ID: 1093587439

View in Genome Browser
Species Human (GRCh38)
Location 12:20856869-20856891
Sequence CTCAAGTCCTTTAGGTAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1702
Summary {0: 1, 1: 5, 2: 107, 3: 461, 4: 1128}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093587439_1093587441 -7 Left 1093587439 12:20856869-20856891 CCTTTTTACCTAAAGGACTTGAG 0: 1
1: 5
2: 107
3: 461
4: 1128
Right 1093587441 12:20856885-20856907 ACTTGAGCATCCACAAATCTTGG 0: 2
1: 19
2: 91
3: 307
4: 810
1093587439_1093587443 28 Left 1093587439 12:20856869-20856891 CCTTTTTACCTAAAGGACTTGAG 0: 1
1: 5
2: 107
3: 461
4: 1128
Right 1093587443 12:20856920-20856942 ATCTTAGAACCAATAACCAGTGG 0: 1
1: 0
2: 1
3: 12
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093587439 Original CRISPR CTCAAGTCCTTTAGGTAAAA AGG (reversed) Intronic
900961596 1:5925369-5925391 CTCAAGTCCCTTATATAAAATGG - Intronic
901711601 1:11119921-11119943 CTCAAGTGCCTTATATAAAATGG + Intronic
901760401 1:11467493-11467515 TTCAAGTCCTGCAGGAAAAATGG + Intergenic
902085693 1:13859801-13859823 CTCCAGTCCCTTATATAAAATGG - Intergenic
902231908 1:15033159-15033181 CTCAAGTCCTTTATATAAAATGG - Intronic
902582619 1:17418033-17418055 CTCAAGTACCTTATATAAAATGG - Intronic
902910797 1:19595852-19595874 CTCAAGTCCCATATATAAAATGG + Intergenic
903095494 1:20968851-20968873 TTCAAGTTCATTATGTAAAATGG - Intronic
903841002 1:26240378-26240400 CTCAAGTCCCTGATATAAAATGG + Intronic
903940757 1:26929551-26929573 CTCAAGTCCCTTATATAAAATGG - Intronic
903967031 1:27097284-27097306 CTCAAGTTCCTGATGTAAAATGG - Intergenic
904790417 1:33016145-33016167 CTCAAGTCCCTGATATAAAATGG + Intronic
904926423 1:34052412-34052434 CTTAAGTCCCTTATTTAAAATGG - Intronic
904946527 1:34203035-34203057 CTCAAGTCCCTAATATAAAATGG - Intronic
905082806 1:35339604-35339626 CTCAAGTCTCTTATATAAAATGG - Intronic
905141295 1:35846871-35846893 CTCAAGTCCCTGATATAAAATGG + Intronic
905805452 1:40873805-40873827 ATCAATTCCTTTCTGTAAAATGG - Intergenic
905910675 1:41651597-41651619 CTCAAGTCCTTTATATAAAATGG - Intronic
906010691 1:42522022-42522044 TTCAAGGCCTTTATATAAAATGG + Intronic
906263211 1:44408158-44408180 ATCAACTCTTTTAGGGAAAACGG - Intronic
906407760 1:45555614-45555636 CTCCAGTCCCTTATATAAAATGG - Intronic
906624913 1:47317029-47317051 CTCAAGTCTTTTATATAAAATGG - Intergenic
906645442 1:47471226-47471248 CTCAAGTCATTTCCATAAAAAGG + Intergenic
906653351 1:47530022-47530044 CTCAAGTCCCTTATATAAAATGG + Intergenic
906843761 1:49168074-49168096 CTCAAGTCCCTTATATAAAATGG - Intronic
906941663 1:50261013-50261035 CTCAACTCCTTTAGCAAAATGGG - Intergenic
907039846 1:51249045-51249067 CCCAAGTCCCTTATATAAAATGG - Intronic
907136745 1:52146217-52146239 CTCAAATCCCTTATATAAAATGG - Intronic
907393764 1:54175839-54175861 CTCGAGTCCTTGATATAAAATGG - Intronic
907420949 1:54346925-54346947 CTTGAGTCCTTTACATAAAATGG + Intronic
907538817 1:55193253-55193275 CTCAAATCCCTTATATAAAATGG - Intronic
907749459 1:57248071-57248093 CTCAAGTCCCTGACATAAAATGG + Intronic
907752767 1:57279228-57279250 TTCAAGTTCTTTATATAAAATGG + Intronic
907790811 1:57661631-57661653 CTGAAGTCCCTTATATAAAATGG + Intronic
907799074 1:57746611-57746633 CTCAAATCCTTTATATAAAATGG + Intronic
907879293 1:58530190-58530212 CTCAAGTCCTTGATAAAAAATGG - Intronic
907967269 1:59344637-59344659 CTCAAGTCCCTGATGTAAAATGG + Intronic
908103623 1:60816840-60816862 CTCTAGTCCTTTAGGTAAGATGG + Intergenic
908185364 1:61647727-61647749 CTCAAGCCCATTACATAAAATGG - Intergenic
908272255 1:62433477-62433499 CTCAAGTCCCATATATAAAATGG - Intergenic
908352316 1:63298509-63298531 CTGAAGTCCCTTATATAAAATGG - Intergenic
908482539 1:64556361-64556383 CTCACAACCTTTAGGTGAAAGGG + Intronic
908750428 1:67417389-67417411 CTCATGTCCATTATATAAAATGG - Intronic
908812157 1:67993023-67993045 CTCAAGTCCCTTATGTAAACTGG + Intergenic
908822141 1:68099544-68099566 CTCAAGTCCCTTATGTAAAATGG + Intronic
909001186 1:70219584-70219606 CTCAAATCCCCTATGTAAAATGG - Intronic
909112003 1:71491285-71491307 CTCAAGTCCCTGATGTAAAGTGG - Intronic
909167863 1:72251512-72251534 CTCAAGTCTCTTATATAAAACGG + Intronic
909650912 1:77974942-77974964 CTCAAGTTCCTTATATAAAATGG + Intronic
909858929 1:80578695-80578717 CTCAAGTCCCCTATATAAAATGG + Intergenic
910130864 1:83903521-83903543 CTCAAGTCCATGATATAAAATGG + Intronic
910148055 1:84106103-84106125 CTCAAGTCCCTTATGTCAAATGG - Intronic
910189124 1:84576673-84576695 CTCAAGTCCCTTATATAAAATGG - Intergenic
910206251 1:84751647-84751669 CTCAAGTCCCTTATATAAAACGG + Intergenic
910252274 1:85210257-85210279 CTCAAGTCCCTTATATAAAATGG + Intergenic
910463019 1:87468563-87468585 CTCAAGTCCCTTATATAAAATGG - Intergenic
910568355 1:88671808-88671830 CTCAAATCCCTTGTGTAAAATGG - Intergenic
910578400 1:88793686-88793708 CTCAAGTCCTTTATATAAAATGG + Intronic
910834298 1:91492692-91492714 CTCAAGTCCCTTATATAAAATGG + Intergenic
910882590 1:91935752-91935774 CTCAAGTCCCTGATATAAAATGG - Intergenic
911139733 1:94486246-94486268 CTCAAGTCCCTGATGAAAAATGG - Intronic
911617886 1:100035134-100035156 CTAAAGTCCCTTACATAAAATGG + Intergenic
911763680 1:101646571-101646593 CTCAAGTCCTTTATATAAAATGG + Intergenic
911804150 1:102184464-102184486 CTCAAGTCCCTTATATAAAATGG - Intergenic
911857363 1:102896614-102896636 TCCAAATCCTTTAGGTAAAGCGG - Intronic
912029726 1:105225388-105225410 CTCAAGTCTTTTACATAAAATGG - Intergenic
912072367 1:105827336-105827358 CTTAAGCCCTTTAGGTAAAATGG + Intergenic
912423227 1:109562342-109562364 CTCAAGTCCCTTACATAAAATGG - Intronic
912515312 1:110213107-110213129 CCTAACTCCTTTAGGTGAAAGGG + Intronic
912740461 1:112190193-112190215 CTCAAGTCCCTTATATCAAATGG + Intergenic
912873446 1:113330924-113330946 CTCAAGTCCCTGATATAAAATGG + Intergenic
912915248 1:113808207-113808229 ATCAAGTCCTTCATATAAAATGG + Intronic
912921077 1:113867924-113867946 CTCAAGTCCCTCATATAAAATGG + Intronic
913050249 1:115111187-115111209 CTCAAGTCCCTTATGTAAAATGG + Intergenic
913139038 1:115922152-115922174 CTCAGGTCCTCTCTGTAAAATGG + Intergenic
913281863 1:117193139-117193161 CTCAAGTTCCTTATATAAAATGG - Intronic
913312495 1:117515311-117515333 CTCAAATCCTTGATATAAAATGG - Intronic
913321442 1:117591465-117591487 CCCAAGTCCCTCAGGAAAAAAGG + Intergenic
913420841 1:118667190-118667212 CACATGTCTTTTTGGTAAAATGG - Intergenic
913460028 1:119075360-119075382 CTCAAGTTCCTTATATAAAATGG - Intronic
914435634 1:147656995-147657017 CTCAAGTCCCTTTTATAAAATGG - Intronic
914985834 1:152456396-152456418 CTCAAATCCCTCACGTAAAATGG + Intergenic
915389212 1:155525847-155525869 CTCAAGTCACTTATATAAAATGG + Intronic
915853870 1:159359642-159359664 CTCAAGTCCGTTATATCAAATGG - Intergenic
915880982 1:159671070-159671092 CATAAGGCATTTAGGTAAAAAGG + Intergenic
916302059 1:163286279-163286301 CTCAAGTCCCTTATGTAAAATGG - Intronic
916424431 1:164667287-164667309 GGCAAGTCCCTTAGCTAAAAAGG - Intronic
916734971 1:167599432-167599454 CCCAAGTCCCTTATATAAAATGG + Intergenic
916846157 1:168652299-168652321 TTCAAGTAGTTTAGCTAAAAAGG - Intergenic
916851415 1:168708014-168708036 CTCAAGTCCTTGATCTAAAATGG + Intronic
917004075 1:170392773-170392795 CTCAAATCCCTTATATAAAATGG + Intergenic
917009064 1:170450460-170450482 CTCAAGTCCCTTATATAACATGG - Intergenic
917169724 1:172157797-172157819 CTCAAGTCCCTTATATAAAATGG - Intronic
918399547 1:184149977-184149999 CTCAAGTCCCTTACATAAAATGG + Intergenic
918666804 1:187161644-187161666 CTCAAGTGCCTTATATAAAATGG - Intergenic
918758973 1:188376978-188377000 CTCAAGTCCCTTACATAAAATGG + Intergenic
919092926 1:192995781-192995803 CTCAAGACCATTAGATAAGAAGG + Intergenic
919107805 1:193175741-193175763 CTCAAGTCCCTTTTATAAAATGG - Intronic
919120862 1:193338756-193338778 CCCAAGTCCTTTATATAAAATGG - Intergenic
919231303 1:194778325-194778347 CTCAAGTCTTTGATATAAAATGG + Intergenic
919444084 1:197679504-197679526 CTTAAGTCCTTTATATAAAATGG - Intronic
919955738 1:202413388-202413410 CTTAAGTCCTGTAGTTACAAGGG + Intronic
920222271 1:204412300-204412322 GTCAAGTCCCTTATGTAAAATGG + Intergenic
920322101 1:205132152-205132174 CTCAGGTCTCTTAGGCAAAAGGG + Intergenic
920385219 1:205566672-205566694 CTCAAGTCCCTGATATAAAATGG - Intergenic
920765011 1:208823887-208823909 CTCAAGTCCCTTATATAAAATGG + Intergenic
920886038 1:209929001-209929023 CTTAAGTTCTTTATATAAAATGG - Intergenic
921142130 1:212318881-212318903 CTCAAGTCCCTTATGTAAAATGG - Intronic
921186045 1:212670400-212670422 CTCAAGTCCCTGACATAAAATGG - Intergenic
921186407 1:212673530-212673552 CTCCAGTCCCTTATATAAAATGG + Intergenic
921210312 1:212890590-212890612 CTCAAGGCCTTTATATGAAATGG - Intronic
921907230 1:220508070-220508092 CTCAAGTCTTTTGTATAAAATGG - Intergenic
921934014 1:220779397-220779419 CTCCATTTCTTTGGGTAAAATGG + Intronic
922003038 1:221500366-221500388 CTCAAGTACTTTATATAAAATGG + Intergenic
922283497 1:224147583-224147605 CTCAAGTCCTTTATATAAAATGG - Intronic
922302053 1:224310316-224310338 CTCAAGTCCCTTACATAAAATGG - Intronic
922434415 1:225589502-225589524 CTCAAGTCCCTTACATAAAATGG + Intronic
922883094 1:228997342-228997364 ATGAAGTGCTATAGGTAAAAAGG + Intergenic
922998230 1:229983961-229983983 CTCAAGTCCCTGATATAAAATGG - Intergenic
923173366 1:231438390-231438412 CTCAAGTTCCTTATATAAAATGG - Intergenic
923371952 1:233323340-233323362 CTCAAGTCCCATATGTAAACTGG + Intergenic
923374772 1:233350077-233350099 CTCAAGTCCCTGATATAAAAAGG + Intronic
923573037 1:235133759-235133781 CTGAAGTCCCTTATATAAAATGG - Intronic
923612526 1:235507421-235507443 CTCAAGTCCCTTATATAAAATGG + Intergenic
923633051 1:235667604-235667626 CTCAAGTCCTTGATATAAAATGG + Intronic
923689728 1:236180126-236180148 CTCAAGTCCCTGATATAAAATGG + Intronic
923738526 1:236634751-236634773 CTCAAGTCCTTTATACAAAGTGG + Intergenic
923926448 1:238633165-238633187 CTCAAGTCCTTTATATAAAATGG + Intergenic
923958608 1:239051578-239051600 CTCAAGTCCTAGATATAAAATGG - Intergenic
924004662 1:239595281-239595303 CTCAAGTCCGTGATATAAAATGG - Intronic
924026072 1:239834048-239834070 CATAAGTCATTTAGTTAAAAGGG - Intronic
924142810 1:241043854-241043876 CTCAAGTCCTTTTTATAAAATGG - Intronic
924152863 1:241146368-241146390 CTCAAGTCTCTTATATAAAACGG - Intronic
924357695 1:243200194-243200216 CTCAAGTTCCTTATGTAAAATGG - Intronic
924405567 1:243742119-243742141 CTCAAGTCCCTTATATACAATGG - Intronic
924413303 1:243830296-243830318 CTCAAATCCCTTACATAAAATGG - Intronic
924542794 1:244996924-244996946 CTGAAGTCCCTTACATAAAATGG + Intronic
924687014 1:246303409-246303431 CTCAAGTCCCTTAGATTACATGG + Intronic
924699639 1:246438570-246438592 CTCAAGTCCCTTCTATAAAATGG + Intronic
924820549 1:247485715-247485737 CTCAAGTCCCTTGTATAAAATGG + Intergenic
1062794273 10:331655-331677 CTCAAGTCCCTGATATAAAATGG - Intronic
1063444282 10:6099500-6099522 CCCAAGTCCCTTATATAAAATGG + Intronic
1063633657 10:7759387-7759409 CTTAAATCCTTTATGAAAAAAGG + Intronic
1063649606 10:7919612-7919634 CTCAAGTCCCTTATGTAAAATGG + Intronic
1064412626 10:15120523-15120545 CTCAAGTCCCTTATATAAGATGG - Intronic
1064553984 10:16529749-16529771 GTCCAGTCCTTTAGGGAAAGTGG - Intergenic
1064666125 10:17653776-17653798 CTCAAGTCCCTAATATAAAATGG - Intronic
1064771873 10:18731561-18731583 CACAAGTCCTTGATATAAAATGG + Intergenic
1065144860 10:22758565-22758587 CTCAAGTCCCTAATATAAAATGG - Intergenic
1065374151 10:25019643-25019665 TGCAAGTCCTTTATATAAAATGG - Intronic
1065498205 10:26351465-26351487 TTGAAGTCCCTTATGTAAAATGG + Intergenic
1065540758 10:26764860-26764882 CTCAAGTCCTTTCTATAAACTGG - Intronic
1065633721 10:27709365-27709387 CTCAAGTCTCTTATGTAAAATGG - Intronic
1065818665 10:29505925-29505947 CTCAAGTCCCTGATGTAAAATGG + Intronic
1065954255 10:30678471-30678493 CTCAAGTCCCTGAAATAAAATGG - Intergenic
1066178303 10:32934417-32934439 CTCAAGTCCCTGATATAAAATGG - Intronic
1066451683 10:35535825-35535847 CTCAAGTCCCTGATATAAAATGG - Intronic
1066534724 10:36379389-36379411 CTCAAGTCCCATATATAAAATGG - Intergenic
1067349894 10:45466145-45466167 CTCAAGGCCTTTTAGTACAATGG + Intronic
1067364330 10:45610985-45611007 CTCAAGTCTCTTATATAAAATGG + Intergenic
1067727678 10:48783195-48783217 CTCAAGTCCCTTAAATAAAATGG + Intronic
1067763410 10:49067891-49067913 CTCAAGACCCTTATATAAAATGG + Intronic
1067973301 10:50994989-50995011 CTCAAGTCCTTTATATAAAATGG - Intronic
1067992489 10:51230625-51230647 CTCAAGTCTTTGACATAAAATGG + Intronic
1068033816 10:51735610-51735632 CTCAAGTCCCTGATATAAAATGG + Intronic
1068042250 10:51839946-51839968 CTGAACTCCATTAGTTAAAATGG - Intronic
1068073689 10:52227564-52227586 CTCAAGTCCCTGATATAAAATGG - Intronic
1068406759 10:56599577-56599599 CTCAAATCCGTTATATAAAATGG + Intergenic
1068501343 10:57842652-57842674 CTCAAGTCCCTGATATAAAATGG - Intergenic
1068700770 10:60017423-60017445 CTCAAGTCCCTGATATAAAATGG - Intergenic
1068865858 10:61895286-61895308 CTCAAGTCCCTTATATAAGATGG - Intergenic
1068905368 10:62316293-62316315 CTTAAGTCCTTGATATAAAATGG - Intergenic
1068936615 10:62641319-62641341 CTCAAGTCCCTTATATAAAATGG - Intronic
1069346284 10:67474187-67474209 CTCAAGTCCTTTATATAAAATGG - Intronic
1069429389 10:68320492-68320514 CTCAAGTCCATTATATAAAATGG + Intronic
1069570248 10:69490337-69490359 CTCAAGTCCTTTATATAAAATGG + Intronic
1069650816 10:70046808-70046830 CTCAAGTCCCTTATATAAAATGG + Intergenic
1069710138 10:70482755-70482777 CTCAAGTCCCTTGTGTAACAGGG + Intronic
1069816803 10:71201714-71201736 CTCAAGTCCCTTATATAAAATGG + Intergenic
1070002622 10:72392143-72392165 CTCAAGTCCCATATGTGAAACGG - Intronic
1070021006 10:72585820-72585842 CTCAAGTATCTTATGTAAAATGG + Intronic
1070192703 10:74127153-74127175 CTCGAGTCCCTTACATAAAATGG - Intronic
1070271026 10:74955066-74955088 CTCAAGTCCCTTATGTAAAATGG + Intronic
1070659797 10:78296743-78296765 CTCAAGTCTTTTATGTAAAATGG + Intergenic
1070957854 10:80475976-80475998 CTCAAGTCCCTAATATAAAATGG + Intronic
1070978512 10:80625368-80625390 CTTAAGTTCTTTATGTAAAATGG + Intronic
1071052065 10:81462364-81462386 CTCAAGTCCCTGATATAAAATGG + Intergenic
1071995837 10:91148400-91148422 CTCAAGTCCTTTACAGAGAAGGG + Intergenic
1072109171 10:92301675-92301697 CTCAAGTCCCTGATATAAAATGG + Intronic
1072131376 10:92497455-92497477 CTCAAGTCCCTTATATTAAATGG - Intronic
1072179765 10:92970427-92970449 CTGAAGTCCTTTATATAAAATGG - Intronic
1072298194 10:94033121-94033143 CTCAAGTCCCTTATGTAAGATGG - Intronic
1072437180 10:95424613-95424635 CTCAAGTCCCTTATATAAAATGG - Intronic
1072515054 10:96173142-96173164 TTCAAATCCCTTATGTAAAATGG - Intronic
1072678598 10:97488518-97488540 CTCAAGACCCTTATATAAAATGG + Intronic
1072768606 10:98116998-98117020 CTCCAGTCCCTTATATAAAATGG + Intergenic
1072921418 10:99580101-99580123 CTCAAGTCCTTTGTGAAAAGAGG - Intergenic
1072977500 10:100071840-100071862 CTCAAGTCCCTTATATAAAATGG - Intronic
1073090646 10:100935706-100935728 CTAAATTCCTGTATGTAAAAAGG + Intronic
1073145273 10:101276725-101276747 CTCAGGTCCTTTGGGTATCAGGG - Intergenic
1074131333 10:110580191-110580213 CTCAAGTCCCTTATATAAAATGG - Intronic
1074464576 10:113669873-113669895 CTCAAGTTCCTTATATAAAATGG + Intergenic
1074483193 10:113846665-113846687 CTCAAGTCCTTTATACAAAATGG + Intronic
1074591531 10:114818371-114818393 CTCAAGTCCCTAATGTAAAATGG - Intergenic
1074609716 10:115009945-115009967 CTCAAGTCCCTTATATATAATGG - Intergenic
1074812691 10:117121674-117121696 TCCAAGTCCTTAATGTAAAATGG + Intronic
1074841923 10:117361945-117361967 CTCAAGTCCCTGATATAAAATGG - Intronic
1074915245 10:117949219-117949241 TTCAAGTCCCTTATATAAAATGG + Intergenic
1075063097 10:119270508-119270530 CTCAAGTCCCTGATATAAAATGG - Intronic
1075133619 10:119762698-119762720 TTCAAGTCCCTTATGTAAAATGG - Intronic
1075135406 10:119780881-119780903 CTCAAGTCTCTCATGTAAAATGG - Intronic
1075180483 10:120206649-120206671 CTCAAGTCCTTTATACCAAATGG - Intergenic
1075278501 10:121117890-121117912 CTCAAGTCCCTGATATAAAATGG - Intergenic
1075323089 10:121508086-121508108 CCCAAGACCTTTATTTAAAATGG - Intronic
1075503799 10:123003381-123003403 CTCCAGTCCTTTATATAAAATGG - Intronic
1075507878 10:123041810-123041832 CTCAAGTACCTTACATAAAATGG - Intronic
1075556986 10:123440404-123440426 CTAAAGTCCTTTAGTTTAAGGGG - Intergenic
1076177756 10:128381434-128381456 CTCAAGTCTCTTATATAAAATGG + Intergenic
1076632841 10:131862033-131862055 CTCAAGTCCCGTATTTAAAATGG + Intergenic
1077670011 11:4148581-4148603 CTCAAGTCCCTTATATAAAATGG + Intergenic
1077802526 11:5555231-5555253 GTAAAGTCCTTCAGGTAAGAAGG + Intronic
1077825338 11:5802194-5802216 ATCAAGTCCTTTATATAAAATGG - Intronic
1077882640 11:6363432-6363454 CTCAAGTCCTTTAGTTACCATGG + Intergenic
1077991562 11:7416702-7416724 CTCAGGTCCCTTATATAAAATGG - Intronic
1078141316 11:8695187-8695209 CTCAAGTCCCTTCTATAAAATGG - Intronic
1078306590 11:10194395-10194417 CTCAAGTTCCTTATATAAAATGG - Intronic
1078519977 11:12055043-12055065 CTCAAGTCCCTTATATAAAATGG + Intergenic
1078556772 11:12334218-12334240 CTCAAGTCCCTGATATAAAATGG + Intronic
1078813148 11:14791813-14791835 CTTGAGTCCTTTATATAAAATGG + Intronic
1078864442 11:15283578-15283600 CTCAAGTCTCTTATGTAAAATGG + Intergenic
1078941208 11:16008037-16008059 CCCAAGTCCCTTATATAAAATGG + Intronic
1078955559 11:16190563-16190585 CTCAAGTTCCTTATGTAAAATGG - Intronic
1079197031 11:18337751-18337773 CTCAAGTCCGTTAGATAAAATGG - Intronic
1079908191 11:26275832-26275854 TTAAAGTTCTTTAGCTAAAAAGG - Intergenic
1080067619 11:28037506-28037528 CTCAAGTCCCTTACATAAAATGG - Intronic
1080080488 11:28212543-28212565 CTCAATTCCCTTACATAAAATGG + Intronic
1080275114 11:30494972-30494994 CTCAAGTCTTTTATATAAAATGG - Intronic
1080340817 11:31261645-31261667 CTCAGGTCCCTTATATAAAATGG - Intronic
1080544563 11:33303166-33303188 CTCAAGTCCCTTATATAAAATGG + Intronic
1080555846 11:33416624-33416646 CTCAAGTCCCTTATATAAAATGG - Intergenic
1080826678 11:35854536-35854558 CTTAAGTCCCTTATATAAAATGG - Intergenic
1080936673 11:36870943-36870965 CTCAAGTCCCTTATATAAAATGG - Intergenic
1080999980 11:37656643-37656665 CTCAAGTTTCTTATGTAAAATGG - Intergenic
1081104893 11:39054162-39054184 CTCAAGTACTTTTTGTAAAATGG - Intergenic
1081563387 11:44239906-44239928 CGCAAGTCCATTATATAAAATGG + Intronic
1081630093 11:44683529-44683551 CTCAAGTCCCTTATATAAAATGG + Intergenic
1081643178 11:44771803-44771825 CTCAAGTCCCTGATATAAAATGG - Intronic
1082189234 11:49222479-49222501 CTCAAGTCCCTTATGTAAAATGG + Intergenic
1082845832 11:57724719-57724741 CATAAGACATTTAGGTAAAAGGG - Intronic
1083390730 11:62348143-62348165 CTCAAGTCCTCTACGTGAAATGG - Intronic
1083564638 11:63703248-63703270 CTCAAGTCCTGTGTATAAAATGG - Intronic
1084336033 11:68458340-68458362 CTCAAGTCCCATATATAAAATGG + Intergenic
1084362828 11:68680034-68680056 CTCAAGTCCCTTATATAAAATGG + Intergenic
1084616356 11:70238919-70238941 CTCAAGTCACTTATATAAAATGG - Intergenic
1085080057 11:73626497-73626519 CTCAAATCCCTTATATAAAATGG + Intergenic
1085231816 11:74978552-74978574 CTCAAGTCCCTTATATAAAATGG + Exonic
1085355986 11:75837360-75837382 CTCAAGTCCCTGATATAAAATGG + Intronic
1085770778 11:79324030-79324052 CTCAAGTCCGTTATATAAAATGG + Intronic
1085811005 11:79681063-79681085 TTCAAGCACTTTATGTAAAATGG - Intergenic
1086100526 11:83094678-83094700 TTCAAGTCCCTTATATAAAATGG - Intergenic
1086113877 11:83226940-83226962 CCCAAGTCCCTTATATAAAATGG - Intronic
1086253294 11:84843593-84843615 CTCAAGTCCTTTATATAAAATGG + Intronic
1086677288 11:89624118-89624140 CTCAAGTCCCTTATGTAAAATGG - Intergenic
1086725982 11:90185041-90185063 CTCAACTCCCTTATATAAAATGG - Intronic
1086846743 11:91759591-91759613 CTCAAGTCTTTTGTGTAAAATGG - Intergenic
1087117232 11:94538717-94538739 CTCAAGTCCCTTATATAAAATGG - Intergenic
1087176999 11:95105273-95105295 CTCAAGTCCCTTATGTAAAATGG + Intronic
1087253167 11:95926109-95926131 CTCAAGTCTCTTAAATAAAATGG - Intergenic
1087317671 11:96623094-96623116 CTCAAGTCCCTTGTTTAAAAAGG - Intergenic
1087522963 11:99266728-99266750 CTCAAGTCCCTTATAAAAAATGG - Intronic
1087778537 11:102278862-102278884 CTCAAGTCCCTGATATAAAATGG - Intergenic
1087924261 11:103901164-103901186 CTCAAGTCCCTTATCTAAAATGG + Intergenic
1088062009 11:105665333-105665355 CTCAGTTTCTTTACGTAAAATGG - Intronic
1088396190 11:109372336-109372358 CTGAAGTCCCTTACATAAAATGG - Intergenic
1088477732 11:110260723-110260745 CTCAAGTCCCTGATATAAAATGG + Intronic
1088777313 11:113098302-113098324 CTCAAGTCCCTGATGTAAAATGG + Intronic
1089213933 11:116824117-116824139 TTCAAGTCCTTGATATAAAATGG + Intergenic
1089262922 11:117234895-117234917 CTCAAGTCCCTTACATAAAATGG + Intronic
1089722218 11:120436768-120436790 CTCAAGTCCCTGATATAAAATGG - Intronic
1089968983 11:122677253-122677275 CTCAAGTCCTTGATATAAAATGG - Intronic
1090110529 11:123903227-123903249 CTCAAGTCCCTGATTTAAAATGG - Intergenic
1090127574 11:124104097-124104119 CTCATGTCCCTTATTTAAAATGG + Intergenic
1090261148 11:125321352-125321374 CTCAAGTCCCTTATATAAAATGG + Intronic
1090298798 11:125615647-125615669 CTCAAGTCCCTTATATAAAATGG - Intronic
1090298867 11:125616217-125616239 CTCAGGTCCCTTATATAAAATGG + Intronic
1090378642 11:126309403-126309425 CTCAAGTCCCTGATATAAAATGG + Intronic
1090619187 11:128546453-128546475 CTCAAGTCCCTGATATAAAATGG + Intronic
1090782357 11:130018835-130018857 CACAAGTCCCTTATATAAAATGG - Intergenic
1090957865 11:131529765-131529787 ATCAAGTCCATTAGGTACAGGGG - Intronic
1091093645 11:132796128-132796150 CTCAAGTTCTTGATATAAAATGG - Intronic
1091535950 12:1409639-1409661 CTCAAGTCCCTTATATAAAATGG + Intronic
1091548691 12:1521555-1521577 CTCAAGTCCCTAATATAAAATGG + Intergenic
1091646888 12:2279872-2279894 CTCATGTCCCTTATATAAAATGG - Intronic
1091742419 12:2969358-2969380 CTCAAGTCCCTCATATAAAACGG - Intronic
1091796886 12:3302521-3302543 CTCAAGTCCCTGATATAAAATGG + Intergenic
1091812784 12:3413907-3413929 TTCAAGTCCCTTATATAAAATGG - Intronic
1091872200 12:3903165-3903187 CTCAAGTTCCTTATATAAAATGG + Intergenic
1092111933 12:5970305-5970327 CCCAAGTCTTTTAGGTAAGATGG + Intronic
1092267382 12:6992832-6992854 CTCAAGTCCCTTATATAATATGG + Intronic
1092454238 12:8628113-8628135 CTCAAGTCCTTTATACGAAATGG - Intergenic
1092655905 12:10685356-10685378 CTCAAGTCCCTTATATAAAGTGG - Intergenic
1092760692 12:11808605-11808627 CTCAAATCCCTTATATAAAATGG - Intronic
1092893340 12:12989978-12990000 CTCAAGTCCCTGATATAAAATGG + Intronic
1092966727 12:13650985-13651007 ATGAAGTCCTTTAGGTTAAATGG - Intronic
1093059253 12:14585824-14585846 CTCAAGTCCCTTATATAAAATGG - Intergenic
1093204137 12:16226111-16226133 CTCAAGTGTATTATGTAAAACGG + Intronic
1093263144 12:16966059-16966081 CTCAAGTCTCTTATATAAAATGG + Intergenic
1093304722 12:17500626-17500648 CGCAATTCCTTTATATAAAATGG + Intergenic
1093369885 12:18354229-18354251 CTCAAGTCCTGTAGGTAGAAGGG + Intronic
1093422426 12:18989720-18989742 TTCAAGTCCCTTATATAAAATGG + Intergenic
1093557847 12:20498560-20498582 CTCAAGTCCCTGATATAAAATGG - Intronic
1093587439 12:20856869-20856891 CTCAAGTCCTTTAGGTAAAAAGG - Intronic
1093600602 12:21017112-21017134 TTCAAGTTCCTTAAGTAAAAAGG - Intronic
1093601625 12:21032871-21032893 CTCACGTCCCTTATATAAAATGG - Intronic
1093656476 12:21700291-21700313 CTCAAGTCCCTTATACAAAATGG + Intronic
1093668394 12:21842012-21842034 CTCAAGTCCGTTATATAAAATGG + Intronic
1093724621 12:22489588-22489610 CTCAAGTCCCTTATATAAAATGG - Intronic
1093773330 12:23042802-23042824 TTCAAGTCTCTTATGTAAAATGG - Intergenic
1093811293 12:23495285-23495307 CCCAAATCCTTTCTGTAAAAAGG - Intergenic
1093897294 12:24588599-24588621 CTCAAGTTCCTTATATAAAATGG + Intergenic
1093915597 12:24799178-24799200 CTCAAGCCCTTTAGTGAAAGAGG + Intergenic
1094183784 12:27619201-27619223 CTCAAGTCCCTGATATAAAATGG + Intronic
1094247675 12:28319550-28319572 CTCAAGTCCCTGATATAAAATGG + Intronic
1094249154 12:28339664-28339686 CTCAAGTCTCTTATATAAAATGG - Intronic
1094481155 12:30882542-30882564 CTCAAGTCCCTTATATAAAATGG + Intergenic
1094573306 12:31661166-31661188 CTCAAGTCCCTTATATAAAATGG - Intronic
1094610205 12:31988497-31988519 CTTAAGTTCCTTATGTAAAATGG - Intronic
1094618591 12:32058768-32058790 CTCAAGTTCCTTATATAAAATGG - Intergenic
1095172253 12:39049619-39049641 CTCAAATCCTTGATATAAAATGG + Intergenic
1095179585 12:39131924-39131946 CTCAAGTCCCTTATATAAAATGG - Intergenic
1095202371 12:39399311-39399333 CTCAAGTCCCTTACATAAAATGG - Intronic
1095342015 12:41101281-41101303 CTCAAGTTCCTTATATAAAATGG - Intergenic
1095365843 12:41404002-41404024 CTGAAGTTCTTTATATAAAATGG + Intronic
1095457802 12:42407657-42407679 CTCAAATCCCTTATGTAAAATGG + Intronic
1095543208 12:43334905-43334927 CTCAAGTCCTTGACATAAAATGG + Intergenic
1095998769 12:48112039-48112061 GTCAAGTCATTTGGATAAAAAGG + Intronic
1096440717 12:51641251-51641273 CTCAAGTCTCTTATGTAAAATGG - Intronic
1096711878 12:53463600-53463622 TTCAAGTCTTTTACATAAAATGG - Intronic
1096727114 12:53573338-53573360 CTCAAGTCCCTGATATAAAATGG + Intronic
1096929431 12:55190023-55190045 CTCTAGAACTTTAGTTAAAATGG + Intergenic
1097097925 12:56564663-56564685 TTCAAGTCCCTTAGATAAAATGG + Intronic
1097130537 12:56807991-56808013 CTTAAGTCCTGTAGAGAAAAGGG + Intergenic
1097140932 12:56902068-56902090 CTTAAGTCCTGTAGAGAAAAGGG - Intergenic
1097311198 12:58121447-58121469 CTCAAGTCCCTGATATAAAATGG + Intergenic
1097632296 12:62079037-62079059 CTCGAGTCCTTTAGAAAGAAAGG - Intronic
1097655609 12:62358878-62358900 CTCAAGTTCTTGATATAAAATGG - Intronic
1097672061 12:62552147-62552169 CTCAAGTCTGTTATATAAAATGG - Intronic
1097748047 12:63320865-63320887 CTCAAGTCCCTGATATAAAATGG + Intergenic
1098254013 12:68598305-68598327 CTCAAGTCCCTTATATAAAATGG - Intergenic
1098508280 12:71281260-71281282 CTCAAGTTCCTGATGTAAAATGG - Intronic
1098549403 12:71746690-71746712 CTCAAGTCTGTTATATAAAATGG - Intergenic
1098593817 12:72247089-72247111 CTCAAGTCCCTTATATAAAATGG + Intronic
1098718377 12:73861603-73861625 CTCAAATCCCTTATATAAAATGG - Intergenic
1098896688 12:76070750-76070772 TTCAAGTCCCTTATATAAAATGG + Intronic
1099638095 12:85242477-85242499 CTCATGTCCCTTATATAAAATGG - Intronic
1099953690 12:89331974-89331996 CTCAAGTCCCTTATATAAAATGG - Intergenic
1100383716 12:94085987-94086009 CTCAAGTCCCTGATATAAAATGG - Intergenic
1100502907 12:95191675-95191697 CTCAAGTCCCTTATATAAAATGG + Intronic
1100506124 12:95222005-95222027 CTCAAGTCCCTTATATAAAATGG - Intronic
1100556372 12:95698091-95698113 CTCAAGTCCCTTATATGAAATGG - Intronic
1100577297 12:95905009-95905031 CTCAAGTCGCTTATGTAAAATGG + Intronic
1100782538 12:98044506-98044528 CTTAAGTCTTTTATTTAAAATGG + Intergenic
1100847505 12:98675695-98675717 CTCAAGTCTCTTACATAAAATGG - Intronic
1101180882 12:102216818-102216840 CTCATGTCCCTTATATAAAATGG + Intergenic
1101341207 12:103842542-103842564 CTCAAGTCCTTTATATAAAATGG + Intronic
1101366878 12:104080298-104080320 CTCAAGTCCCTGATATAAAATGG + Intronic
1101454604 12:104816887-104816909 CTCAAGTCCTTTACATAAAATGG + Intronic
1101455947 12:104830290-104830312 CTGAAGTCCCTTATATAAAATGG + Intronic
1101479200 12:105081120-105081142 TTCAAGTCCCTTATATAAAACGG - Intronic
1101665843 12:106813497-106813519 CTCAAGTCTCTTATATAAAATGG - Intronic
1101685393 12:107014804-107014826 CTCAAGTCCCTTATGTAGAATGG + Intronic
1102226517 12:111232570-111232592 CTCAAATCCTTTATACAAAATGG - Intronic
1102488472 12:113274034-113274056 TTCAAGTCCCTTATATAAAATGG + Intronic
1102665321 12:114567326-114567348 CTCAAGTCCTGTATATAAAATGG - Intergenic
1102905168 12:116668894-116668916 CTCAAGTCCTTGATATAAAATGG + Intergenic
1103429560 12:120871450-120871472 CTAAAGTCCTTTATATAAAATGG + Intronic
1103670590 12:122611737-122611759 CTCAAGTCTTTCATATAAAACGG + Intronic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1104692051 12:130833765-130833787 TTCAAGGCCTTTTGGTTAAAAGG - Intronic
1104808753 12:131606939-131606961 CTCAAGTCCCTTATATAAAATGG + Intergenic
1105386226 13:19931933-19931955 ATTAAGTCCTTGAGTTAAAAAGG - Intergenic
1105548634 13:21370803-21370825 CTCAAGTCCCTGATATAAAATGG - Intergenic
1105767537 13:23576613-23576635 CTCAAGTCCCTTACAAAAAATGG + Intronic
1105886057 13:24642586-24642608 CATAAGACATTTAGGTAAAAGGG + Intergenic
1105934183 13:25083505-25083527 CTCAAGTCTGTTATATAAAATGG + Intergenic
1106113047 13:26793655-26793677 CTCAAGTCCCTGAGATAAAATGG + Intergenic
1106148847 13:27078354-27078376 CTCAAGTCCCTGATATAAAATGG - Intronic
1106293100 13:28383922-28383944 CTCAAGTTCCTTATATAAAATGG - Intronic
1106547182 13:30741041-30741063 CTCAAGTCCCTGATATAAAATGG + Intronic
1106654434 13:31727104-31727126 TTCAAGTCCTTGACATAAAATGG - Intergenic
1106756207 13:32825553-32825575 CTCAAGTCCCTGATATAAAATGG - Intergenic
1106798486 13:33231911-33231933 CTCAAGTCCCTGATATAAAATGG + Intronic
1106803282 13:33278909-33278931 CTCAAATCCTCTAGGTAATGAGG + Intronic
1106847252 13:33749405-33749427 CTCAAGTTCCTTATATAAAATGG - Intergenic
1106888645 13:34217984-34218006 AATAACTCCTTTAGGTAAAAAGG + Intergenic
1106957349 13:34954665-34954687 CTCAAGTCGTTTGTATAAAATGG + Intronic
1107067953 13:36236895-36236917 CTCAAGTCCCTTACATAAAACGG + Intronic
1107170580 13:37338068-37338090 ATCAAGTCCCTTATATAAAATGG + Intergenic
1107232115 13:38122342-38122364 CTCAAGTCACTTATATAAAATGG + Intergenic
1107339691 13:39393094-39393116 TTCAAGTCCCTCATGTAAAATGG - Intronic
1107710871 13:43149356-43149378 CTCAAGTCCCTGATATAAAATGG + Intergenic
1107914933 13:45139908-45139930 CTCAAGTCCTTTATATAAAATGG + Intronic
1107924244 13:45243148-45243170 CTCAAGTCCCTTATATAAAATGG + Intronic
1107986252 13:45778889-45778911 CTCAAGTCCCTTATATAAAACGG - Exonic
1108220199 13:48225742-48225764 CTCAAGTCCCTTATATAAAATGG + Intergenic
1108535024 13:51367082-51367104 CTCAAGTCCCTTGTATAAAATGG + Intronic
1108536091 13:51381174-51381196 CTCAAGTCCCTCATATAAAATGG - Intronic
1108699239 13:52929769-52929791 CTCAAGTCCCTTATATAAAATGG - Intergenic
1108742800 13:53356124-53356146 CTCAAGTCCTTTACATAAAATGG - Intergenic
1108744094 13:53372208-53372230 CTCAAGTCTCTTATATAAAATGG + Intergenic
1108951835 13:56104167-56104189 CTCAAGTCCCTGATATAAAATGG + Intergenic
1109226784 13:59706051-59706073 CTCTAGTCCTTGATATAAAATGG + Intronic
1109481505 13:62961514-62961536 CTTAAGTCCTTAATATAAAATGG - Intergenic
1109572278 13:64208630-64208652 CTCAAGTCCCTTATATAAAACGG - Intergenic
1109641222 13:65194182-65194204 CTCAAGTCCCTTATAGAAAATGG + Intergenic
1109818261 13:67617070-67617092 TTCAAGTCCCTTATATAAAATGG - Intergenic
1110243304 13:73292777-73292799 CTCAAGTCCCTGATATAAAATGG + Intergenic
1110243885 13:73299710-73299732 CTCAAGTCCCTGATATAAAATGG + Intergenic
1110348270 13:74475057-74475079 CTCAAGTCCCTTATATAAAATGG - Intergenic
1110484189 13:76019134-76019156 CTCAAGTCCTTGGTATAAAATGG - Intergenic
1110490482 13:76098534-76098556 CTCAAGTCCAGAATGTAAAATGG - Intergenic
1110681241 13:78314763-78314785 CTCAAGTCCCTTATATAAAATGG - Intergenic
1111223226 13:85233817-85233839 GTCAAGTCCCTTATATAAAATGG + Intergenic
1111487134 13:88918750-88918772 CTCAAGTACTTAATATAAAATGG - Intergenic
1111547854 13:89767290-89767312 CTCAAGTTCTTTGTATAAAATGG + Intergenic
1111548637 13:89778845-89778867 CTCAAGTCCTTTATGTAAAATGG - Intergenic
1111551968 13:89825319-89825341 CTCAAGTCCCTTATGTAAAGTGG - Intergenic
1111673243 13:91355329-91355351 CTCAAGTCCCTTATGTAAAGTGG + Intergenic
1111924948 13:94453201-94453223 CTCAAGTCCCTTATATAAAATGG - Intronic
1112062759 13:95757534-95757556 CTTAAGTTCATTGGGTAAAAAGG - Intronic
1112903298 13:104386377-104386399 CTCCAGTCCCTTATATAAAATGG - Intergenic
1112935154 13:104788145-104788167 TTCAAGTCCCTTATATAAAATGG - Intergenic
1113136285 13:107093426-107093448 TTCAAGTCCCTTATGTAAAATGG + Intergenic
1113546532 13:111155117-111155139 CTCAAGTCTTTTATATAAAATGG - Intronic
1113634391 13:111909865-111909887 CTCTAGTCCTTTTGGCAAATGGG + Intergenic
1114135320 14:19842190-19842212 CTCAAATCCCTGAGTTAAAATGG - Intergenic
1114282762 14:21209229-21209251 TTCAAGTCCCTTACATAAAATGG - Intronic
1114890000 14:26908107-26908129 CTCAAGTCCCTGATTTAAAATGG + Intergenic
1114971731 14:28038721-28038743 CTCATGACGTTTTGGTAAAAGGG + Intergenic
1115188529 14:30720772-30720794 CTCAAGTACCTTATGTAAAATGG - Intronic
1115213408 14:30990709-30990731 CTCAAGCCCTTTATATAAAATGG + Intronic
1115322653 14:32100630-32100652 CTGAAGTCCCTTATATAAAATGG - Intronic
1115383723 14:32770798-32770820 CTCAACTCCTTGAGGGTAAAAGG + Intronic
1115433488 14:33347677-33347699 CTCCAGTCCTTGATATAAAATGG + Intronic
1115604680 14:34988842-34988864 CTCAAGTCCCTGATGTAAAATGG + Intronic
1115633952 14:35272835-35272857 CTCAAGTCCCTTATATAAAATGG + Intronic
1115694328 14:35880251-35880273 CTCAAGTCCCTTATATAATATGG + Intronic
1116006861 14:39302264-39302286 CTCATCTCCTTTTGCTAAAATGG + Intronic
1116011059 14:39352609-39352631 CTCAAGTCTCTTATATAAAATGG + Intronic
1116322353 14:43485100-43485122 CACAAGTCTTTAAGGAAAAAAGG - Intergenic
1116400132 14:44496608-44496630 CTCAAGTCCCTCAAATAAAATGG + Intergenic
1116556085 14:46310053-46310075 CTGAAGTCCCTTATATAAAATGG + Intergenic
1116609495 14:47049347-47049369 TTCAAGTCCCTTATATAAAATGG + Intronic
1116793680 14:49366558-49366580 CTCAAGTCCTTGAGAAAAACAGG - Intergenic
1116884482 14:50206384-50206406 CCCAAGTCCTTTATATATAATGG + Intronic
1116960738 14:50965694-50965716 CTCAAGTCCCTGATATAAAATGG + Intergenic
1116966031 14:51016082-51016104 CTCAAGTCCCTGATATAAAATGG + Intronic
1117045815 14:51812026-51812048 CTCAAGTCCTGGATATAAAATGG + Intergenic
1117125975 14:52626153-52626175 TTCAAGTCCCTTACATAAAATGG - Intronic
1117137701 14:52753569-52753591 CTCAAGTCCCTTATATAAACTGG + Intronic
1117370692 14:55075898-55075920 CTCAATTACTTTAGGAAACAGGG + Intergenic
1117851348 14:59973523-59973545 CACAAGTCCATTATATAAAATGG + Intronic
1117937648 14:60925311-60925333 CTTAAGTCCCTTATATAAAATGG - Intronic
1118055455 14:62075066-62075088 CTCAATTTCTCTAGGTAAAAAGG + Intronic
1118117350 14:62795553-62795575 CTGAAGTCCCTTACGTAAAATGG - Intronic
1118580308 14:67289434-67289456 CTCAAGTCCCTTATATAAAATGG - Intronic
1118650575 14:67888795-67888817 CTCAAGTCCCTCATATAAAATGG - Intronic
1118686800 14:68299540-68299562 CTCAAGTCCTTTATATAAAATGG - Intronic
1119176333 14:72570282-72570304 CTCAAGTCCCTTTTATAAAATGG - Intergenic
1119201720 14:72757758-72757780 CTCAAGTCCCTTATATAAAATGG - Intronic
1119345226 14:73917939-73917961 CTCAAGTCTCTTACATAAAATGG + Intronic
1120036912 14:79708335-79708357 CTCAAGTCCTCAATATAAAATGG - Intronic
1120075369 14:80150962-80150984 CTCAAGTCCCTTATATAAAATGG + Intergenic
1120295544 14:82635396-82635418 CTCAAGTCCCTTACATAAAATGG + Intergenic
1120338861 14:83193157-83193179 CACAATTCCTTCATGTAAAACGG - Intergenic
1120417376 14:84236814-84236836 CTCAAGCCCCTTATATAAAATGG + Intergenic
1120475264 14:84978840-84978862 CTCAAGTCCCTTATATAAAATGG - Intergenic
1120476122 14:84989880-84989902 CTCAAGTCCCTGATATAAAATGG - Intergenic
1120620627 14:86759668-86759690 GTAAAGTCTTTTAGGAAAAAAGG - Intergenic
1120796850 14:88643526-88643548 CTCAAGTGCCTTATATAAAATGG - Intronic
1120800713 14:88685557-88685579 CTCAAGTCCCTCATATAAAATGG + Intronic
1121070934 14:91020446-91020468 CTCAAGTCCCTTATATAAATTGG - Intronic
1121263576 14:92584108-92584130 CTCAAGTCCTTGATATGAAATGG - Intronic
1121451964 14:94014275-94014297 CTCAAGTCCCTGATATAAAATGG - Intergenic
1121679978 14:95785751-95785773 CTCAAGCACTTTATATAAAATGG - Intergenic
1121745949 14:96292854-96292876 TTCAAGTCCCTTATATAAAATGG + Intronic
1121807789 14:96846892-96846914 CTCAAGTCCCTCATATAAAATGG - Intronic
1122045743 14:99021949-99021971 TTCAAGTCCTCTAGGGAGAAAGG - Intergenic
1122184454 14:99980080-99980102 TTCAAATCCCTTAGGTAAAATGG - Intronic
1122420880 14:101576495-101576517 CTCAAGTCCTTGATCTAAAGTGG - Intergenic
1122699886 14:103581107-103581129 CTCAAATCCTTTATATAAAATGG - Intronic
1123715856 15:23030441-23030463 CTCAAGTCCCTGATATAAAATGG + Intronic
1123738747 15:23212761-23212783 CACAAGTGGTTTAGGTAACATGG + Intergenic
1123879544 15:24663990-24664012 CTCAAGTCCTTTATATAGAATGG + Intergenic
1123961001 15:25400308-25400330 CTCAAGTCCATTATATAAAATGG + Intronic
1123981430 15:25608359-25608381 CTCAAGTCCCTAAGGTAAAATGG - Intergenic
1124099122 15:26677148-26677170 TTTAAGTCCTTTAGATCAAAAGG + Intronic
1124160115 15:27260593-27260615 CTCAAGTCCCTGAGATAAAATGG - Intronic
1124270703 15:28277897-28277919 CTCAAGTCCCTGATATAAAATGG + Intronic
1124289957 15:28441395-28441417 CACAAGTGGTTTAGGTAACATGG + Intergenic
1124293272 15:28475894-28475916 CACAAGTGGTTTAGGTAACATGG - Intergenic
1124350393 15:28951249-28951271 CTCAAGTCCCTTCTATAAAATGG - Intronic
1124579000 15:30935594-30935616 CTCAAGTCCCTGATATAAAATGG - Intronic
1124856651 15:33395866-33395888 CTCAAGTCCTTTACATAAAATGG + Intronic
1124892866 15:33748856-33748878 CTCAAGTCCCTGATATAAAATGG + Intronic
1125124726 15:36206679-36206701 CTCAAGTCTCTTATATAAAATGG + Intergenic
1125303837 15:38287779-38287801 CTCAAGTCCCTGATATAAAATGG - Intronic
1125333041 15:38601014-38601036 CTCAAGTCCCTGATATAAAATGG - Intergenic
1125569043 15:40700849-40700871 CTCAAGTCCCTTATATAAAATGG - Intronic
1125623626 15:41087321-41087343 CTCAAATTCATTATGTAAAATGG - Intronic
1125707938 15:41757461-41757483 CTCAAGTCCCTGATATAAAATGG - Intronic
1125742538 15:41976311-41976333 CTCAACTCCCTTATATAAAATGG - Intergenic
1125794309 15:42393129-42393151 CTCAAGTCCCTTCTGTAAAATGG + Intronic
1125863624 15:43021481-43021503 CTCAATTCCCTTATGTAAAATGG + Intronic
1126075137 15:44901665-44901687 CTCAAGTCCCTTATATGAAATGG + Intergenic
1126083226 15:44986143-44986165 CTCAAGTCCCTTATATCAAATGG - Intergenic
1126139194 15:45423487-45423509 CTCAAGTCCCTGATATAAAATGG - Intergenic
1126221642 15:46221152-46221174 CTCAAATCCCTCATGTAAAATGG - Intergenic
1126267351 15:46770111-46770133 CATAAGACATTTAGGTAAAAGGG + Intergenic
1126359123 15:47827806-47827828 CTCAAGTCTCTTATATAAAATGG - Intergenic
1126447420 15:48764069-48764091 CTCAATTCCAAAAGGTAAAATGG + Intronic
1126606766 15:50485807-50485829 CTCAAGTCCCTTATATAAAATGG + Intronic
1126857418 15:52852605-52852627 CTCAAGTACCTTATATAAAATGG - Intergenic
1126899410 15:53297563-53297585 CTCAAGTCTCTTAAATAAAATGG + Intergenic
1127129124 15:55843645-55843667 CTCAATTTATTTAGGGAAAATGG + Intronic
1127152083 15:56086218-56086240 CTCCAGTCCCTTACATAAAATGG - Intergenic
1127205710 15:56716047-56716069 CTCAAGTCCCTTATATAACATGG - Intronic
1127233931 15:57026823-57026845 CTGAAGGCCTTTATATAAAATGG + Intronic
1127247779 15:57196363-57196385 CTCAAGTCCTTTAAATAAAATGG - Intronic
1127255733 15:57291192-57291214 CTCATGGCCTTTATATAAAAGGG + Intronic
1127257202 15:57302403-57302425 CTCAAGTCCTTGATATAAAATGG + Intergenic
1127318847 15:57823014-57823036 CTCAAGTCCCTGATATAAAATGG - Intergenic
1127408804 15:58683965-58683987 CTCAAGTCCCTTATACAAAATGG + Intronic
1127413583 15:58733589-58733611 CTCAAGTCCCTTATATAAAAAGG - Intronic
1127745608 15:61968433-61968455 CTCAAGTTCCTTATATAAAATGG - Intronic
1127752331 15:62058618-62058640 CTCAAGTCCCTTAAATAAAATGG - Intronic
1128196600 15:65762794-65762816 CTTAAGCCCCTTACGTAAAATGG - Intronic
1128424647 15:67528886-67528908 ATGAAGTCCTTTAAGTATAATGG - Exonic
1128853990 15:70991403-70991425 CTCAATTCCCTTATATAAAATGG + Intronic
1128950105 15:71870653-71870675 CTGAAGTCCCTTATATAAAATGG + Intronic
1128959450 15:71986263-71986285 CTCAAGTCCCTTATGTAAAATGG - Intronic
1129015823 15:72467957-72467979 CTCAAGTTCCTTATATAAAATGG - Intergenic
1129583874 15:76842205-76842227 TTCAAGTCCCTTATATAAAATGG - Intronic
1129627326 15:77215434-77215456 CTCAAGTCCTTTATATGAAATGG + Intronic
1129634970 15:77305734-77305756 ATCAAGTCCCTTACATAAAATGG + Intronic
1129819452 15:78587685-78587707 CAAAAGTCCTTTATATAAAAGGG - Intronic
1130117939 15:81021810-81021832 CTCAACTCCCTGATGTAAAATGG + Intronic
1130697606 15:86146403-86146425 CTCAAGTCCCTGATATAAAATGG - Intronic
1130881848 15:88062152-88062174 CTCAAGTCCCTGATGTAAAATGG - Intronic
1131072333 15:89473746-89473768 CTCAAGTCCCTGATATAAAATGG - Intronic
1131164448 15:90132180-90132202 CTCAAGTCCCTGATATAAAATGG + Intergenic
1131244700 15:90780914-90780936 CTCAAGTCCCTGATATAAAATGG - Intronic
1131297664 15:91165526-91165548 CTCAAGTTCTTTATATTAAATGG - Intronic
1131451116 15:92540997-92541019 CTCAAGTCCCTGATATAAAATGG - Intergenic
1131462486 15:92627995-92628017 CTCAAGTCTTTTATATCAAACGG + Intronic
1131588275 15:93719642-93719664 CTCAAGTCCCTGATATAAAAGGG - Intergenic
1132076464 15:98825314-98825336 CTCAAGTCCCTTTTATAAAATGG + Intronic
1132105660 15:99060701-99060723 CTCAAGTTCCTTATATAAAATGG - Intergenic
1132392451 15:101449140-101449162 CTCAAGTCCCTGATATAAAATGG + Intronic
1134041210 16:11069923-11069945 CTCAAGTCCTTCATATAAAATGG - Intronic
1134182647 16:12060288-12060310 CTGAAGTCCCTGATGTAAAACGG - Intronic
1134189661 16:12111445-12111467 CTCAAGTCTCTGAGGTAAGAAGG - Intronic
1134198351 16:12176656-12176678 CTCAAGTCCCTTATATGAAATGG - Intronic
1135033054 16:19054404-19054426 CTCAAGTCCTTGCTATAAAATGG + Intronic
1135716557 16:24774813-24774835 TTCAAGTCCCTTATATAAAATGG + Intronic
1135958186 16:26973953-26973975 TTCAAGACCTTTATATAAAATGG + Intergenic
1136467140 16:30452372-30452394 CTCAAGCCCCTTATATAAAATGG - Intergenic
1138053049 16:53802172-53802194 CTCAAGTCACTTATATAAAATGG + Intronic
1138662160 16:58527695-58527717 CTTAAGTCCTGTATGTAAAGTGG - Intronic
1138711440 16:58974855-58974877 GTCAAGTACTTAAGTTAAAATGG + Intergenic
1138914522 16:61447265-61447287 CTTAAGTCCCTTATATAAAATGG + Intergenic
1138918306 16:61495531-61495553 CTCAAGTCCCTTATATAAAATGG - Intergenic
1138999813 16:62496003-62496025 CTCAAGTCCCTTATATAACAAGG + Intergenic
1139026653 16:62826138-62826160 CTCAAGTCCCTTATATAAAATGG - Intergenic
1139403225 16:66698003-66698025 CTCAAATCCTTTATATAAAATGG + Intergenic
1139807296 16:69578175-69578197 CTCAAGTCCCTAATATAAAATGG - Intronic
1139944393 16:70629485-70629507 CTCAGGTCCCTTATGTAAAATGG + Intronic
1139998303 16:71001524-71001546 CTCTAGTCTCTTAGATAAAATGG - Intronic
1140164679 16:72538356-72538378 CTCACGTCCATGAGGTAAAATGG + Intergenic
1140435925 16:74946803-74946825 CTAAAGGCCTTTACATAAAAAGG + Intronic
1140703849 16:77607685-77607707 CTCAAGTCCCTAATATAAAATGG + Intergenic
1140912291 16:79465191-79465213 CTCAAATCCTTTATATGAAATGG + Intergenic
1141695845 16:85619038-85619060 CTCCAGTCTTTTTGGGAAAAGGG - Intronic
1141769386 16:86080004-86080026 CTCAGGTCCTTCATATAAAACGG + Intergenic
1142564546 17:831365-831387 CTCAAGTCCTTGATATAAAATGG - Intronic
1142861043 17:2761694-2761716 CTCTAGTCCCTTGAGTAAAATGG + Intergenic
1143425085 17:6829379-6829401 CTCAAGTCTTTTATACAAAATGG + Intronic
1143693772 17:8594709-8594731 CTCAAGTCCCTTATATAAAATGG + Intronic
1143811246 17:9473462-9473484 CTCAAGTCCCATATATAAAATGG + Intronic
1143856906 17:9858123-9858145 CTCAAGTCCCTTCTATAAAATGG - Intronic
1143922359 17:10340497-10340519 CTCAAGTCTCTTATGTCAAAAGG - Intronic
1144081280 17:11766558-11766580 CTCATGTCCTCCAGGTTAAAGGG + Intronic
1144149188 17:12427225-12427247 CTCAGGTCCCTTATATAAAATGG - Intergenic
1144265496 17:13564449-13564471 CTCAAGTTCCTTATATAAAATGG + Intronic
1144297825 17:13895865-13895887 CTCAAGTCCCTTATATAAAATGG + Intergenic
1144440604 17:15277904-15277926 CTCAAGTCCCTGATATAAAAAGG - Intergenic
1144441315 17:15285272-15285294 CTCAAGTCCCTTATATAAAAGGG - Intergenic
1145218797 17:21071929-21071951 CTCAAGTCCCTGATATAAAATGG + Intergenic
1145737982 17:27246828-27246850 CTCAAGTCCCTTATATAAAATGG - Intergenic
1145823042 17:27855193-27855215 CTCAAGTCCCTTATATGAAATGG - Intronic
1145824273 17:27865370-27865392 CTCAAGTCCCTTATTAAAAATGG - Intronic
1145853983 17:28134544-28134566 CTCAAGTCCCTTATATAAAATGG - Intronic
1146084790 17:29817692-29817714 CTCAAGTGTCTTATGTAAAATGG + Intronic
1146426259 17:32742229-32742251 TTCAAGTCCCTTATATAAAATGG - Intronic
1146543466 17:33718099-33718121 CTCAAGTCCCTTATATAAAATGG + Intronic
1146934782 17:36806340-36806362 CTCAAGTCCCTTGTATAAAATGG - Intergenic
1146966087 17:37031352-37031374 CTCAAGTTCCTTATATAAAATGG - Intronic
1147678768 17:42225588-42225610 CTCAAGTTCCTTATATAAAATGG + Intronic
1147993076 17:44346731-44346753 CTCAAGCCCCTGAGATAAAATGG + Intronic
1148074946 17:44930102-44930124 CTCAAGGCCTTTTTGAAAAAAGG + Intronic
1148601328 17:48896342-48896364 CTCAAGTCCCTTATATAAAATGG - Intergenic
1148716786 17:49721703-49721725 CTCAAGTCATTGAGGTTAAGGGG - Intronic
1148761023 17:50000370-50000392 CTCAAGTCCCTGATATAAAATGG - Intergenic
1148815068 17:50321726-50321748 CTCAAGTCCCTTATATATAATGG + Intergenic
1148919829 17:51020785-51020807 CTCAGGTCCCTTATATAAAATGG + Intronic
1149398138 17:56265685-56265707 CTCAAATCCCTTATATAAAATGG + Intronic
1149736038 17:58994637-58994659 CTCAAGTCCCCTATATAAAACGG - Intronic
1149743759 17:59074322-59074344 CTCAAGTCCCTTATATAAAATGG - Intronic
1149836028 17:59913624-59913646 CTCAAGTGCCTTATATAAAATGG + Intronic
1149927231 17:60713725-60713747 CTCAAGTCCTTTACATAAAATGG - Intronic
1150156604 17:62859010-62859032 CTCAAGTCTATTCTGTAAAATGG - Intergenic
1150258711 17:63771346-63771368 CTCAAGTCCCTTATATAAAATGG - Intronic
1150347687 17:64416816-64416838 CTCAAGTCTTTTCTGTAAAATGG + Intergenic
1150534897 17:66026672-66026694 CTCAAGTCCCTTTTATAAAATGG + Intronic
1150800352 17:68276967-68276989 GTGAAGTCCTTTAGGGAAACAGG + Intronic
1150803919 17:68303750-68303772 CTCAAGTGCTATAAGGAAAATGG - Intronic
1153035735 18:760559-760581 CTCAAGTCCATGATATAAAATGG - Intronic
1153120338 18:1716928-1716950 CTCAAGTCCCTTATATAAAATGG + Intergenic
1153136452 18:1923132-1923154 CAAAAGACATTTAGGTAAAAGGG + Intergenic
1153242636 18:3044657-3044679 GTCAAGTCCCTTATATAAAAGGG - Intergenic
1153281487 18:3418426-3418448 CTCAAGTTCATTATATAAAATGG + Intronic
1153600873 18:6780465-6780487 CTCAAGTCCATTACATAAAATGG - Intronic
1154115714 18:11611568-11611590 CTCAAGTCCCTGATATAAAATGG - Intergenic
1154120158 18:11645787-11645809 CTCAAGTCCCTGATATAAAATGG - Intergenic
1154200974 18:12300568-12300590 CTCAAGTCCCTTATATAAAAGGG - Intergenic
1154373397 18:13787069-13787091 CTCAAGTGCCTGATGTAAAATGG - Intergenic
1154971926 18:21418317-21418339 CTCAATTCCCTTATATAAAATGG + Intronic
1154974490 18:21443750-21443772 CTCAAGTCCCTCATATAAAATGG + Intronic
1155046095 18:22104594-22104616 CTCAAGTCCGTGATATAAAATGG + Intergenic
1155135832 18:22991529-22991551 CTCAAGTCCGTTACATAAAATGG + Intronic
1155487587 18:26363042-26363064 CTCAAGTCCCTGATATAAAATGG - Intronic
1155698248 18:28710499-28710521 CTCAAGTCCCTGACATAAAATGG - Intergenic
1156122849 18:33865235-33865257 CTCAAGTCCTTTATATTAAATGG + Intronic
1156129561 18:33954085-33954107 CTCAAGTCCATTACACAAAATGG + Intronic
1156349291 18:36289222-36289244 CTCAAGTCCTTCACATAAAATGG + Intergenic
1156792656 18:40995448-40995470 CTCAAGCCCTTTATATAAAATGG - Intergenic
1157460320 18:47886025-47886047 CTCAAGTCTCTTATATAAAATGG - Intronic
1157495751 18:48156090-48156112 CTCAAATCCTTTTGGGAACAAGG - Intronic
1157688607 18:49663126-49663148 CTCAAGTCCCTAATATAAAATGG - Intergenic
1157695917 18:49723577-49723599 CTTAAATCCTTTAGGAAAACTGG - Intergenic
1158077749 18:53550895-53550917 CTCAAGTCCTCTATGTAAAATGG - Intergenic
1158260497 18:55600967-55600989 CTCAAGTCCCTGATATAAAATGG - Intronic
1158383961 18:56967770-56967792 CTCAAGTCCCTGATATAAAATGG + Intronic
1158598461 18:58836991-58837013 CTCAAGTCCTTTAAATAAAATGG + Intergenic
1158657639 18:59353824-59353846 CTGAAGTCCCTTATATAAAATGG + Intronic
1158909505 18:62046224-62046246 CTCAAGTCCCTGATATAAAATGG + Intronic
1159355015 18:67327791-67327813 CTCAAGTCCTTGATATAAAATGG + Intergenic
1159470755 18:68852402-68852424 TTCAAGTCCCTTACATAAAATGG + Intronic
1159618498 18:70610098-70610120 TTCAATCCGTTTAGGTAAAAAGG + Intergenic
1159689554 18:71468918-71468940 CTCAAGTCCGTTACATAAAATGG + Intergenic
1159751806 18:72311889-72311911 CTCAAGTCCCTTATATAAAATGG + Intergenic
1162599085 19:11653575-11653597 CTCAAGTGCTTTATATAAAATGG + Intergenic
1162660909 19:12168506-12168528 CTCAAGTCCTGTAGGGAAGGGGG + Intronic
1163079748 19:14930126-14930148 CTGAAGTCCCTTATATAAAATGG - Intergenic
1163259115 19:16176416-16176438 CTCAAGTCATTTATATAAAATGG + Intergenic
1163269192 19:16240152-16240174 CTCAAGTCTTTTATATAAAATGG - Intronic
1163855939 19:19702217-19702239 CTCAAGGCCCTTATATAAAATGG - Intergenic
1165195315 19:34097952-34097974 CTCAAGTCCTTTATATAAAATGG + Intergenic
1165524024 19:36337565-36337587 CTCAAGTCCCTTGTATAAAATGG - Exonic
1165538004 19:36466367-36466389 CTCAAGTCCCTTATATAAAATGG + Intronic
1165586995 19:36925863-36925885 CTCAAGTCCCTTATATAAAATGG - Intronic
1166610421 19:44188572-44188594 CTCAAGTCCCTTACATAAAATGG - Intergenic
1166626769 19:44364792-44364814 TTCAAGTCTGTTATGTAAAATGG - Intronic
1167836988 19:52081124-52081146 CTGAAGTCCCTTATATAAAAAGG + Intronic
1168375562 19:55876329-55876351 CTCAAGTTCCTAATGTAAAATGG + Intronic
1168384466 19:55951614-55951636 CTCAACTCCTTCATGTAAAATGG + Intronic
1168392717 19:56023722-56023744 CTCAAGTCCCTGATATAAAATGG - Intronic
925074825 2:1007120-1007142 CTCAAGTCCCTGATATAAAATGG - Intronic
925398785 2:3557065-3557087 CTTAAGTCCTTTGCATAAAATGG + Intronic
925664896 2:6242340-6242362 CTCAGGTCCTTTGTATAAAACGG - Intergenic
925667451 2:6275672-6275694 CTCAAGTCCCTCAGGTAAAATGG + Intergenic
926265123 2:11309295-11309317 CTCAAGTCCCTTATATAAAATGG - Intronic
926488804 2:13498346-13498368 CTCAAGTGTCTTATGTAAAATGG + Intergenic
926512753 2:13802946-13802968 CTCAAGTTCCTTATATAAAACGG + Intergenic
926900984 2:17752207-17752229 CTCAAGTCCCTTATATGAAATGG + Intronic
926962280 2:18370986-18371008 CCCAAGTCCCTTATATAAAATGG - Intergenic
927268273 2:21177824-21177846 CTCAAGTCCTGGATATAAAATGG - Intergenic
927367054 2:22309284-22309306 CTCAAGTCCCTTATATAAACTGG + Intergenic
927609819 2:24527002-24527024 CTCAACTTCCTTATGTAAAATGG - Intronic
927622022 2:24671346-24671368 CTCAAGTCCCTGATATAAAATGG + Intronic
927760305 2:25746968-25746990 CTCAAGTCCTTTATATAAAATGG + Intronic
927819203 2:26247818-26247840 CTCAAGTCCTTTACATAAAATGG - Intronic
928526832 2:32149788-32149810 TTAAAGTCCCTTATGTAAAATGG - Intronic
928554935 2:32413786-32413808 CTCAAGTCCCTTGTATAAAATGG + Intronic
928835800 2:35543200-35543222 CTCAAGTCCCTTATATAAAATGG - Intergenic
928926854 2:36588550-36588572 CTCAAGTCCCTTATATAAAGTGG + Intronic
928982072 2:37146378-37146400 CTCAAGTCCTTTATATAAAATGG - Intronic
929098673 2:38287718-38287740 CTCAAGTCCCTTACAGAAAATGG + Intergenic
929210440 2:39351090-39351112 CTCAAGTCCCTTATATAAAGTGG - Intronic
929558584 2:42941415-42941437 CTCAAGTCCCTGATATAAAATGG - Intergenic
929596155 2:43177668-43177690 CTCAAGTCCGTGATATAAAATGG - Intergenic
929778171 2:44941379-44941401 ATCAACTTCTTTAGGAAAAAGGG + Intergenic
929833944 2:45376939-45376961 CTCATGTCCCTTATATAAAATGG + Intergenic
929842430 2:45482805-45482827 CTCAAGTCCTTTATATAAAATGG + Intronic
929974885 2:46623066-46623088 CTCAATCCTTTTAGATAAAAGGG - Intronic
930294263 2:49534591-49534613 CTCACGTCCTTTGTATAAAATGG + Intergenic
930487113 2:52024016-52024038 GTCAAGTTGTTTGGGTAAAAAGG + Intergenic
930705904 2:54504651-54504673 CTCAGGTCCCTTATATAAAATGG - Intronic
930717620 2:54607687-54607709 CTCAAGTCGCTTATATAAAACGG - Intronic
931488589 2:62719812-62719834 CTCAAGTCCCTGACATAAAATGG - Intronic
931536474 2:63282829-63282851 TTCATGTCCTTTATATAAAATGG + Intronic
931829520 2:66036265-66036287 CTCAAGTCTTGTATATAAAATGG + Intergenic
931917023 2:66967510-66967532 TTCAAGTCCCTTATATAAAATGG - Intergenic
932005787 2:67925834-67925856 CTCAAGTTCCTTATGTAAAATGG - Intergenic
932035408 2:68241155-68241177 CTCAAGTCCCTGATATAAAATGG + Intronic
932202750 2:69846471-69846493 CTCAAGTCCCTTATATAAAATGG - Intronic
932454418 2:71838349-71838371 CTCAAGTTCCTTACATAAAATGG - Intergenic
932545059 2:72699961-72699983 CTCAAGTCCCTTACCTAAAATGG + Intronic
932547296 2:72727019-72727041 CTTAAGTCCCTTATATAAAATGG - Intronic
932993277 2:76814670-76814692 CTCAAGTCCCTTATATAAAATGG - Intronic
933053015 2:77624450-77624472 CTCAACTCCTTCATATAAAATGG + Intergenic
933267809 2:80201016-80201038 CTCAAGTCCCTGATATAAAATGG + Intronic
933353055 2:81179820-81179842 CTCAAGTCCCTTATAGAAAATGG + Intergenic
933443378 2:82344332-82344354 CTCAAGTCCTCAATATAAAATGG - Intergenic
933541710 2:83652140-83652162 CTCAAGTCTCTGATGTAAAATGG + Intergenic
933578502 2:84098179-84098201 CTCAAGTCCCTTACATGAAATGG - Intergenic
933621386 2:84546248-84546270 CTCAAGTCCCTTATATAAAATGG + Intronic
933917680 2:87012878-87012900 CTCAAGTCCCTTATGTAAAATGG - Exonic
934005316 2:87757039-87757061 CTCAAGTCCCTTATGTAAAATGG + Exonic
934018049 2:87910822-87910844 CTCAAGTCCCTTATATGAAATGG - Intergenic
934069523 2:88371096-88371118 CTCAAGTCCTTTATATAAAATGG + Intergenic
934091978 2:88559425-88559447 CTCAAGTCCCTTATATAAAATGG - Intronic
934171656 2:89545207-89545229 CTCAAGTCCTATATATAAAATGG + Intergenic
934281965 2:91619525-91619547 CTCAAGTCCTATATATAAAATGG + Intergenic
934671492 2:96216375-96216397 CTCAAGTCCCTGATATAAAATGG - Intergenic
934932712 2:98441198-98441220 CTCATGTCCCTTATATAAAATGG + Intergenic
935262438 2:101366973-101366995 CTCAAGTCCCTGATATAAAATGG - Intronic
935413811 2:102793565-102793587 CTCAAGTCCCTGATATAAAATGG + Intronic
935599734 2:104911020-104911042 CTCAAGTCCCTGATATAAAATGG - Intergenic
935768275 2:106391126-106391148 CTCAAGTCCCTTATGTAAAATGG + Intergenic
935819381 2:106878734-106878756 CTCAAGTCCCTGATATAAAATGG - Intronic
935985421 2:108667777-108667799 CTCAAGTCCCTGATATAAAATGG + Intronic
936137850 2:109911426-109911448 CTCAAGTCCCTGATATAAAATGG + Intergenic
936206847 2:110460059-110460081 CTCAAGTCCCTGATATAAAATGG - Intronic
936551447 2:113445438-113445460 TTCAAGTCCCTTACATAAAATGG + Intronic
936584213 2:113739197-113739219 CTCAAGTCCCTTATATAAAATGG + Intronic
936882169 2:117266790-117266812 CTCAAGTTCTTTATATAAAATGG - Intergenic
936953275 2:117999657-117999679 CTCAAGTCCCTGATATAAAATGG + Intronic
937049625 2:118877784-118877806 CTCAAGTCCCTTATGTAAAATGG - Intergenic
937211926 2:120279603-120279625 CTCAAGTCCTTTACTTAAAATGG - Intronic
937831585 2:126430229-126430251 CTCAAGTCCTTGAGGTGAGGAGG + Intergenic
937948832 2:127368009-127368031 CTCAAGTCCCTCATATAAAATGG + Intronic
938005120 2:127783074-127783096 CTCAAGTCCTTTAAATAAAATGG - Intronic
938247172 2:129786865-129786887 CTGAAATCCTTTTGGAAAAAAGG - Intergenic
938546713 2:132339586-132339608 CTCAAGTCTGTTATGTAAAATGG + Intergenic
938552863 2:132396740-132396762 CTCAAGTCCCTCATATAAAATGG + Intergenic
938752578 2:134347705-134347727 CTCAAGTCCCTTATATAAAGTGG - Intronic
938834208 2:135082905-135082927 CTCAAGTCCCTTTTATAAAATGG + Intronic
938865753 2:135418276-135418298 CTCATGTCCTTCATGTAAAATGG - Intronic
939038261 2:137158506-137158528 ATCAAATCCTTTTGGTAAACTGG + Intronic
939808657 2:146805806-146805828 CTCAAGTCCTTGATACAAAATGG + Intergenic
939833847 2:147104151-147104173 CTCAAGTCCTTTATATAAAGTGG + Intergenic
939910800 2:147980379-147980401 CTCAAGTCCTTTCTATAAATTGG - Intronic
940044679 2:149396922-149396944 CTCAAGTCCCTTATATAAAATGG + Intronic
940207515 2:151220263-151220285 CTCAAGTCTCTTTCGTAAAATGG - Intergenic
940305321 2:152219649-152219671 CTCAAGTCCCTTATGTAAAATGG + Intergenic
940355418 2:152736886-152736908 TTCAAGTCCCTTATATAAAATGG - Intronic
940458784 2:153936322-153936344 CTCAAGTCCATTATATAAAATGG - Intronic
940710764 2:157160865-157160887 CTCAAGTTGTTTATATAAAATGG - Intergenic
940739949 2:157495979-157496001 CTCAAGTCCCTTTTATAAAATGG - Intergenic
940916425 2:159261295-159261317 CTCAAGTCCCTTATATAAAATGG - Intronic
941066105 2:160904530-160904552 CTCAAGTCCCTTATACAAAATGG + Intergenic
941103674 2:161326762-161326784 CTCAAGTCCCTTAGATAAAATGG + Intronic
941246617 2:163106122-163106144 CTCAAGTCCCTTATATAAAATGG - Intergenic
941391395 2:164919611-164919633 CTCAAGTCCCTGATATAAAATGG + Intronic
941500552 2:166270372-166270394 CTCAATTCCTTTATATAAAATGG - Intronic
941505237 2:166336036-166336058 CTCAAGTTCTTTACATAAAATGG - Intronic
941514718 2:166459009-166459031 CTCAAGTCCCTTATGTAAAATGG - Intronic
941532204 2:166684450-166684472 CTCAAGTCACTTATATAAAATGG + Intergenic
941562736 2:167069062-167069084 CTCAAGTCCTTTATATAAAACGG + Intronic
941709978 2:168701692-168701714 CTCAAGTCTTTTATATAAAATGG + Intronic
941838312 2:170050944-170050966 CTCAAGTCCCTTACATAAAATGG + Intronic
941952922 2:171175486-171175508 CTCAAGTCCCTTATATAAAATGG - Intronic
941982207 2:171470956-171470978 CTCAAGTACCTTATATAAAATGG - Intronic
942053752 2:172163751-172163773 TTCAAGTCTTTTAAATAAAATGG + Intergenic
942287565 2:174435778-174435800 CTCAAGTCCCTTATATAAAATGG - Exonic
942542283 2:177027005-177027027 TTCAACTCATTTAGGTAAACAGG - Intergenic
942700691 2:178706198-178706220 CTCAAGTCCCTGATGCAAAATGG + Intronic
942728163 2:179033382-179033404 CTCAAGTCCCTTTTATAAAATGG - Intronic
942894831 2:181039817-181039839 CTCAAGTTCCTTATATAAAATGG + Intronic
943149030 2:184086402-184086424 CTCTAGTCCTTTATATAAAATGG - Intergenic
943217372 2:185055975-185055997 TTCAAGTCCCTTACATAAAATGG - Intergenic
943272952 2:185830495-185830517 CTCAAGGTCTTTATATAAAATGG + Intronic
943441491 2:187932795-187932817 CTTAAGTCCTATAGAGAAAACGG + Intergenic
943521157 2:188950439-188950461 CTCAAGTCCCTTATATAAAATGG - Intergenic
943574429 2:189614582-189614604 CTCAAGTTCTTTATATAAAATGG - Intergenic
943693429 2:190894199-190894221 CTCAAGTCTCTTATGTAAAATGG + Intronic
943893306 2:193320025-193320047 CTCAAGTCCCTAACATAAAATGG - Intergenic
944214921 2:197245401-197245423 CTCAAGTCCCTGACATAAAATGG - Intronic
944397465 2:199284969-199284991 CTCAAGCCCCTTATGTAAAATGG - Intronic
944462110 2:199960691-199960713 CTCAAGTCCTTTATATAAAATGG - Intronic
944617169 2:201473321-201473343 CTCAAGTCCCTTGTATAAAATGG - Intronic
944752717 2:202727666-202727688 CTCAAGTCCCTTATATAAAATGG - Intronic
944892676 2:204134007-204134029 CTCAAATCATTCAGGAAAAAGGG - Intergenic
944914041 2:204339383-204339405 CTCAAGTCCTCTGTATAAAATGG - Intergenic
944929255 2:204500023-204500045 CCCAAGTCCCTTATATAAAATGG - Intergenic
945019241 2:205554872-205554894 CTCAAGTCCTTGATATAAAATGG - Intronic
945117345 2:206420982-206421004 CTCAAGTCCCTTATATAAAATGG + Intergenic
945230425 2:207583190-207583212 CTCAAGTCCCTTATATAAAATGG - Intronic
945701521 2:213176715-213176737 CTCAAGTCTCTTACATAAAATGG - Intergenic
945798943 2:214400524-214400546 CTCAAGTCCCTTCTATAAAATGG - Intronic
945828101 2:214749369-214749391 ATCAAGTCCTTCAGGTTTAAAGG - Intronic
946078224 2:217093531-217093553 TTCAAGTCCCTTATATAAAATGG + Intergenic
946149948 2:217757550-217757572 CTCAAATACCTTATGTAAAACGG - Intergenic
946446879 2:219747579-219747601 CTCAAGTCCCTTATATAAAATGG + Intergenic
946641260 2:221785690-221785712 CTCACGTCCTTTATATAAAATGG + Intergenic
946743378 2:222822117-222822139 CTCAAGTCGCTTATTTAAAATGG - Intergenic
946795024 2:223341384-223341406 CCCAAGTCCCTTATATAAAATGG + Intergenic
946908675 2:224440099-224440121 CTCAAGTCCCTTATATAAAATGG - Intergenic
947116372 2:226775739-226775761 CTCAAGTCCTTTGTATAAAATGG + Intronic
947454297 2:230239279-230239301 CTTAAGTCCCTTATATAAAATGG + Intronic
947570530 2:231230663-231230685 CTCAAGTCCTTTATGTAAAATGG + Intronic
947677799 2:232000056-232000078 CTCAGGTCCCTTATATAAAATGG + Intronic
947778379 2:232733689-232733711 CTCAAGTCCCTAATGTAAAATGG + Intronic
948033372 2:234837852-234837874 CTCAAGTCCCTTCTATAAAATGG - Intergenic
948086025 2:235249052-235249074 CTCAAGTCCTTGATAGAAAATGG - Intergenic
948412069 2:237771490-237771512 CTCAAGTCCCTGATATAAAATGG - Intronic
948417752 2:237826883-237826905 CTCAAGTCCCTTATGTAAAATGG - Intronic
948554519 2:238798480-238798502 CTCAAGTCCCTGATATAAAACGG - Intergenic
1168983574 20:2027614-2027636 CTCAAGTCCTTTATATAAAATGG + Intergenic
1169008933 20:2233672-2233694 CTCAAGTCCCTTGTATAAAATGG - Intergenic
1169348897 20:4852222-4852244 CTCAAGTCCCTGATATAAAATGG - Intergenic
1169584358 20:7063431-7063453 CTCAAGTCCTTTACATTAAATGG + Intergenic
1169600878 20:7259342-7259364 CTCAAGTCCCTTTTATAAAACGG + Intergenic
1169750318 20:8985841-8985863 CTCAAGTCCCTTATATAAAATGG + Intergenic
1169766240 20:9151265-9151287 CTCAAGTCCCTTATATAAAATGG - Intronic
1169845850 20:9990720-9990742 CTTTAGTTCTTTATGTAAAATGG - Intronic
1170446840 20:16436984-16437006 CTCAAGTCTCTCACGTAAAATGG + Intronic
1170623939 20:18016768-18016790 TTCAAGTCCCTGATGTAAAATGG - Intronic
1170766552 20:19293956-19293978 CTCAAGTCCCTGATATAAAATGG + Intronic
1171198791 20:23224585-23224607 CTCAAGTCCCTTGTATAAAATGG + Intergenic
1171225852 20:23441517-23441539 CTGAAGTCTTTTATGTAAAATGG + Intronic
1171875575 20:30572312-30572334 CTCAAGTCTGTTATGTAAAATGG + Intergenic
1172256157 20:33519537-33519559 CTCAAGTCTCTTACGTAAAATGG - Intronic
1172440532 20:34962534-34962556 CTTAAGTCCCTTATATAAAATGG + Intergenic
1172707861 20:36896031-36896053 CTCAAGTCCCTTATATAAAATGG - Intronic
1172986031 20:38990722-38990744 CTCAAGTCCATTATATAAGATGG - Intronic
1173205358 20:40989050-40989072 CTCAAGTTTTTTACATAAAATGG + Intergenic
1173271235 20:41537458-41537480 CTCAAGTCCCTTATTTAAAATGG - Intronic
1173735308 20:45357185-45357207 CTCAAATCCTTTATATAAAATGG - Intergenic
1174117199 20:48234588-48234610 CTGAGGTCCTTTGGGTAAAATGG - Intergenic
1174296534 20:49549237-49549259 CTCAAGTCCTTGATTTAAAATGG + Intronic
1174573626 20:51522093-51522115 CTCAGGTCCCTTATGTAAAATGG - Intronic
1174732527 20:52931570-52931592 CTCAAGTCCCTGATATAAAATGG + Intergenic
1174879638 20:54264991-54265013 CTCAAGTCCCTTATATAAAATGG - Intergenic
1174976951 20:55346380-55346402 CTCAAGTCCTTTATGTAAAATGG + Intergenic
1175035476 20:55996197-55996219 CTTAAGTCCCTTATATAAAATGG + Intergenic
1175594211 20:60217558-60217580 CTCAAGTCCCTGATATAAAACGG + Intergenic
1176981769 21:15390157-15390179 CTCAAGTCCTTTATATAAAATGG - Intergenic
1176997435 21:15572163-15572185 CTCAAGTTCCTTATATAAAATGG + Intergenic
1177162603 21:17564187-17564209 CTCAAGTCCCTGATATAAAATGG + Intronic
1177165107 21:17592295-17592317 CTCAAGTGCCTTATATAAAATGG + Intronic
1177258986 21:18703891-18703913 CTCAAGTCCCTTATATAAAGTGG + Intergenic
1177275407 21:18906618-18906640 CTCAAGTCCCTTATATGAAATGG - Intergenic
1177572200 21:22901509-22901531 CTCAAGTCGCTTATATAAAATGG - Intergenic
1178008574 21:28254750-28254772 CTCAAGTCCTTTATATAAAATGG - Intergenic
1178068901 21:28939248-28939270 CTCAAGTTCCTTATATAAAATGG - Intronic
1178080667 21:29060851-29060873 CTCAAATCCCTTACATAAAATGG + Intronic
1178448398 21:32666942-32666964 CTCAAGTCCCTTACATAAAATGG + Intronic
1178476010 21:32937835-32937857 CTCAAGTCCCTGATATAAAATGG + Intergenic
1178569148 21:33718540-33718562 CTCAAGTCCCTGATATAAAATGG - Intronic
1178696677 21:34798783-34798805 CTCAAGTCCCTCATATAAAATGG - Intronic
1178729540 21:35087214-35087236 CTCAGGTCCCTTTTGTAAAATGG - Intronic
1180058481 21:45372765-45372787 CTCAAGTCCGTGCTGTAAAATGG - Intergenic
1181574533 22:23785468-23785490 CTCAAGTCCATTATATAAAATGG - Intergenic
1181603985 22:23968923-23968945 CTCAAGTCCCTTACATAAAATGG - Intronic
1181604528 22:23972383-23972405 CTCAAGTCCCTTACATAAAATGG + Exonic
1181748025 22:24969297-24969319 CTCAAGTCCTGTATATAAAATGG + Intronic
1181835240 22:25600663-25600685 CTCAAGTCCCTTATATAAAATGG - Intronic
1182109748 22:27714684-27714706 CTCAAGTCCTTTATATACAAAGG - Intergenic
1182214154 22:28701889-28701911 CTCAAGCCCTTTATATAAAATGG + Intronic
1182253399 22:29020048-29020070 CTCAAGTACCTTATATAAAATGG + Intronic
1182596639 22:31426220-31426242 CTCAAGGCCCTTATATAAAATGG + Intronic
1182770078 22:32788684-32788706 CTCAAATCCTTGATATAAAATGG - Intronic
1182914236 22:34013520-34013542 CTCAAATCCCTGAGATAAAATGG + Intergenic
1183128944 22:35814266-35814288 CTCAAGCCCTTTATATAAAATGG + Intronic
1183849730 22:40574809-40574831 CTGAAGTCCCTTATATAAAAAGG - Intronic
1183892627 22:40942555-40942577 TTCAAGTCCCTGAGATAAAATGG + Intergenic
1183996264 22:41635105-41635127 CCCAAGTCCCTTAAATAAAATGG + Intronic
1184072937 22:42157269-42157291 CTCAGGTTCCTTATGTAAAATGG + Intergenic
1184180690 22:42822632-42822654 ATCAAGTCCCTTACGTAAAAGGG + Intronic
1184874724 22:47266958-47266980 CTCAAGTCCCTTATATAAAATGG + Intergenic
1184972361 22:48034777-48034799 CTTAAATTCTTTAGGTAAAGCGG - Intergenic
949288524 3:2435278-2435300 CTCAAGTCCCTTATATAAAATGG + Intronic
949351003 3:3125312-3125334 TTCAAGTTCTTTACATAAAATGG - Intronic
949617686 3:5772520-5772542 CTCAAGTTCCTTATGTAAAATGG - Intergenic
949698743 3:6730628-6730650 CTCAAGTCCCTGATATAAAATGG - Intergenic
950267628 3:11586675-11586697 CTCAAGTCCCTCGTGTAAAATGG - Intronic
950808972 3:15633012-15633034 CTCAAGTCCCTTATATCAAATGG + Intronic
950814049 3:15680007-15680029 CTCAAGTCCCTTATAGAAAATGG - Intronic
950961240 3:17110307-17110329 CTCAAGTTCTGTATATAAAATGG - Intergenic
950974435 3:17225960-17225982 CTCAAGTCTCTTATATAAAATGG - Intronic
951046763 3:18048262-18048284 CTAAAGTTCATTAGGTCAAATGG + Intronic
951095238 3:18621553-18621575 CTCAAGTCTCTTATATAAAATGG + Intergenic
951457748 3:22911544-22911566 CTCAAGTCCCTGATATAAAATGG + Intergenic
951593443 3:24291470-24291492 CTCAAGTCCCTTATACAAAAGGG + Intronic
951624197 3:24642298-24642320 CTTGAGTCTTTTAGGTCAAAAGG - Intergenic
951715299 3:25636519-25636541 ATCAAGTCCCTTATATAAAATGG - Intronic
951783946 3:26397278-26397300 CTCAAGTCCCTGATATAAAATGG + Intergenic
951920317 3:27847579-27847601 CTCAAGTCCTTTATATAAAATGG - Intergenic
952177464 3:30880677-30880699 CTCAATTCCTTTATATAAAATGG - Intronic
952178020 3:30887961-30887983 CTCAAGTCCCTTACGTGAAAGGG + Intronic
952266996 3:31796447-31796469 CTCAAGTCCCTTACATAAAATGG - Intronic
952491272 3:33876024-33876046 CTCAAGTCCTTGATATAAAATGG + Intergenic
952801407 3:37295942-37295964 CTCAAGTCCATTATATAAAATGG - Intronic
952836071 3:37603420-37603442 CACAAGTCCTTGATGTAAAATGG - Intronic
953107103 3:39893382-39893404 TTCAAGCCCTTTATATAAAATGG + Intronic
953223438 3:40995898-40995920 CTCAAGTCCTTTACATAAAATGG + Intergenic
953398755 3:42593482-42593504 CTCAAGTCCCTTATAAAAAATGG - Intronic
953710795 3:45268673-45268695 CTCAAGTCCCTTCTATAAAATGG + Intergenic
953933988 3:47023828-47023850 CTCAAGTCCCTTATATACAAGGG - Intronic
954267675 3:49482680-49482702 CTCAAGTCCCTTATATAAAATGG - Intronic
954477718 3:50764475-50764497 CTCAAGTCCCTGATATAAAATGG - Intronic
954526763 3:51278810-51278832 ATAAAGTCCATTATGTAAAAAGG - Intronic
954576905 3:51681351-51681373 CTCCAGGCCTCTAGGCAAAAAGG - Intronic
954735475 3:52704058-52704080 CTCAAGTCCCTTATGTAAAATGG + Intronic
955145312 3:56312093-56312115 CTCAAGTCCCTGACATAAAATGG - Intronic
955194730 3:56794667-56794689 CTCAAGTCCATGATATAAAATGG + Intronic
955676869 3:61457971-61457993 CTCAAGTCCCTTATATAAAATGG + Intergenic
955742322 3:62104647-62104669 CTCAAGTCCACTATTTAAAAAGG - Intronic
955749474 3:62173066-62173088 CTCAAGTCCCTTATATAAAATGG + Intronic
955814674 3:62829392-62829414 CTCAAGTCTCTTATATAAAATGG - Intronic
955827222 3:62961296-62961318 CTCAGGTCCTGTATATAAAATGG - Intergenic
956742742 3:72287895-72287917 CTCAAGTCCTTGATATAAAATGG - Intergenic
956757067 3:72399107-72399129 CTCAAGTCCCTTATGTAAAATGG + Intronic
957118332 3:76056226-76056248 CTCAAGTCCTTTACATAAAATGG - Intronic
957198979 3:77107646-77107668 CTCAAGTCCATTTTATAAAATGG - Intronic
957284029 3:78193404-78193426 CTCAAGTTCTTTGTATAAAATGG - Intergenic
957482765 3:80819799-80819821 CTCAAGTCCTCAGTGTAAAATGG - Intergenic
957583197 3:82103189-82103211 CTGAAGTGCTTTATGTTAAATGG - Intergenic
957594601 3:82246344-82246366 CTTAAGTCTCTTATGTAAAATGG + Intergenic
957781877 3:84829112-84829134 CTCAAGTCCCTGAAATAAAATGG + Intergenic
958194376 3:90223974-90223996 CTCAAGTCCCTTATATAAAATGG + Intergenic
958200064 3:90302710-90302732 TTCAAGTCCTGTAGTTGAAAAGG - Intergenic
958417742 3:93895025-93895047 CTCAAGTCCCTTATATAGAATGG + Intronic
958485367 3:94699648-94699670 CTCAAGTCCGTTATATAAAACGG - Intergenic
958494001 3:94818773-94818795 CTCAAATACTTCAGATAAAATGG + Intergenic
958716020 3:97781563-97781585 CTCAAGTCTCTTATATAAAATGG - Intronic
958934834 3:100245195-100245217 CTCAAGTCCCTTATATAAAATGG - Intergenic
959008145 3:101043831-101043853 CACAAGTCCTTTATATAAAATGG + Intergenic
959167662 3:102800840-102800862 CTCAAGTCCCTCACATAAAATGG - Intergenic
959260552 3:104074349-104074371 CTGAAGTCCCTTATATAAAATGG - Intergenic
959287858 3:104439894-104439916 CTCAAGTCCCTCATATAAAATGG + Intergenic
959313832 3:104776810-104776832 CTCAAGTCCTTTTTATAAAATGG - Intergenic
959866074 3:111271454-111271476 CTCAAGTCTTTTATATAAAATGG + Intronic
959961216 3:112301192-112301214 CTCAAGTCACTTATATAAAATGG + Intergenic
960168376 3:114429879-114429901 CTCAAGTCCCTAATATAAAATGG - Intronic
960438983 3:117663550-117663572 CTCAAGTCCTTTATATAAAATGG + Intergenic
960595942 3:119408145-119408167 CTCAAGTCCCTGATATAAAATGG - Intronic
960630033 3:119720778-119720800 CGCAAGTCTCTTATGTAAAATGG + Intronic
960718956 3:120606376-120606398 CTAAAGTCCCTTATGTAAAATGG + Intergenic
960870534 3:122245078-122245100 CTCAAGTCTCTTATATAAAATGG + Intronic
960883852 3:122374400-122374422 CTCAAGTCCCTGATATAAAATGG + Intronic
960905584 3:122597831-122597853 CTCAAGTCCCTTATGTAAAATGG + Intronic
960963446 3:123088679-123088701 CTCAAGTCCTTTATATAAAATGG + Intronic
961031368 3:123607150-123607172 CTCAAGTCCCTTATATAAAATGG + Intergenic
961062913 3:123847231-123847253 CTCAAGTCCCTTATATAAAATGG - Intronic
961154721 3:124669748-124669770 CTCAAGTCCCTTACATAAAATGG + Intronic
961409588 3:126708982-126709004 CTCAAGTCCCTAATGGAAAATGG + Intronic
961409641 3:126709909-126709931 CTCAAGTCCCTTTTATAAAATGG - Intronic
961599136 3:128045609-128045631 CTCAAGTCCCTGATATAAAATGG - Intergenic
962230015 3:133656186-133656208 CTCAAGTCAGATACGTAAAATGG + Intronic
962791507 3:138815766-138815788 CTCAAGTCTCTTAGATAAAATGG - Intronic
962917878 3:139922978-139923000 CTCAAGTCCCTTATATAAAATGG + Intergenic
963068729 3:141284588-141284610 CTCAAGTCCCTTATGTAAAATGG + Intronic
963192985 3:142494222-142494244 CTCAAGTCCTTTATATAAAGTGG - Intronic
963495102 3:146048531-146048553 CTCAAGTCCTTCAAATAAAATGG - Intergenic
963507892 3:146210033-146210055 CTTAAGTCCCTTATATAAAATGG + Intronic
963512562 3:146267062-146267084 CTCAAGTCCTTTATGTACAATGG - Intergenic
963529610 3:146457949-146457971 CTCAAGTCCCTGATATAAAATGG + Intronic
963643009 3:147881391-147881413 CTTAAGTCCTGTAGAGAAAAGGG + Intergenic
963750791 3:149177475-149177497 CTCAAGTCCCTTATATAAAATGG + Intronic
963775937 3:149440201-149440223 CTCAAGTCCCTGATTTAAAATGG - Intergenic
963807123 3:149734366-149734388 TTCAAGTCCCTTACATAAAATGG + Intronic
963881149 3:150530106-150530128 CTCAAGTCCCTTATATAAAATGG + Intergenic
964084504 3:152799595-152799617 CTCAAGTCTTTTATAGAAAATGG + Intergenic
964221424 3:154350820-154350842 CTTAAGTCCCTTATATAAAATGG + Intronic
964224837 3:154386178-154386200 CTCAATTCCCTTAACTAAAAAGG - Intronic
964269044 3:154934979-154935001 CTCAAGTCCCTTATATAAAATGG - Intergenic
964471238 3:157058406-157058428 TTCAAGTCCCTTATATAAAATGG - Intergenic
964592713 3:158383348-158383370 CTCAAGTCCCTTATATAAAATGG - Intronic
964770079 3:160215455-160215477 CTCAAGTCCTTTATATAAAATGG + Intergenic
965116368 3:164494878-164494900 CTCAAGCCATTTATGTTAAAAGG - Intergenic
965420652 3:168454373-168454395 CTCAAGTCCCTTATATAAAATGG - Intergenic
965460675 3:168958378-168958400 CTCAATTCCCTTAGACAAAATGG + Intergenic
965789342 3:172371146-172371168 CTCCAGTCCCTTATATAAAATGG + Intronic
965863356 3:173173804-173173826 CTCAAGTACTTTAAGAAAACAGG - Intergenic
966051533 3:175621788-175621810 CTCAACTCCCTTACATAAAATGG - Intronic
966094501 3:176183494-176183516 CTCAAATCTTTTATATAAAATGG + Intergenic
966102299 3:176285287-176285309 CTCAAGTCCCTTATATAAAATGG - Intergenic
966363517 3:179155665-179155687 TTCAAGTCCCTTATATAAAATGG - Intronic
966501349 3:180644608-180644630 TTCAAGTCCCTTATATAAAATGG + Intronic
966742544 3:183247825-183247847 CCCAAGTCTCTTATGTAAAATGG - Intronic
966744043 3:183258669-183258691 CTCAAGTCCCTTATATAAAATGG + Intronic
966857092 3:184202246-184202268 CTCAAGTCCCTGATATAAAATGG - Intronic
966980047 3:185124175-185124197 CTCAAGTTCCTTATATAAAAGGG - Intronic
967205738 3:187119171-187119193 CTCAAGTCCTTTATATGAAATGG + Intergenic
967212594 3:187181705-187181727 CTCAAGTCCTTGACATAAAATGG - Intergenic
967471788 3:189870480-189870502 CTCAAGTCCCTTATATAAAATGG - Intronic
967476794 3:189930819-189930841 CTCAAGTTCCTTATATAAAATGG + Intergenic
967550147 3:190783798-190783820 CCCAAGTCTTTTATGTAAAATGG - Intergenic
967684148 3:192399986-192400008 CTCAAGTCCTTTACATAAAATGG + Intronic
967704550 3:192634470-192634492 CGCAAGTCCTTTATGTAAAATGG - Intronic
967714389 3:192745523-192745545 CTCAACTCCTTGATATAAAATGG + Intronic
968012057 3:195288987-195289009 CTCATGTCCCTTATATAAAATGG - Intronic
968053358 3:195672089-195672111 CTCAAGTCCCTAATATAAAATGG - Intergenic
968102454 3:195976273-195976295 CTCAAGTCCCTAATATAAAATGG + Intergenic
968159471 3:196413807-196413829 CTCAAGTTCTTCATATAAAATGG + Intronic
968508843 4:986363-986385 CTCAAGTACTTGATATAAAATGG + Intronic
968535032 4:1120072-1120094 CTCAAGTCCCTTATATGAAATGG - Intergenic
968558454 4:1262513-1262535 CTCAAGTCCGTGATGTAAAATGG + Intergenic
968678732 4:1901230-1901252 CTCAAGTCCTTCAGATAAAAAGG + Exonic
968842861 4:3021001-3021023 CTCAAGTCCCTGATATAAAATGG - Intronic
969028097 4:4190680-4190702 CTCAAGTCCTCTATATAAAATGG - Intronic
969238448 4:5884191-5884213 CTCAAATCCTTTGTGTAAAAAGG + Intronic
969685890 4:8674026-8674048 CTCAAATCCCTGACGTAAAATGG - Intergenic
969831434 4:9800821-9800843 CTCAAGTCCCTGATATAAAATGG - Intronic
969993268 4:11286312-11286334 CTCAAGTTCCTTACATAAAATGG - Intergenic
970075509 4:12215080-12215102 TTCAAATCCTTAAGGTCAAATGG - Intergenic
970573692 4:17407038-17407060 TTAAAGTAGTTTAGGTAAAAGGG - Intergenic
970596097 4:17601634-17601656 CTCACATCCCTTATGTAAAATGG + Intronic
970652041 4:18189524-18189546 CTCAAGTGCCTTATATAAAATGG + Intergenic
970899221 4:21139352-21139374 CAGAAGTACTTCAGGTAAAATGG + Intronic
970965237 4:21920687-21920709 CTCAAGTCCCTGATATAAAATGG - Intronic
971584422 4:28387158-28387180 CTCAAGTACTCTACATAAAATGG + Intronic
971622597 4:28874924-28874946 CTCAAGTCCCTTATATAATATGG - Intergenic
972002515 4:34057339-34057361 CTGAATTCCTGTGGGTAAAATGG - Intergenic
972070065 4:35007793-35007815 CCCAAGTCCCTTATATAAAATGG + Intergenic
972151843 4:36101149-36101171 CTCAAGTCCCTTATATCAAATGG - Intronic
972414081 4:38821566-38821588 CTCAAGTCCCTTATGTAAAATGG - Intronic
972594494 4:40517913-40517935 CTCGAGTCCTCTATATAAAATGG - Intronic
972795484 4:42413523-42413545 CTTAAATCCTTTATATAAAATGG + Intronic
972813201 4:42613401-42613423 CTCAAGTCCCTTAAATAAACTGG + Intronic
973018981 4:45176006-45176028 CTCAAGTCCCTGATATAAAATGG + Intergenic
973147742 4:46848874-46848896 CTCAATTCCCTTATATAAAATGG + Intronic
973550829 4:52034553-52034575 CTCAAGTCCCTTATATAAAGTGG - Intronic
973628831 4:52799475-52799497 CTCAAGTTCCTTATATAAAATGG - Intergenic
973658199 4:53073260-53073282 CTCAAGTTCCTTACATAAAATGG - Intronic
973734189 4:53854172-53854194 CTCATGTCCCTTATGTAAAATGG - Intronic
973745992 4:53963827-53963849 CTCAAATGCTTTAAGTAACAAGG - Intronic
973988412 4:56378612-56378634 CTCAAGTCCCTTATATAAAATGG + Intronic
974075752 4:57166791-57166813 CTCAAGTCCCTTACATAAAATGG + Intergenic
974099652 4:57402673-57402695 CTCAAGTCCGTTATATAAAATGG + Intergenic
974598854 4:64049980-64050002 CTCAAGTCCCTTATATAAAATGG + Intergenic
974697581 4:65396276-65396298 CTTAAGTCCTGTAGAGAAAAGGG - Intronic
974736470 4:65940458-65940480 CTCAAATCCCTTAAATAAAATGG + Intergenic
974859754 4:67505498-67505520 CTCAAGTCCCTTATATATAATGG + Intronic
974928428 4:68331053-68331075 CTCAAGTCCCTTATATAAAATGG + Intronic
974932750 4:68377936-68377958 CTCAATTCCCTTATATAAAATGG + Intergenic
975148762 4:70998533-70998555 CTCAAGTCCTTTATGTAAAATGG - Intronic
975538285 4:75475359-75475381 CTCAAGTCTCTTATATAAAATGG - Intergenic
975624490 4:76330780-76330802 CTCAAGTCCCTTATATAAAATGG - Intronic
975641653 4:76506444-76506466 CTCAAGTCCCTTATATAAAATGG - Intronic
975840691 4:78470718-78470740 CTCAAGTCCTTTATACAAAATGG - Intronic
975845494 4:78520530-78520552 CTCAAGTCCCTCATATAAAATGG + Intronic
975894194 4:79066895-79066917 CTCAAGTCGCTTATATAAAATGG + Intergenic
976111341 4:81677169-81677191 CTCAAGTCCATTATATAAAATGG + Intronic
976173323 4:82326824-82326846 CTCAAGACTTTTATATAAAATGG - Intergenic
976403050 4:84629554-84629576 CTCAAGTCCCTTATATAAAATGG - Intronic
976407964 4:84680847-84680869 CTCAAGTCCCTGATATAAAATGG - Intronic
976419640 4:84826356-84826378 CTCAAGTCCCTGATATAAAATGG - Intronic
976548244 4:86363292-86363314 CTCAAGTCCCTTATATAAAATGG - Intronic
976855613 4:89601790-89601812 CTCAAGTCCCTTATATAAAATGG - Intergenic
977000052 4:91486743-91486765 TTCAAGTCCCTTATATAAAATGG - Intronic
977298376 4:95236981-95237003 CTCAAGTCCCTTATGTAAAATGG + Intronic
977324856 4:95562383-95562405 CTCAAGTCCCTGATGTAAAATGG + Intergenic
977366327 4:96073088-96073110 CTCAAGTCTTTTATATAAAATGG - Intergenic
977663526 4:99618211-99618233 CTCAAGTCCCTTATATAAAAAGG - Intronic
977989356 4:103421978-103422000 CTCAAGTCTCTTACATAAAATGG - Intergenic
978000248 4:103548429-103548451 TTCAAGTGCTTTATATAAAATGG + Intergenic
978029075 4:103916041-103916063 CTCAATTCCCTTATGTAAAATGG - Intergenic
978138450 4:105290912-105290934 TTCAAGTCCTTCATATAAAATGG - Intergenic
978175303 4:105723562-105723584 CTCATGTCCTTGATATAAAATGG - Intronic
978305610 4:107324663-107324685 CTCAAGTACCTTATATAAAATGG + Intergenic
978361369 4:107933681-107933703 CTCAAGTCCCTGATATAAAATGG + Intronic
978391146 4:108226601-108226623 CTCAAGTCCCTTATATAAAATGG + Intergenic
978583131 4:110252158-110252180 CTTAAGTTCTTTGTGTAAAATGG + Intergenic
978844988 4:113262789-113262811 CTCAAGTCCTTTATATAAAATGG - Intronic
978903655 4:113981404-113981426 TTCAAGTCCCTTATGTAAAATGG + Intergenic
978993853 4:115124906-115124928 CTCAAGTCCTTGATATAAAATGG - Intergenic
979043064 4:115824298-115824320 TTCAAGGCTTTTATGTAAAATGG + Intergenic
979050136 4:115920446-115920468 CTCAAGTCCCTGATATAAAATGG + Intergenic
979086585 4:116418170-116418192 CTCAAGTCCCTTATATAAAATGG + Intergenic
979196833 4:117929598-117929620 CTCAAGTCCGTTATATAAAATGG - Intergenic
979244112 4:118479286-118479308 CTCAAGTTCCTTATGTAAAATGG + Intergenic
979269495 4:118743447-118743469 CTCAAGTCCCTGACATAAAATGG + Intronic
979344405 4:119569900-119569922 CCCAAGTCCCTTATATAAAATGG - Intronic
979420063 4:120493252-120493274 CTCAAGTCCCTTACATATAATGG + Intergenic
979586541 4:122425759-122425781 CTCAAGTCCCTTATATAAAATGG - Intronic
979602716 4:122603957-122603979 CTGGACTCCTTTAGGTTAAATGG + Intergenic
979651321 4:123135745-123135767 CTCAAGTCCTTTATATAAAATGG - Intronic
979661554 4:123261550-123261572 CTGAAGTCCCTTATATAAAATGG - Intronic
979871323 4:125826110-125826132 CTCAAGTCCCTTATTCAAAATGG - Intergenic
979915237 4:126423611-126423633 CTCAAGTCCCTGATATAAAATGG + Intergenic
980266946 4:130528543-130528565 CTCAAGTCCCTTATATAAAGTGG + Intergenic
980269009 4:130559735-130559757 CTCAAGTCCCTTAAATAAAATGG + Intergenic
980282913 4:130743426-130743448 CTCAAATACTTTAGGTAGTAGGG + Intergenic
980696993 4:136370705-136370727 CTCAAGCTCTTTATATAAAATGG - Intergenic
980947184 4:139332969-139332991 CTCAAGTCCTTGATATACAATGG + Intronic
981095091 4:140770766-140770788 CTCAAGTCCCTTATATAAAGTGG + Intergenic
981261141 4:142720469-142720491 TTCAAGTCCCTTATATAAAACGG + Intronic
981467463 4:145090171-145090193 CACAAGTCCCTTATTTAAAATGG + Intronic
981513928 4:145586951-145586973 TTCAAGTCCCTTATATAAAATGG + Intergenic
981666567 4:147233706-147233728 CTCAAGTCCATTCTATAAAATGG + Intergenic
981860689 4:149352566-149352588 CTTAAGTCCTTTATATAAAATGG - Intergenic
982258839 4:153475855-153475877 CTCAAGTCCCTGATATAAAATGG - Intronic
982376873 4:154701456-154701478 CTAAAGTCCCTTATGTAGAATGG + Intronic
982616939 4:157650557-157650579 CTCAAGTCCCCTATGTAAAATGG - Intergenic
982839816 4:160169674-160169696 CTCAAGTCCCCTATATAAAATGG + Intergenic
983090806 4:163499589-163499611 CTCAGGTCCCTTATATAAAATGG + Intronic
983203738 4:164889955-164889977 CTGAAGTCCCTTATATAAAATGG - Intronic
983381985 4:167007272-167007294 CTCAAGACCCTTATATAAAATGG + Intronic
983548240 4:168986243-168986265 CTCAAGTCCCTTACATAAAATGG - Intronic
983565824 4:169150715-169150737 CTCAAGTCCCTCACATAAAATGG - Intronic
983730097 4:170982829-170982851 CTCAAGTCCCTTATGTGAAATGG - Intergenic
984002918 4:174272278-174272300 CTCAAGTCCCTTGTATAAAATGG + Intronic
984098354 4:175458683-175458705 CTCAAGTCCCTTATGTACAATGG - Intergenic
984225352 4:177028232-177028254 CTCAAGCCCCTTATATAAAATGG + Intergenic
984399067 4:179238479-179238501 CTCAAGTCTCTTATATAAAACGG - Intergenic
984461262 4:180040142-180040164 CTCAAGTCCCCTATGCAAAATGG - Intergenic
984754058 4:183308626-183308648 CTCAAGTCCTTTATATAATATGG + Intronic
984792181 4:183625047-183625069 CTCAAGTCCCTGATATAAAATGG + Intergenic
984837540 4:184035797-184035819 CTCAAGTCCTTGATATAAAATGG - Intergenic
984895730 4:184537793-184537815 CTCAAGTCCCTGATATAAAATGG + Intergenic
984924391 4:184793892-184793914 CTCAAGTCCCTGATATAAAATGG + Intronic
985117796 4:186608234-186608256 CTCAAGTCCTTGATATAAAATGG + Intronic
985128563 4:186719394-186719416 CTCAAGTCCCTGATATAAAATGG - Intronic
985295546 4:188433550-188433572 CTCAAGTCCCTTATACAAAACGG + Intergenic
985499650 5:234743-234765 CTCAAGTCCCTAATATAAAATGG - Intronic
986057284 5:4150934-4150956 CTCAAGTCCTTTATATAAAATGG - Intergenic
986374924 5:7121214-7121236 CTCAAGGCCCTTATATAAAATGG - Intergenic
986398796 5:7358852-7358874 CTCAAGTTCCTTATATAAAATGG - Intergenic
986529212 5:8717204-8717226 CTCAAGTGCTTTAAGTGGAAAGG - Intergenic
986659077 5:10042837-10042859 CTCAAGTCCCTGACATAAAATGG + Intergenic
987477652 5:18411459-18411481 CTCAAGTCTGTAATGTAAAATGG - Intergenic
987632930 5:20499206-20499228 CTCAAGTCCATGATATAAAATGG + Intronic
987719203 5:21613049-21613071 CTCAAGTCTTTAAAGAAAAAAGG + Intergenic
987786781 5:22510592-22510614 CTCAAGTCTTTTATGTAAAAAGG + Intronic
987831373 5:23100145-23100167 TTCAAGTCTCTTACGTAAAATGG - Intergenic
988151351 5:27385906-27385928 CTCAAGTCCTTTATATAAAATGG + Intergenic
988243311 5:28642614-28642636 CTCAAGTCCCTTATATAAAATGG + Intergenic
988666679 5:33336364-33336386 CTCAAGTCCCTTATACAAAATGG + Intergenic
988790999 5:34607522-34607544 CTCAAGTCCCTGATGTAAAATGG - Intergenic
989024198 5:37047146-37047168 CTCAAGTCCCTGATATAAAATGG - Intronic
989033894 5:37149284-37149306 CTCAAGTCCCTTATATAAAATGG + Intronic
989222571 5:38985217-38985239 CTCAAGTCCTTTATATAAAATGG + Intronic
989256418 5:39370379-39370401 CTCAAGTCCGTTATATAAAATGG + Intronic
989280579 5:39638160-39638182 CTCAAATCCCTTATATAAAATGG + Intergenic
989514470 5:42326034-42326056 CTCAAGTCCCTTATATAAAATGG - Intergenic
989520532 5:42395980-42396002 CTCAAGTCCCTTATGTAAAATGG - Intergenic
989556870 5:42807603-42807625 CTCAAATCCTTTATATAAAATGG - Intronic
990219063 5:53566635-53566657 CTCAAGTCCTTGATTTAAGATGG + Intronic
990660854 5:58013637-58013659 CTCAACTCCATGAGGTAAACTGG + Intergenic
990713899 5:58615010-58615032 CTCAAGTACTTGATATAAAATGG - Intronic
990964180 5:61427262-61427284 CTTAAGTCCCTTATATAAAATGG + Intronic
991284174 5:64952065-64952087 CTCCAGTCCTTGATATAAAATGG + Intronic
991603880 5:68380818-68380840 CTCAAGTCCCTGATATAAAATGG + Intergenic
991655864 5:68903136-68903158 CTCAAGTCTCTTACATAAAATGG + Intergenic
991913101 5:71581022-71581044 CTCAAGTCCTTTATATAAAATGG + Intergenic
992119335 5:73574922-73574944 CCCAAGTCCCTTATTTAAAATGG + Intronic
992176704 5:74156480-74156502 CTCAAGTCCCTTATATAAAATGG - Intergenic
992313560 5:75528959-75528981 CTCAAGTCCCTGATATAAAATGG + Intronic
992629143 5:78664127-78664149 CTCAAGTCCTTTATATAAAATGG - Intronic
992732500 5:79687441-79687463 CTCAAGTCCCTTATATAAAATGG + Intergenic
992792174 5:80223275-80223297 CTCAAGTCCCTGATATAAAATGG + Intronic
992848779 5:80782502-80782524 CTCAAATCCCTTACATAAAATGG - Intronic
992912841 5:81415345-81415367 CTTAAGTCCTTTATATAAAACGG + Exonic
992932074 5:81658419-81658441 CTCAAGTCCCTTATACAAAATGG + Intronic
992938318 5:81735421-81735443 CTCAAGTCCCTTACATAAAATGG + Intronic
992985935 5:82229783-82229805 TTCAAGTCCCTTATGTAAAGTGG - Intronic
993340721 5:86722083-86722105 CTCAAGTCTCTTATATAAAATGG + Intergenic
993355270 5:86898788-86898810 CTCAAGTCCTTTATATAAAATGG - Intergenic
993447811 5:88036248-88036270 CTCAAGTCCTTTATATAAAGTGG + Intergenic
993640391 5:90397054-90397076 CTCAAGTCCCTTGTATAAAATGG - Intronic
993875931 5:93306637-93306659 CTCAAGTCCCTTACATAAAATGG + Intergenic
993923861 5:93841457-93841479 CTCAAGTCACTTATATAAAATGG - Intronic
993930930 5:93937755-93937777 CTCAAGTGCCTTATATAAAATGG + Intronic
994112453 5:96022139-96022161 CTCAAGCCCTTTATATAAAATGG - Intergenic
994244986 5:97468478-97468500 CTTAAGTCCTGTAGAGAAAAGGG + Intergenic
994527811 5:100928418-100928440 CTCAAGTCCCTTATGTAAAATGG + Intergenic
994630030 5:102274137-102274159 CTCAAGTCCCTTCTATAAAATGG - Intronic
994862143 5:105210347-105210369 CTCACGTCCTTTATATAAAATGG - Intergenic
995134288 5:108663760-108663782 CTCAAGTCCCATATGTAAAAAGG + Intergenic
995235042 5:109818960-109818982 CTCAAGTCCTTTATATAAAATGG + Intronic
995344871 5:111101066-111101088 CTCAAGTCCCTTACATAAAATGG - Intronic
995363785 5:111330661-111330683 CTCAAGTCCCTTATATAAAATGG - Intronic
995396009 5:111687883-111687905 CTCAAGTCCTTGATATAAAATGG - Intronic
995425375 5:112015841-112015863 CTCAAGTCCATTATATACAATGG - Intergenic
995623339 5:114052201-114052223 CTCAAGTCCCTTATAAAAAATGG - Intergenic
995708375 5:115009351-115009373 CTCAAGTCCCTGATATAAAATGG + Intergenic
995834843 5:116389708-116389730 CTCAAGTCCCTTATATAAAATGG - Intronic
996261824 5:121480866-121480888 CTCAAGTCCCTTATATAAAATGG + Intergenic
996635768 5:125687941-125687963 CTCAAGTCCCTTATATAAAATGG + Intergenic
996869169 5:128167132-128167154 CTCAAGTCCCTTATATAAAATGG - Intronic
997088653 5:130830471-130830493 CTCAAGTTCCTTACATAAAATGG + Intergenic
997278020 5:132614533-132614555 CTCAAGTCCCTTATATAAAATGG + Intronic
997549811 5:134742118-134742140 CTCAAGTCCCTTATGTAAAACGG - Intronic
997555973 5:134799074-134799096 CTCAAGTCCCTTATATAAAATGG - Intronic
997751548 5:136350970-136350992 CTCAAGTCCCTGATATAAAATGG + Intronic
997889580 5:137663406-137663428 CTCAAGTCCCTTATATAAAATGG + Intronic
998123027 5:139594869-139594891 CTCAAGTCCCTGATATAAAATGG + Intronic
998780328 5:145649239-145649261 CTCAAGTCCCTTATATAAAATGG - Intronic
998868076 5:146525680-146525702 CTCAAGTCCCTGATATAAAATGG - Intergenic
999036909 5:148361734-148361756 CTCAAGTCCTTTATATAAAGTGG - Intergenic
999059961 5:148623260-148623282 CCCAGGTCCTTCAGGAAAAATGG + Intronic
999109423 5:149105352-149105374 CTCAAGTCCCTGATATAAAATGG + Intergenic
999371469 5:151057894-151057916 CTCAAGTCCCTGATGTAAAATGG - Intronic
999403544 5:151286253-151286275 CTCAAGTCCTTGATATAAAATGG + Intronic
999491200 5:152053163-152053185 CTCAAGGCCTTGATATAAAATGG - Intergenic
999526992 5:152417511-152417533 CTCAAGTCTTTTATATAAAATGG + Intronic
1000136053 5:158352071-158352093 CGCAAGTCCTTTAGGAAGAAAGG + Intergenic
1000405800 5:160887205-160887227 CTCAAGTCCTTGATATAAAATGG + Intergenic
1000574399 5:162958855-162958877 GTCAAGTCCATTACGTAAAATGG - Intergenic
1000635985 5:163644199-163644221 CTCAAGGCCCTTATATAAAATGG + Intergenic
1000851494 5:166345798-166345820 CCAAAGTCCTTTAGGAAAAAAGG + Intergenic
1001006321 5:168053701-168053723 CTCAAGCTCTTTATATAAAATGG - Intronic
1001050807 5:168412870-168412892 CTCAAGTGCTTTATATAAAATGG - Intronic
1002513531 5:179739812-179739834 CTCAAGTCCCTTACATAAAATGG - Intronic
1002883339 6:1272272-1272294 CTCAAGTCCCTGATATAAAATGG - Intergenic
1002958015 6:1887796-1887818 CTCAACTCCCTTATGTGAAATGG + Intronic
1002988412 6:2214562-2214584 CTCAAGTCCCTTAAATAAAATGG - Intronic
1003005536 6:2377753-2377775 CTCATGTCCTTGATATAAAATGG - Intergenic
1003259233 6:4501746-4501768 CTCAAGTCTTTGATATAAAATGG - Intergenic
1003365444 6:5470363-5470385 CTCAAGTCCCTCATATAAAATGG - Intronic
1003379496 6:5610572-5610594 CTCAGGTCCCTTATATAAAATGG - Intronic
1003383512 6:5646643-5646665 CTCAAGTCCCTGATATAAAATGG + Intronic
1003830729 6:10008045-10008067 CTCAAATCCCTTATATAAAATGG - Intronic
1003854411 6:10258509-10258531 CTCAATTCATTTGGGTAAATAGG - Intergenic
1004167720 6:13271556-13271578 CTCAAGTCCCTTGTATAAAATGG + Intronic
1004172984 6:13313134-13313156 TTCAAGTCCCTTACATAAAATGG - Intronic
1004327465 6:14688454-14688476 CTCAAGTCCCTTAAATAAGATGG + Intergenic
1004419844 6:15459272-15459294 CTCAAGTCCATTATGTAACATGG + Intronic
1004464264 6:15869552-15869574 CTCAAGTCCCTTATATAAAATGG - Intergenic
1004596583 6:17105146-17105168 TTCAAGTCCTTTATAGAAAATGG - Intronic
1004736810 6:18414984-18415006 CTCAAGTCCCTTATATAGAATGG + Intronic
1004917761 6:20347753-20347775 CTCAAGTCCTGAATATAAAATGG - Intergenic
1005075770 6:21905393-21905415 ATCAGGTGCTTTAGGTAAAAGGG - Intergenic
1005139301 6:22609440-22609462 CTCAAGTCCCTTATAAAAAATGG - Intergenic
1005202839 6:23366301-23366323 CTCAAGTCCCTTATATAAATTGG + Intergenic
1006238219 6:32654457-32654479 CTCAAGTCCCTTATTAAAAATGG + Intergenic
1006560157 6:34904116-34904138 CTCAAGTCCTTTATATAAAATGG + Intronic
1006567250 6:34970503-34970525 CTCAAGTCCCTTATGTAAAACGG + Intronic
1006687948 6:35853429-35853451 CTCAAGTACTTTACATAAAATGG - Intronic
1006842192 6:37036161-37036183 CTCAAGTCCCTGATATAAAATGG + Intergenic
1006976972 6:38111904-38111926 CTCAAGTCCCTTATATAAAATGG - Intronic
1007023290 6:38544264-38544286 CTCAAGTCTGTTATATAAAATGG - Intronic
1007334848 6:41148320-41148342 CTCAAGTCCCTTTTATAAAATGG + Intergenic
1007569771 6:42881153-42881175 CTGAAGTCCCTTATATAAAATGG + Intronic
1007600767 6:43079526-43079548 CTCAAGTCTCTTATATAAAATGG + Intronic
1007940074 6:45772173-45772195 CTTAAGACCTTTAAGTAAGACGG + Intergenic
1008085827 6:47243022-47243044 CTCAAGACCTTGAAGTAAGAAGG + Intronic
1008288559 6:49684212-49684234 CTCAAGTCCTTTATATAAAATGG + Intergenic
1008413400 6:51210567-51210589 TTCAAGTCTTTTATATAAAATGG + Intergenic
1008498208 6:52153903-52153925 GTTAAGTGCCTTAGGTAAAAAGG - Intergenic
1008591540 6:52998314-52998336 CTCCAGTCCCTTATATAAAACGG + Intergenic
1008795874 6:55302397-55302419 CTCAGGTCCCTTATATAAAATGG + Intergenic
1009211268 6:60865958-60865980 CTTAAGTCCCTTATGTAAAATGG + Intergenic
1009253240 6:61337855-61337877 CTTAAGTCCTATAGCTGAAAGGG + Intergenic
1009257926 6:61439676-61439698 CTTAAGTCCTATAGCTGAAAGGG + Intergenic
1009285760 6:61814902-61814924 CTCAAGTTCCTTATATAAAATGG + Intronic
1009311675 6:62161528-62161550 CTCAAGTTCCTTATTTAAAATGG - Intronic
1009334242 6:62465834-62465856 CTCAAGTACCTTATATAAAATGG + Intergenic
1009419443 6:63449056-63449078 CTCAAGTTCCTTATATAAAATGG - Intergenic
1009615196 6:65995602-65995624 CTCAAGTTCCTTACATAAAATGG + Intergenic
1009859319 6:69306054-69306076 CTCAACTCCCTTATATAAAATGG - Intronic
1009903119 6:69833555-69833577 CTCAAGTCCCTGAAATAAAATGG - Intergenic
1009927734 6:70140196-70140218 CTCAAGTCCCTAATATAAAATGG + Intronic
1010214618 6:73390398-73390420 CTCAAATTCTTTACGTAAAATGG + Intronic
1010333722 6:74655865-74655887 CTCAAGTCCCTGAATTAAAATGG + Intergenic
1010410443 6:75555277-75555299 CTCAAGTCCCTTATATAAAATGG - Intergenic
1010420665 6:75671404-75671426 GACAAGTGCTTTATGTAAAAAGG - Intronic
1010571750 6:77481849-77481871 CTCAAGTCCCTTATATAAAATGG - Intergenic
1010702421 6:79066659-79066681 ATAAATTCCTATAGGTAAAAGGG + Intronic
1010720549 6:79278497-79278519 CTCAAGTCCCTTATATAAAATGG + Intergenic
1010754990 6:79656762-79656784 CTCAAATCCTTGATGTAAAATGG - Intronic
1010791580 6:80070762-80070784 CTAAAGTCCCTTATATAAAATGG - Intergenic
1010845315 6:80700267-80700289 CTCAAGTCCATTACGTAAAATGG - Intergenic
1010979791 6:82358789-82358811 CTCAAGTTCCTTAAGTTAAATGG + Intergenic
1011190547 6:84723432-84723454 CTCAAGTCCCTTATAAAAAATGG + Intronic
1011420677 6:87168887-87168909 CTCAAGTCCCTTAAATGAAATGG + Intronic
1011427906 6:87250634-87250656 CTCAAGTCCCTTATATAAAATGG - Intronic
1011534609 6:88362579-88362601 CTCAAGTCCATTATATAAAATGG + Intergenic
1011680471 6:89778572-89778594 CTCAAGTCCCTTATATAAAATGG + Intronic
1011742860 6:90380450-90380472 CTCAAGTCCATTATATAAAGTGG + Intergenic
1011980597 6:93371432-93371454 CTTAAGTCCCTTATATAAAATGG - Intronic
1011989270 6:93492273-93492295 CTCAAGGCCCTTATATAAAATGG + Intergenic
1012118229 6:95331892-95331914 GTTAAGTCCTTTTGTTAAAAGGG + Intergenic
1012226470 6:96709456-96709478 CTCAAGTCCCTTATATAAAATGG - Intergenic
1012291144 6:97457441-97457463 CTTAAGTCTTTTATATAAAATGG - Intergenic
1012329779 6:97970357-97970379 CTCAAGTCCTTTATCTAAAATGG - Intergenic
1012467173 6:99529135-99529157 CTCAAGTCCCTTATATATAATGG - Intergenic
1012507579 6:99966112-99966134 CTCAAGTCCTTTGAGGAAGATGG + Intronic
1012534517 6:100279613-100279635 CTCAAGTCCCTTGTATAAAATGG - Intergenic
1012538586 6:100330962-100330984 CTCAAGTCCCTTGCATAAAATGG - Intergenic
1012567039 6:100670370-100670392 CTTAAGTCCCTTATATAAAATGG + Intronic
1012686292 6:102254309-102254331 CCCAAGTCCATTAGTCAAAAGGG - Intergenic
1012819891 6:104072914-104072936 CTCAAGTCCTTTATATAAAATGG + Intergenic
1012914225 6:105151267-105151289 CTCAAGTCCTTGATATAAAATGG + Intergenic
1013030042 6:106324364-106324386 CTCAAGTCCCTGATATAAAATGG - Intronic
1013137709 6:107298484-107298506 CTCAAGTCCCTGATATAAAATGG - Intronic
1013226519 6:108122747-108122769 CTCAAGTCCCTGATATAAAATGG + Intronic
1013252901 6:108352412-108352434 CTCAAGTCCCTTATGTAAAATGG + Intronic
1013446018 6:110227820-110227842 CTCAAGTCCCTTATATAAAATGG - Intronic
1013452722 6:110300970-110300992 CTCAAGTCCTGGATATAAAATGG - Intronic
1013505864 6:110799431-110799453 CTCAAGTCCCTGATATAAAATGG + Intronic
1013535222 6:111057663-111057685 CTCAAGTCCCTTATATAAAATGG - Intergenic
1013701311 6:112773522-112773544 TTCAAGTCCTTTAAATGAAATGG - Intergenic
1014030055 6:116690789-116690811 CTCAGGTCCTTTATGTAAAATGG + Intronic
1014032904 6:116727546-116727568 CTCAATTCCTTTATATAAAATGG - Intronic
1014264352 6:119258535-119258557 CTCAAGTACCTTATATAAAATGG - Intronic
1014487980 6:122024099-122024121 CTCAAGTCCCTAATATAAAATGG + Intergenic
1014539524 6:122657251-122657273 CTCAAGTCCTATTGGATAAAGGG - Intronic
1014607843 6:123499933-123499955 TTCAAGTCTTTTATATAAAAGGG - Intronic
1014630000 6:123776951-123776973 CTCAAGTCCGTCATATAAAATGG + Intergenic
1014688745 6:124534922-124534944 CTCAAGTCCCTTATATAAAATGG + Intronic
1014759388 6:125339256-125339278 CTCAAGTCCCTGATATAAAATGG + Intergenic
1014768214 6:125431748-125431770 CTCAAGTCCCTGATATAAAATGG + Intergenic
1014993591 6:128113620-128113642 CTCAAGTCCCTTACACAAAATGG - Intronic
1015027093 6:128548035-128548057 CTCAAGTCCCTTTTATAAAATGG - Intergenic
1015074522 6:129139529-129139551 CTCAAGTCCTTGAAATGAAATGG - Intronic
1015097931 6:129439099-129439121 CTCAAGTCCCTTTTATAAAATGG + Intronic
1015372736 6:132473352-132473374 CTCAAGTCCCTGATATAAAAAGG + Intronic
1015524133 6:134159575-134159597 CTCAAGTCGCTTAAATAAAATGG - Intergenic
1015546405 6:134366027-134366049 CTCAAGTCCCTTATATAAAATGG + Intergenic
1015690075 6:135912452-135912474 CTCAAGTCCCTAATATAAAATGG - Intronic
1015829119 6:137348625-137348647 CTCAAGTCCCTGATATAAAATGG - Intergenic
1015894470 6:138003374-138003396 CTCAAGTCCCTGATATAAAATGG - Intergenic
1016442379 6:144096808-144096830 CTCAAGTCCCTGATATAAAACGG - Intergenic
1016513819 6:144871935-144871957 CTCAAGTACCTTATTTAAAAGGG - Intergenic
1016749336 6:147615117-147615139 CTCAAGTCCCTTATATAAAGTGG - Intronic
1016751245 6:147632613-147632635 CTCAAGTTTTTTGGATAAAAAGG + Intronic
1017103648 6:150868196-150868218 CTCAATTCCTTCAGGAAAATGGG + Intronic
1017343308 6:153351956-153351978 CTCAAGTCTTTTATATAAAATGG - Intergenic
1017366993 6:153654880-153654902 CTCTAGTCCCTGATGTAAAATGG - Intergenic
1017475280 6:154784717-154784739 CTCACGTCCCTTATATAAAATGG - Intronic
1017654142 6:156611191-156611213 CTCAAGTCTCTTATATAAAATGG - Intergenic
1017803180 6:157917629-157917651 CTCAAGTCCCTGATATAAAATGG + Intronic
1017991862 6:159496178-159496200 CTCAAGTCTGTTATATAAAATGG - Intergenic
1018129116 6:160711297-160711319 CTCAAGTCCCTTATATAAAATGG + Intronic
1018405326 6:163475479-163475501 CTCAAGTCCCTTATATAAAACGG - Intronic
1018410711 6:163544319-163544341 CTCAAGTCCATGATATAAAATGG - Intronic
1018439327 6:163794860-163794882 CTCAAGTCCCTTAAATAAAATGG + Intergenic
1018637795 6:165879619-165879641 CTCAAGTCGCTGATGTAAAACGG + Intronic
1019767372 7:2861594-2861616 CTCAAGTCCCTAATATAAAATGG + Intergenic
1020344511 7:7148689-7148711 CTCAAGACCCTTATATAAAATGG - Intergenic
1020375435 7:7479105-7479127 CTCAAGTCCCTTGTATAAAATGG - Intronic
1020632893 7:10661852-10661874 CTCAAGTCCCTTATATGAAATGG - Intergenic
1020793469 7:12655062-12655084 CTCAAGTCCCTTATATAAAACGG + Intergenic
1020903647 7:14038002-14038024 CTCAAGTCCCTTATATAAAATGG - Intergenic
1021152707 7:17170798-17170820 CTCAAGTCCCTTGTATAAAATGG + Intergenic
1021233319 7:18111519-18111541 CCCAAGTCTCTTGGGTAAAAGGG + Intronic
1021363350 7:19745056-19745078 CACAAGTCCCTTATGTAACAAGG + Intronic
1021415167 7:20375923-20375945 ATAAAATTCTTTAGGTAAAATGG + Intronic
1021516794 7:21498315-21498337 CTCAAGTCTCTTATATAAAATGG - Intronic
1022122472 7:27322944-27322966 CTCAAGTCCCTGATATAAAATGG - Intergenic
1022407689 7:30106885-30106907 CAGAAGTCCCTTATGTAAAATGG - Intronic
1022817787 7:33930012-33930034 CTCAAGCCCTTAACGTAAAGTGG - Intronic
1022844586 7:34197210-34197232 CTCAAGTCCCTTATATAAAATGG - Intergenic
1022886273 7:34648982-34649004 CTCAAGTCGCTTATATAAAACGG - Intergenic
1023039171 7:36157154-36157176 CTCAAGTCCCTGATATAAAATGG - Intronic
1023051999 7:36261000-36261022 CTCAAGTCCCTGATATAAAATGG - Intronic
1023114705 7:36851340-36851362 CTCAAGTCCCTTATATAAAATGG - Intergenic
1023222644 7:37935105-37935127 CTCAAGTCCCTTAGATAAAATGG - Intronic
1023253272 7:38287872-38287894 CTCAAGTCCCTGATATAAAATGG + Intergenic
1023414147 7:39916562-39916584 CTCAAATCCTGTAGGAATAAAGG - Intergenic
1023506668 7:40906686-40906708 TTCGAGTCCTTTATATAAAACGG - Intergenic
1023608270 7:41949103-41949125 CTGAAGTCCTTGATATAAAATGG + Intergenic
1024386474 7:48757513-48757535 CTCAAGTCCGTTATATAAAATGG + Intergenic
1024420563 7:49160746-49160768 CTCAAGTACTGTAGCTATAAAGG + Intergenic
1024567302 7:50692209-50692231 CTCAAGGCCCTGATGTAAAATGG - Intronic
1024607688 7:51036031-51036053 CTCAACTCCTTTGTATAAAATGG + Intronic
1024672628 7:51609865-51609887 CTCAAGTCCTTGATACAAAATGG + Intergenic
1024949743 7:54847741-54847763 CTCAAGTTCTTTATATGAAATGG - Intergenic
1025936274 7:66040288-66040310 CTCAAGTCCCTGATATAAAACGG - Intergenic
1025947893 7:66118617-66118639 CTCAAGTCCCTGATATAAAACGG + Intronic
1025971721 7:66332844-66332866 CTCAAGTGCCTTATATAAAATGG - Intronic
1026548945 7:71350672-71350694 CTCAAGTCCCTTGTATAAAATGG - Intronic
1026934779 7:74247894-74247916 CTCAAGTCCCTTATATGAAATGG + Intronic
1027586886 7:80068945-80068967 CTCAAGTACTTTATATAAAAAGG - Intergenic
1027591307 7:80122347-80122369 CTCAAGTCCCTAATGTCAAATGG + Intergenic
1027847643 7:83402860-83402882 GTCAAGTCTTTTGGGTAAAGTGG + Intronic
1027877036 7:83784096-83784118 CTCAAGTCCGTTATGGAAAAAGG + Intergenic
1028207751 7:88035739-88035761 CTCAAGTCTGTTATATAAAATGG - Intronic
1028360573 7:89962158-89962180 CTCAAGTTCCTGATGTAAAATGG - Intergenic
1028507077 7:91582579-91582601 CTCAAGTTCCTTATATAAAATGG - Intergenic
1028520025 7:91719860-91719882 CTCAAGTCCCTTATATTAAATGG - Intronic
1028556549 7:92132298-92132320 CTCAAGTCCCTTATATAAAATGG + Intronic
1028574126 7:92327432-92327454 CTCAAGTCCCTTATGTAAAATGG + Intronic
1028585088 7:92444835-92444857 CTCAAGTCCCTTATATAAAATGG - Intergenic
1028660273 7:93264029-93264051 CTCAAGTTCTTTATATAAAATGG - Intronic
1028707011 7:93861195-93861217 CTCAAATCCCTTATGTAAAGTGG - Intronic
1028731521 7:94156577-94156599 CTCAAATCCTTTAAGTAACAAGG + Intergenic
1028834477 7:95359066-95359088 CTCAAGTCCCTGATATAAAATGG + Intergenic
1029054670 7:97729401-97729423 CTCAAGTCCCTGATGCAAAATGG - Intergenic
1029176276 7:98666975-98666997 CTCAATTCTTATAGGGAAAATGG - Intergenic
1029219818 7:98979300-98979322 CTCAAGTCCCTGATATAAAACGG + Intronic
1029901521 7:104045732-104045754 CTCAAGTCCCTTCTATAAAACGG + Intergenic
1030015263 7:105213037-105213059 CTCAAGTCCTTGATATAAAATGG - Intronic
1030019820 7:105262391-105262413 CTCAAGGGCTTTAAGTAAAGAGG + Intronic
1030020097 7:105265402-105265424 CTCAAGTCCTTCATGTAAAATGG - Intronic
1030296744 7:107936451-107936473 GTCAAGTCCGTTATATAAAATGG - Intronic
1030316072 7:108115783-108115805 CTCAAGTCCCTGATCTAAAATGG - Intronic
1030413081 7:109206223-109206245 CTCAAGTTCTTCATATAAAATGG - Intergenic
1030515338 7:110531568-110531590 CTCAACTCCCTTATATAAAATGG - Intergenic
1030717525 7:112827573-112827595 TTCAAGTCCTTTATATAAAATGG + Intronic
1030734629 7:113032224-113032246 CTCAAGTCCCTGATATAAAATGG + Intergenic
1030738394 7:113078679-113078701 CTCAATCCCTTTGGGTTAAAAGG - Intronic
1030881986 7:114891322-114891344 CTCAAGTCCCTTAAATAAAATGG + Intergenic
1031169375 7:118273186-118273208 GCCACGTCCTTTAGGAAAAAGGG - Intergenic
1031185327 7:118472646-118472668 CTCAAGTCCCTTTTATAAAATGG - Intergenic
1031292895 7:119960950-119960972 CTCAAGTCCCTGATTTAAAATGG - Intergenic
1031314735 7:120241856-120241878 CTCAAGTCCCCTACATAAAATGG - Intergenic
1031587411 7:123549083-123549105 CTCAAGTCCCTTATATAAAATGG - Intronic
1031625780 7:123991435-123991457 CTCAAGTCCCGTATATAAAATGG + Intergenic
1031675437 7:124605504-124605526 CTCAAGTCCCTTATATAAAATGG + Intergenic
1031679348 7:124652105-124652127 CTCAAGTCCCTTACAAAAAATGG - Intergenic
1031707684 7:125001881-125001903 CTGAAGTCCCTTATATAAAATGG - Intergenic
1031708278 7:125010386-125010408 CTCAAGTCCGTTATGTAAAATGG + Intergenic
1031741927 7:125443413-125443435 CTCAAGTCCCTGATATAAAATGG + Intergenic
1031932641 7:127701751-127701773 CTCGAGTCCTTTATATAAAATGG + Intronic
1032103271 7:129001503-129001525 CCCAAGTCCCTTATATAAAATGG - Intronic
1032133162 7:129248325-129248347 CTCGAGTCCCTTATATAAAATGG + Intronic
1032158470 7:129490764-129490786 CTCAAGTCCTTGATATAAAATGG - Intergenic
1032178943 7:129658976-129658998 CTCAAGTCCCTGATATAAAATGG - Intronic
1032309941 7:130775882-130775904 CTCAAGTCCCTTATATAAAATGG - Intergenic
1032562127 7:132903160-132903182 CTCAAGTCCCTGATATAAAATGG + Intronic
1032564396 7:132926673-132926695 CTCAAGTCCCTCATGTAAAATGG + Intronic
1032773213 7:135080908-135080930 CTCAAATCCTTTTGGGAAATAGG - Intronic
1032800619 7:135314737-135314759 CTCAAGTCATCTAGGCAAAGAGG + Intergenic
1032814362 7:135456596-135456618 CTCAAGTCCCTTATATAAAATGG + Intronic
1032900328 7:136300130-136300152 CTCAAGTCCCTGATATAAAATGG - Intergenic
1033481757 7:141749260-141749282 CTCAAGTCCCTGATATAAAATGG - Intronic
1033947293 7:146736193-146736215 CTCAAATCCCTTATGTCAAACGG - Intronic
1034097403 7:148422816-148422838 CTCACGTCCCTTATATAAAATGG - Intergenic
1034144074 7:148852929-148852951 CTCAAGTCCCTGATATAAAATGG + Intronic
1034153534 7:148935878-148935900 TTCAAGTCCTTTATATAAATTGG + Intergenic
1034178542 7:149119929-149119951 CTCAAGTCCCTTATATAAAATGG - Intronic
1034699969 7:153087352-153087374 CTCAAGTCCTTTCTAGAAAATGG + Intergenic
1035013313 7:155740068-155740090 CTCAAGTCCTGTAAGTTAAAAGG - Intronic
1035145248 7:156809422-156809444 CTCAAGTCCCTTATGTAAAATGG + Intronic
1035200019 7:157256787-157256809 CTCAAGTCCCTTCTCTAAAACGG - Intronic
1035440925 7:158899077-158899099 CTCAAGTTCCTTAAGTAAAATGG + Intronic
1035596385 8:861304-861326 CTCAAGTCCCTTATATAAAAAGG - Intergenic
1035718825 8:1775283-1775305 CTCAAGTCCCTTATATAAAATGG - Intronic
1035880428 8:3240128-3240150 GTCAAGTAATTTGGGTAAAAAGG + Intronic
1035950235 8:4011873-4011895 CTCAAGTCCCTTATATAAAATGG + Intronic
1035958404 8:4109038-4109060 CTCAAGTCCGTCATATAAAATGG + Intronic
1036037674 8:5037827-5037849 CTCAAGTTCCTTATATAAAATGG + Intergenic
1036131639 8:6120372-6120394 CTCAAGCCCCGTATGTAAAATGG - Intergenic
1036279499 8:7387972-7387994 CTGAAGTCCTTGATGTAAAATGG - Intergenic
1036296097 8:7539199-7539221 CTCAAGTCCCTTGTATAAAACGG - Intergenic
1036326469 8:7781820-7781842 CTCAAGTCCCTTGTATAAAACGG + Intergenic
1036342020 8:7923905-7923927 CTGAAGTCCTTGATGTAAAATGG + Intergenic
1036517759 8:9460366-9460388 CTCAAGTCCCTGATATAAAATGG - Intergenic
1036925508 8:12901297-12901319 CTCAAGTCCCTGATATAAAATGG - Intergenic
1037073598 8:14684308-14684330 ATCAAGTTCTTTAGGGAAAGTGG + Intronic
1037414164 8:18630937-18630959 CTCAAGTCCCTGATATAAAATGG - Intronic
1037433263 8:18836638-18836660 CTCCAGACCTTTATATAAAATGG + Intronic
1037844616 8:22272232-22272254 CTCAAGTCTCTTATATAAAATGG - Intergenic
1038126852 8:24684383-24684405 CTCAAGTCTCTTATATAAAATGG - Intergenic
1038226295 8:25661085-25661107 CTCAAGTCCCTGATATAAAATGG - Intergenic
1038386407 8:27152060-27152082 CTCAAGTCCCTTATATAAAATGG - Intergenic
1038511478 8:28140016-28140038 CTCAAGTCCCTCATATAAAATGG - Intronic
1038532552 8:28330252-28330274 CTCAAGTCCCTTATATAAAATGG - Intronic
1038558979 8:28553019-28553041 CTCAAGTCCCTTATATAAAATGG - Intronic
1038598373 8:28911756-28911778 CTCAAATCACTTATGTAAAATGG - Intronic
1038655518 8:29447496-29447518 CTCAAGTCCCTGATATAAAATGG + Intergenic
1038801256 8:30751032-30751054 CTCAAGTCCCTGATATAAAATGG - Intronic
1038920229 8:32075512-32075534 CTCAAATCCCTTACATAAAATGG + Intronic
1038937251 8:32265983-32266005 CTCAAGTCCCTGATGTAAAACGG - Intronic
1039365033 8:36920243-36920265 CTCAAGTCCTTTATATAAAATGG + Intronic
1039450319 8:37668560-37668582 TTCAAGTCCCTTACATAAAATGG + Intergenic
1039501991 8:38025254-38025276 CTCAAGTCCCTGATATAAAATGG - Intergenic
1039572212 8:38596307-38596329 CTCAAGTCCCTGATATAAAATGG - Intergenic
1041078495 8:54190858-54190880 CTCAAGTCCCATATATAAAATGG - Intergenic
1041137556 8:54776490-54776512 CTCAAGTCCCTTATAGAAAATGG - Intergenic
1041206346 8:55501907-55501929 CTCAAGTCTCTTATATAAAATGG + Intronic
1041595555 8:59646630-59646652 CTCAAGTTCCTTATATAAAATGG + Intergenic
1041720378 8:60969937-60969959 CTCAAGCCCCTTATATAAAATGG - Intergenic
1041935160 8:63325061-63325083 TTTAAGTCCTGTAGGGAAAAAGG - Intergenic
1042138257 8:65652894-65652916 CTCAAGTGCCTTATATAAAATGG - Intronic
1042264574 8:66895063-66895085 CTCAAGTCCCTTATATAAAATGG + Intronic
1042401499 8:68353895-68353917 CTCAAGTTCCTTATATAAAATGG - Intronic
1042445307 8:68877601-68877623 CTCAAATCCCTTATATAAAATGG + Intergenic
1042462213 8:69082760-69082782 CTCAAGTCCGTTATATAAAAAGG + Intergenic
1042577516 8:70236823-70236845 CTCAAGTCCCTTATATGAAATGG - Intronic
1042783046 8:72513208-72513230 CTCAAGTCCATTATATAATATGG - Intergenic
1042831728 8:73036635-73036657 CTCAAGTCCCTTACATAAAATGG + Intronic
1042881756 8:73500207-73500229 CTCAAGTCCTTTATACAAAATGG + Intronic
1043111211 8:76184830-76184852 CTCAAGTCCCTTATTGAAAATGG + Intergenic
1043185445 8:77142503-77142525 CTCAAGTCCCTTACATAAAATGG + Intergenic
1043321304 8:78989917-78989939 ATCAAATTCTTTAGATAAAAAGG + Intergenic
1043460019 8:80450162-80450184 TTCAAGTCCCTTATATAAAATGG + Intergenic
1043681771 8:83036488-83036510 CTCAAGTCCCTGATGTAAAATGG - Intergenic
1043736184 8:83747416-83747438 CTCAAGTCCCTTATATAAAAAGG - Intergenic
1044000937 8:86880501-86880523 CTCAAGTCTTTCATATAAAATGG - Intronic
1044102415 8:88157373-88157395 CTCAAGTCCCTTATATAAGATGG - Intronic
1044285500 8:90407974-90407996 CTCAGGTCCTTTATATAAAATGG - Intergenic
1044305070 8:90630171-90630193 CTCAAGTCCCTTACATAAAATGG + Intronic
1044536997 8:93368769-93368791 CTCAAGTCCCTTATATATAATGG + Intergenic
1044584088 8:93852900-93852922 CTCAAGTCCCTTACATAAAATGG + Intergenic
1044652044 8:94506054-94506076 CTCAAGTCCATTATATAAAACGG - Intronic
1044788392 8:95820900-95820922 CTCAAGTCCCTTATGTAAAATGG + Intergenic
1044818346 8:96136144-96136166 CTCAAGCCCTTGATGTTAAATGG + Intergenic
1044855848 8:96475025-96475047 CTCAAGTTTATTAGTTAAAAAGG + Intergenic
1045306610 8:100962440-100962462 CTCAAGTCCCCTATGTAAAATGG + Intergenic
1045352207 8:101352236-101352258 CTCAAGTCCCTCATATAAAATGG - Intergenic
1045382525 8:101641587-101641609 ATCAAGTCCCTGAGGTATAAAGG - Intronic
1045384781 8:101661438-101661460 CTCAAGTCCCTCATGTAAAATGG + Intronic
1045767000 8:105684250-105684272 CTCAAGTCCTTTGTGAAAAAAGG - Intronic
1045805316 8:106153313-106153335 CTCAAGTCCCTTATATGAAATGG - Intergenic
1046056827 8:109088080-109088102 CCAAAGTCCATTAGGTAAATAGG - Exonic
1046192217 8:110811014-110811036 CTCAAGTCCCTTAGATAAAGTGG + Intergenic
1046486688 8:114896364-114896386 CTCTGGTCCTTTAAGTAAACTGG - Intergenic
1046591817 8:116216008-116216030 CTCAACTCTTTTATATAAAATGG + Intergenic
1046611575 8:116431533-116431555 CTCAAGTCCTTTGTATAAAATGG - Intergenic
1046625766 8:116575452-116575474 CTCAAGTCCCTTATATGAAATGG - Intergenic
1046642571 8:116748766-116748788 CTCAAGTCCTTTATATAAAATGG + Intronic
1047165229 8:122431332-122431354 CTTAAGTCCCTTATATAAAATGG - Intergenic
1047361195 8:124171109-124171131 CTCAGGTCCTTTATATAAAATGG - Intergenic
1047859348 8:128947474-128947496 CACCAATCCTTCAGGTAAAAGGG - Intergenic
1047889236 8:129289298-129289320 CTCAAGTTCCTTATATAAAATGG + Intergenic
1047973285 8:130105353-130105375 CTCAAGTGCCTTATATAAAATGG - Intronic
1048375005 8:133815547-133815569 CTCAAGTCCCTGATGTTAAATGG + Intergenic
1048406792 8:134131185-134131207 CTCAAGTCCCTGATATAAAAAGG - Intergenic
1048450674 8:134530914-134530936 CTCAAGTCCATTATATAAAATGG - Intronic
1048595000 8:135857369-135857391 CTCAAGTCTCTTATATAAAATGG - Intergenic
1049070469 8:140351675-140351697 CTCAAGTCCCTGATATAAAATGG - Intronic
1049111205 8:140644899-140644921 CTCAAGTCCCTGATGTAAAATGG + Intergenic
1049452765 8:142670909-142670931 CTCAAATCCCTTACATAAAATGG + Intronic
1049692410 8:143967610-143967632 CTCAAGTCCCTGATGTAAAAAGG + Intronic
1049871763 8:144984717-144984739 CACAAGTCCCTTATATAAAATGG - Intergenic
1049901549 9:171676-171698 TTCAAGTCCCTTACATAAAATGG - Intronic
1049960714 9:735604-735626 CTCAAGTCCCTTATGTAAAATGG + Intronic
1050071452 9:1818967-1818989 CTCAAGTCCCTGATATAAAATGG - Intergenic
1050341239 9:4641331-4641353 CTCAAGTCCCTGATATAAAATGG + Intronic
1050405705 9:5306609-5306631 TTCAAGTCCTTTAAATAAAAAGG + Intergenic
1050605979 9:7301514-7301536 CTCAAGTCCCTTATATAAAATGG - Intergenic
1050698083 9:8301722-8301744 CTCAAGTCCCTTATATAAAATGG + Intergenic
1051050106 9:12922530-12922552 CTCAACTCCCTTAATTAAAATGG + Intergenic
1051075013 9:13223116-13223138 CTCAAGTCCCTTATATAAAGTGG - Intronic
1051457514 9:17276699-17276721 CTCAAGCCCTTGATATAAAATGG + Intronic
1051675502 9:19554434-19554456 CTCAAGTCCCTGATATAAAATGG - Intronic
1051724590 9:20075897-20075919 CTCAAGTCCCTGATATAAAATGG + Intergenic
1052056800 9:23916066-23916088 CTCAAGTCCTAGATATAAAATGG - Intergenic
1052134736 9:24896160-24896182 CTTAAGTCCCTTATATAAAATGG - Intergenic
1052184669 9:25577662-25577684 CTCAAGTCCCTTATATAAAATGG + Intergenic
1052308621 9:27039764-27039786 TTCAAGTCTTTTACATAAAATGG - Intronic
1052662611 9:31454821-31454843 CTCAAGTCCCTGATATAAAATGG + Intergenic
1052680367 9:31684021-31684043 CTCAAGTCCCTTATGTACAATGG - Intergenic
1052688649 9:31785766-31785788 CTCAAGTCTCTTACATAAAATGG - Intergenic
1053233218 9:36429386-36429408 CTCAAGCCCTTTATATAAAATGG + Intronic
1053320055 9:37089555-37089577 CTCAAGTCCCTGATATAAAATGG + Intergenic
1053382948 9:37663745-37663767 CTCAAGTCCTTTATATAAAATGG + Intronic
1053561864 9:39204646-39204668 CCCAAGTCCCTTATATAAAATGG - Intronic
1053744581 9:41181970-41181992 TTCAAGTCCCTTACATAAAATGG - Intronic
1053827674 9:42042665-42042687 CCCAAGTCCCTTATATAAAATGG - Intronic
1054135254 9:61414306-61414328 CCCAAGTCCCTTATATAAAATGG + Intergenic
1054482690 9:65683240-65683262 TTCAAGTCCCTTACATAAAATGG + Intronic
1054602886 9:67144777-67144799 CCCAAGTCCCTTATATAAAATGG + Intergenic
1054683764 9:68249280-68249302 TTCAAGTCCCTTACATAAAATGG + Intronic
1054727477 9:68666805-68666827 CTCAAGTCCCTTATATAAAATGG - Intergenic
1055151147 9:73001854-73001876 TTCAGTTCATTTAGGTAAAAAGG + Intronic
1055324622 9:75116257-75116279 TTCAAGACCTTTATATAAAATGG - Intronic
1055474941 9:76653335-76653357 CTCAAGTCCCTAATATAAAATGG + Intronic
1055589663 9:77798617-77798639 CTCAAGTCCTCCATATAAAATGG + Intronic
1055799187 9:80014116-80014138 TTTAAGTCCCTTATGTAAAATGG + Intergenic
1055861226 9:80751713-80751735 CTCAAATCCCTTATATAAAATGG - Intergenic
1055941814 9:81657722-81657744 CTCAAGTCCTTTATATAAAATGG + Intronic
1056192816 9:84200917-84200939 CTCAAGACCCTTATATAAAATGG + Intergenic
1056410072 9:86317045-86317067 CTCAAGTTCCTTATATAAAATGG - Intronic
1056479548 9:86987252-86987274 CTCAAGTCCTTTATATTAAATGG + Intergenic
1056496788 9:87163714-87163736 TTCAAGTCCTTTATATAAAATGG + Intergenic
1056498351 9:87183386-87183408 CTCAATTCCTTTAAATAACATGG + Intergenic
1056533123 9:87504731-87504753 CTGAAGTCCCTTATATAAAATGG + Intronic
1056648952 9:88441260-88441282 CCCAAGTCCCTTATATAAAATGG - Intronic
1057116688 9:92530104-92530126 CTCAAGTTCCTTATATAAAATGG - Intronic
1057816872 9:98302461-98302483 TTCACGGCCATTAGGTAAAAGGG + Intronic
1058117396 9:101099719-101099741 CTCAAATCCCTTACATAAAATGG - Intronic
1058345808 9:103960128-103960150 CTCAAATCCTTTATACAAAATGG + Intergenic
1058368918 9:104241925-104241947 CTCAAATCCTTTACATAAAATGG + Intergenic
1058998574 9:110324583-110324605 CTCAATGTCTTTAAGTAAAAAGG - Intronic
1059069165 9:111117364-111117386 CTCAAGTCCTTGATATAAAATGG - Intergenic
1059080045 9:111239133-111239155 TTCAAGTCCTTTATATAAAATGG - Intergenic
1059330820 9:113534421-113534443 CTCAAGTCCTTGACACAAAATGG + Intronic
1059505462 9:114795611-114795633 CTGAAGTCCTTGATATAAAATGG - Intronic
1059592276 9:115674710-115674732 CTCAAGTCCCTTATATAAAATGG - Intergenic
1059631436 9:116127758-116127780 CTCAAGTTCCTTATATAAAATGG - Intergenic
1060069810 9:120536252-120536274 CTCAAGTCCTATGGGAAACATGG + Intronic
1060081298 9:120649013-120649035 CTCAAGTCCTTTCCATAAAATGG + Intronic
1060131905 9:121109088-121109110 CTCAAGTCCTTTATGTAAAATGG + Intronic
1060304212 9:122395765-122395787 CTCAAGTCCTTTATATGAAGTGG + Intergenic
1060411347 9:123402521-123402543 CTGAAGTCCTTTGGGTGGAAAGG - Intronic
1060546034 9:124459810-124459832 CTCAAGTTTTTTATATAAAATGG - Intronic
1060559196 9:124528919-124528941 TTCAAGTCCTTCATATAAAATGG - Intronic
1061098666 9:128475243-128475265 CTCAAGTCCCTGATATAAAATGG - Intronic
1061607447 9:131721892-131721914 CTCAAGTCCCTGATGCAAAATGG - Intronic
1186112250 X:6270739-6270761 CTCAAATCCCTTATGTAAAACGG - Intergenic
1186347343 X:8707726-8707748 CTCAAGTTATTGAAGTAAAATGG - Intronic
1186441207 X:9588237-9588259 CTCCAGTCCCTTAGATAAAAGGG - Intronic
1186505804 X:10091145-10091167 GTCAAGTCCCTTATATAAAATGG + Intronic
1186552764 X:10523968-10523990 CTCAAGTCCCTGATATAAAATGG - Intronic
1186555246 X:10551035-10551057 CTCAGGTCCCTTATATAAAATGG + Intronic
1186930109 X:14379949-14379971 CTCAAGTCCCTTATATAAAATGG + Intergenic
1186949962 X:14613615-14613637 CTCAAGTCCCTTATATGAAATGG - Intronic
1187084548 X:16028516-16028538 CTCAAGTCCCTTATATAAAATGG - Intergenic
1187328292 X:18312335-18312357 CTCAAGTCCCTGATATAAAATGG + Intronic
1187591835 X:20725337-20725359 CTCAAGTCCATAATCTAAAATGG - Intergenic
1187604353 X:20867711-20867733 TTTAAGTCCTTTACATAAAATGG - Intergenic
1187746885 X:22419042-22419064 CTCAAGTCGCTTATATAAAATGG - Intergenic
1187754122 X:22501363-22501385 CCCAAGTCCCTTATATAAAATGG + Intergenic
1188130592 X:26426694-26426716 CTCAAGTCTCTTATATAAAATGG - Intergenic
1188144088 X:26587866-26587888 CTCAGGTCCCTTATTTAAAAAGG + Intergenic
1188147472 X:26630936-26630958 CTCAAGTTCCTTATATAAAATGG - Intergenic
1188578083 X:31677796-31677818 CTCAGGTCCCTTCGATAAAATGG + Intronic
1188731547 X:33652088-33652110 CTCAAGTCTCTTATATAAAATGG + Intergenic
1188731899 X:33658407-33658429 CTCAAGTCTTTCATGTAAAATGG - Intergenic
1188787302 X:34363563-34363585 CTCAAGTCCCTTACATGAAATGG + Intergenic
1188849997 X:35120207-35120229 CTCAAGTCCCTTGTATAAAATGG + Intergenic
1189027449 X:37411267-37411289 CTCAAGTCCCTTATATAAAATGG - Intronic
1189080620 X:37968267-37968289 CATAAGACATTTAGGTAAAAGGG + Intronic
1189149058 X:38685818-38685840 CTCAAGTCCTTGATACAAAATGG - Intronic
1189221953 X:39380069-39380091 CTCAAGTCTCTTATATAAAATGG - Intergenic
1189264598 X:39704228-39704250 TTCAAGTCCCTTACATAAAATGG + Intergenic
1189362171 X:40361338-40361360 CTCAAGTCCCTTAAATAAAATGG - Intergenic
1189430425 X:40941765-40941787 CTCAAGTTCCTGAGATAAAATGG + Intergenic
1189450834 X:41128626-41128648 CTCAAGTCCCTGATATAAAATGG + Intronic
1189551365 X:42097015-42097037 CTCAAGTCTTCTACATAAAATGG - Intergenic
1189661110 X:43300734-43300756 CTCAAGTCTCTTATATAAAACGG + Intergenic
1190250414 X:48719749-48719771 CTCAAGTCCCTTATATAAAATGG - Intergenic
1190412931 X:50154854-50154876 CTCATGTCCCATAGGAAAAAAGG - Intergenic
1190478863 X:50854797-50854819 CTCAAGTCCCTTACATAAAATGG - Intergenic
1190811408 X:53887885-53887907 CTCAAGTCTGTTATATAAAATGG - Intergenic
1190872869 X:54439463-54439485 CTCAAGTCCCTGATATAAAATGG + Intergenic
1190878070 X:54474040-54474062 CTCAAGTCCCTTATATAAAATGG - Intronic
1190934351 X:54982644-54982666 CTCAAGTCCCTTTTATAAAATGG - Intronic
1190975275 X:55393794-55393816 CTCAAGACCCTTATGTAAAATGG - Intergenic
1191157405 X:57288679-57288701 CTGATGTCCTTTAAGAAAAATGG + Intronic
1191624932 X:63260669-63260691 CATAAGACATTTAGGTAAAAGGG + Intergenic
1191810926 X:65187310-65187332 CTCAGGTTCTATGGGTAAAAGGG + Intergenic
1192070503 X:67935271-67935293 CTCAAGTCCCTTATATAAAATGG + Intergenic
1192399642 X:70821984-70822006 CTCAAGTCCCTTATATAAAATGG + Intronic
1192426093 X:71077988-71078010 CTCAAGTCCATTATATAAAATGG - Intergenic
1193374081 X:80737232-80737254 CTCAAGTCCCTGATATAAAATGG + Intronic
1194124077 X:89992280-89992302 CTTAAGTCCTGTAGAGAAAAGGG + Intergenic
1194452283 X:94059222-94059244 CTCAAGTCCCTGATATAAAATGG + Intergenic
1194555768 X:95356899-95356921 CTCAAGTCCCTTATATACAATGG - Intergenic
1194659240 X:96610530-96610552 CTAAAGTCCGTTATATAAAATGG + Intergenic
1194676315 X:96797995-96798017 CTCAAGTCTCTTACATAAAATGG + Intronic
1194706028 X:97176873-97176895 CTCAAGTTCTTTATTTAAAATGG + Intronic
1194861314 X:99001873-99001895 CTCAAGTCCCTTATATAAAATGG + Intergenic
1195072960 X:101298720-101298742 CTCAAGTCCCTTATATAAAATGG - Intergenic
1195118660 X:101726773-101726795 CTCAAGTCCCTGAACTAAAATGG + Intergenic
1195141093 X:101960974-101960996 CTCACGTCCTTCAGGTTTAATGG + Intergenic
1195255958 X:103091518-103091540 CTCAAGTCCCTTACATAAAGTGG - Intronic
1195326611 X:103763689-103763711 CTCAAGTTGTTTGGATAAAAAGG + Intergenic
1195466599 X:105186108-105186130 CTCAAGACCTTGATATAAAATGG - Intronic
1195600131 X:106737402-106737424 CTCAAGTCCCTGATATAAAATGG + Intronic
1195971010 X:110473364-110473386 CTCAAGTCCCTTATATAATATGG + Intergenic
1195993865 X:110711795-110711817 ATCAAGTGTCTTAGGTAAAATGG + Intronic
1196100195 X:111839626-111839648 CTCAAGTTCCTTATATAAAATGG + Intronic
1196475313 X:116077866-116077888 CTTAAGTCCTTTATAAAAAACGG - Intergenic
1197012664 X:121586137-121586159 CTCAAGTTCTTTAGCTAAAATGG - Intergenic
1197182678 X:123553101-123553123 TTTAAGTACTTTAAGTAAAAAGG - Intergenic
1197229853 X:123992072-123992094 CTCAAGTCCCTTATATAAAATGG - Intronic
1197610445 X:128632473-128632495 CTCAAGTGCTTTAGATGGAAGGG - Intergenic
1197669585 X:129261445-129261467 CTCAAGTCCCTGATATAAAATGG + Intergenic
1197713795 X:129691245-129691267 CTCAAGTCCCTGATATAAAATGG - Intergenic
1198268036 X:135028888-135028910 CTCAACTCCCTTATATAAAATGG - Intergenic
1198319770 X:135508793-135508815 CTCAAGTCCCTTATATAAAATGG + Intergenic
1198441757 X:136670110-136670132 CTCAAGTCCTTAACATAAAATGG + Intronic
1198442104 X:136673208-136673230 CTCAAGTCCCTGATGTAAAATGG - Intronic
1198497584 X:137208254-137208276 CTCAAGTCCTTGATATAAAATGG + Intergenic
1198548739 X:137722329-137722351 TTCAAGTCCCTTATATAAAATGG + Intergenic
1198574371 X:137993921-137993943 CTCAAGTACCTTATATAAAATGG - Intergenic
1198690863 X:139282768-139282790 CTCCAGTTCTTTACCTAAAATGG + Intergenic
1199087618 X:143646603-143646625 CTCAATTCCCTTACATAAAATGG + Intergenic
1199126480 X:144128187-144128209 CTCAAGTCCCTTATATGAAATGG + Intergenic
1199286202 X:146057324-146057346 CTCAAGTCCCTGATATAAAATGG + Intergenic
1199357549 X:146879458-146879480 CTCAAGTCCCTGATATAAAATGG - Intergenic
1199487799 X:148367442-148367464 CTCAAGTCCCTTACTTAAAATGG - Intergenic
1199596255 X:149508458-149508480 CTCAAGTCCTTTATATAAGATGG + Intronic
1199726202 X:150584753-150584775 CCCAAGTCCTTGATATAAAATGG + Intronic
1199819351 X:151429422-151429444 CTCAAGTCCTTTCTATATAATGG - Intergenic
1199936317 X:152577054-152577076 TTCAAGTCCCGTATGTAAAATGG + Intergenic
1200242265 X:154503281-154503303 CTCAAGTCCCTGATATAAAATGG + Intergenic
1200245860 X:154524941-154524963 CTCAAGTCCCTGATATAAAATGG - Intergenic
1200476964 Y:3649902-3649924 CTTAAGTCCTGTAGAGAAAAGGG + Intergenic
1200492655 Y:3847014-3847036 CTCAAGTCCCTTATATAAAGTGG - Intergenic
1200543123 Y:4484683-4484705 CTCAAGATCTTTATCTAAAATGG + Intergenic
1200760831 Y:7037272-7037294 CTCAAGTCCCTGATATAAAATGG + Intronic
1202578870 Y:26357793-26357815 CTTAAGTCCTGTAGTTACAAGGG - Intergenic