ID: 1093588416

View in Genome Browser
Species Human (GRCh38)
Location 12:20870632-20870654
Sequence GTATACACACAGATTTCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 233}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093588414_1093588416 -1 Left 1093588414 12:20870610-20870632 CCTTGTCAAAGATCAGATGACTG 0: 1
1: 29
2: 120
3: 288
4: 816
Right 1093588416 12:20870632-20870654 GTATACACACAGATTTCTCTGGG 0: 1
1: 0
2: 2
3: 27
4: 233
1093588413_1093588416 0 Left 1093588413 12:20870609-20870631 CCCTTGTCAAAGATCAGATGACT 0: 1
1: 132
2: 386
3: 956
4: 2070
Right 1093588416 12:20870632-20870654 GTATACACACAGATTTCTCTGGG 0: 1
1: 0
2: 2
3: 27
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093588416 Original CRISPR GTATACACACAGATTTCTCT GGG Intronic
902108295 1:14056441-14056463 GCATACAAACAGATTTCCCCTGG + Intergenic
905966487 1:42102615-42102637 ATATATGCACACATTTCTCTTGG - Intergenic
906294634 1:44641964-44641986 GTATCCTGAGAGATTTCTCTAGG + Intronic
906844084 1:49171836-49171858 GTATATCAACAAATTTCTCTTGG - Intronic
907164868 1:52401472-52401494 GTTTTCACACACATTTCTCTAGG + Exonic
909058335 1:70848877-70848899 GTATACACAATGATTTATTTGGG - Intergenic
910834788 1:91497800-91497822 ACATACACACAGTTTTCTTTAGG - Intergenic
910857619 1:91711272-91711294 GTATGCAAACAAAATTCTCTTGG + Intronic
912252300 1:108024217-108024239 GGAAACATACAGACTTCTCTGGG + Intergenic
914314616 1:146498479-146498501 TTATACACAGATTTTTCTCTTGG - Intergenic
914499732 1:148234909-148234931 TTATACACAGATTTTTCTCTTGG + Intergenic
916964636 1:169924312-169924334 TAATACACACAGATGTCTCTGGG - Intronic
917577316 1:176337442-176337464 GTGTACACAAAGATCTCACTGGG + Intergenic
917672553 1:177286760-177286782 TTAGACACACAGATTTCTTCTGG + Intergenic
919389972 1:196971368-196971390 GCATATCCACAAATTTCTCTTGG + Intergenic
919707868 1:200696008-200696030 TTATAGACACAGAACTCTCTGGG + Intergenic
920138806 1:203792588-203792610 ATATACACACAGAATTCTCAGGG - Intergenic
920922162 1:210307104-210307126 GTCAACGCACAGATTCCTCTAGG + Intergenic
922126900 1:222736605-222736627 GTATTCACCGACATTTCTCTAGG - Intergenic
924405741 1:243744012-243744034 GCATACATACACATTTCTGTTGG - Intronic
924680270 1:246224043-246224065 TTCTACACACAGGTTTCTTTGGG + Intronic
1063525817 10:6783999-6784021 GTATATACACACAATTCTCTTGG - Intergenic
1065063959 10:21939976-21939998 GTATACACACACGTTTGTTTTGG - Intronic
1065195246 10:23257929-23257951 GTATACACACATATGTGTATGGG + Intergenic
1066601343 10:37110718-37110740 GAATGTACCCAGATTTCTCTGGG + Intergenic
1067155242 10:43776085-43776107 ATAATCACACAGATTTCTCTAGG + Intergenic
1067382948 10:45792057-45792079 GATCACACACAGGTTTCTCTTGG - Intronic
1067890647 10:50132602-50132624 GATCACACACAGGTTTCTCTTGG - Intronic
1068600757 10:58954122-58954144 GCATAGAAACAGTTTTCTCTGGG - Intergenic
1069180729 10:65355137-65355159 GTATATACACAGAGTTGACTTGG - Intergenic
1069679084 10:70270896-70270918 CTATACACCCTGATCTCTCTTGG - Intronic
1070504116 10:77098065-77098087 GTGTAGACACAGATCCCTCTAGG - Intronic
1071356663 10:84803409-84803431 ATAGACACACAGATTTGCCTAGG - Intergenic
1075217539 10:120550831-120550853 GGATAGACAAAGATTTCTTTAGG + Intronic
1076054301 10:127358761-127358783 GTGTATACAGAGATTTTTCTGGG + Intronic
1079569571 11:21925758-21925780 GTGCACACACACACTTCTCTGGG - Intergenic
1080499481 11:32855262-32855284 ATATGCACACAAATTTATCTGGG + Exonic
1081319860 11:41678971-41678993 GCAGACACACAGTTATCTCTTGG - Intergenic
1085546539 11:77323595-77323617 CTATACAAACTAATTTCTCTTGG - Intronic
1085668165 11:78435112-78435134 GTATACATACAAATTTCATTAGG + Intergenic
1085982371 11:81740020-81740042 ACATACACACAGATGTCTCTGGG + Intergenic
1086137723 11:83459068-83459090 GTATAGAAACAAATTTCTATAGG - Exonic
1087358501 11:97125719-97125741 GTATACACACATATATTTCTGGG - Intergenic
1091612146 12:2020087-2020109 GTGCACACACACACTTCTCTTGG + Intronic
1093588416 12:20870632-20870654 GTATACACACAGATTTCTCTGGG + Intronic
1093833547 12:23797315-23797337 GGATATACACAGATGTATCTTGG + Intronic
1093869511 12:24270999-24271021 ATATATACACATATTTCTCTAGG + Intergenic
1095319716 12:40812309-40812331 GTGTACACACAGCATTCTCTAGG - Intronic
1099022039 12:77418122-77418144 ACATACACACAGATGTCCCTTGG - Intergenic
1099311467 12:81031191-81031213 GTATTCTCACATATTTCTGTTGG + Intronic
1100585339 12:95974655-95974677 CTATCCACACTGAATTCTCTGGG - Intronic
1101526561 12:105536639-105536661 TCATACACACTGATTTCTCCTGG + Intergenic
1105982277 13:25530254-25530276 GTATACAGGGAGATTTCTTTTGG + Intronic
1106462923 13:29989056-29989078 GTGGACACAGAGATTTTTCTTGG + Intergenic
1107777639 13:43863459-43863481 GCATACACATTTATTTCTCTTGG + Intronic
1108323798 13:49310391-49310413 GTAGACACACAGATCGCTCAGGG - Exonic
1109255190 13:60071769-60071791 GGAATCACACATATTTCTCTGGG - Intronic
1110173439 13:72529899-72529921 ATTTAAACACTGATTTCTCTAGG + Intergenic
1110671385 13:78183572-78183594 GTTTACAGACAGAATTCACTGGG + Intergenic
1111442965 13:88304600-88304622 GCCCACACACAGATTCCTCTTGG + Intergenic
1111857421 13:93655626-93655648 GTATACACATAGATTTTTCAGGG - Intronic
1111872273 13:93847859-93847881 GAATACACACAACTTTCTCCTGG + Intronic
1112153543 13:96792059-96792081 ACATACACACATATTACTCTAGG + Intronic
1112327669 13:98453677-98453699 GTCTGCACAAAGATGTCTCTCGG + Intronic
1113048415 13:106181983-106182005 GTATACACAAATATTTCTTTTGG - Intergenic
1113159076 13:107358817-107358839 ATTTACACACAGGTTTCTTTGGG + Intronic
1115435224 14:33364618-33364640 GTACACACTCAGATTTCTAGGGG + Intronic
1117418314 14:55518803-55518825 GTATGTACAGAGATTTATCTGGG - Intergenic
1117697498 14:58380743-58380765 GAATACACTCAGATTTTTCTGGG + Intergenic
1118362827 14:65070411-65070433 GTATACCCACAGCCTGCTCTGGG - Intronic
1124591754 15:31060153-31060175 ACACACACACAGAGTTCTCTAGG + Intronic
1125054999 15:35348453-35348475 ATATACATAAAGATTTCTCTGGG + Intronic
1125973436 15:43930681-43930703 GAAGCCACACAGATATCTCTAGG + Intronic
1126374112 15:47977297-47977319 ATATGCACACAGATCTCTCAGGG - Intergenic
1128919478 15:71597386-71597408 ATATACACACATATATCTGTGGG - Intronic
1129792619 15:78351514-78351536 GTATACACACAAATGTCTTAGGG - Intergenic
1130215230 15:81961944-81961966 GTAAGCAAAGAGATTTCTCTAGG - Intergenic
1130362431 15:83202989-83203011 ATATAAACACTCATTTCTCTTGG + Intronic
1130948234 15:88565561-88565583 ACACACACACAGCTTTCTCTTGG + Intergenic
1131033336 15:89204811-89204833 GTATACACCTTGATTTCTCAAGG - Intergenic
1131162119 15:90113104-90113126 GTATACAGACAGATATTTGTTGG + Intergenic
1133645159 16:7757156-7757178 GTATATACACAGAATAATCTAGG + Intergenic
1135392710 16:22107088-22107110 ATCTTCAAACAGATTTCTCTTGG - Intronic
1135741718 16:24980901-24980923 GTATACACAGAGAAGTCTCAAGG + Intronic
1139221921 16:65191905-65191927 GTATACACACATATATTTCCTGG - Intergenic
1145245997 17:21269860-21269882 GTAAACACAGTTATTTCTCTTGG + Intergenic
1147536727 17:41326618-41326640 GTGTCCCCACAGATCTCTCTCGG + Intergenic
1148523635 17:48307609-48307631 GTATGCAAACAGATGTCTGTGGG + Intronic
1149185676 17:53994538-53994560 GTATACACACAAATATCTTCTGG + Intergenic
1149283474 17:55133676-55133698 GCAAAGACACAGCTTTCTCTAGG - Intronic
1150044213 17:61895667-61895689 ACACACACACATATTTCTCTTGG - Intronic
1156957585 18:42987188-42987210 GTATACACACACATGTATCATGG + Intronic
1158908391 18:62036133-62036155 ATGTACACACAGAAGTCTCTGGG - Intergenic
1159429324 18:68331010-68331032 GAATACACACAGATGTCTTCTGG + Intergenic
1165932971 19:39372211-39372233 GTATACAGACAGATCTGGCTGGG + Intronic
1165948024 19:39456874-39456896 ATATGTACACAGATATCTCTAGG + Intronic
1166499439 19:43329905-43329927 GTCTCCACACAGTTTTCACTGGG - Intergenic
1167394466 19:49218964-49218986 GTATACAAAAAGAAATCTCTAGG + Intergenic
928199819 2:29240603-29240625 GTTTGCACACATATTTCTCCAGG - Intronic
928249523 2:29662799-29662821 GCAGGCACACAAATTTCTCTTGG - Intronic
928435550 2:31252318-31252340 CTATTCACACAGATTACTCTGGG - Intronic
929326805 2:40623335-40623357 GTATACACATAGATGAATCTTGG + Intergenic
930798223 2:55415322-55415344 GTATACAAACATATTTCTACTGG + Intronic
931286389 2:60835466-60835488 ATATAAAAACAGATTTTTCTGGG + Intergenic
931926450 2:67078172-67078194 AGATGCACAGAGATTTCTCTTGG + Intergenic
933624354 2:84582015-84582037 GTATATATCCAGGTTTCTCTGGG - Intronic
933885688 2:86718312-86718334 GAATAAACATAGATTTGTCTAGG + Intronic
933924490 2:87078394-87078416 GAATAAACATAGATTTGTCTAGG - Intergenic
935735508 2:106103754-106103776 GTTTACTCACAGCTTTCTTTTGG + Intronic
938758041 2:134398493-134398515 GCAGACACACATATTTCTCCTGG - Intronic
938937195 2:136137581-136137603 GCATAAAAACAGCTTTCTCTGGG - Intergenic
939304813 2:140397614-140397636 TTATACACAAATATTTTTCTAGG + Intronic
939562428 2:143748604-143748626 CTCTACACACAGATATCACTTGG + Intronic
940548654 2:155122991-155123013 GTATACACACATATATTTATAGG + Intergenic
941409910 2:165142001-165142023 GAATACACACAGAATTATTTGGG - Intronic
941529205 2:166644465-166644487 ATATACACTCAAATTTCTCAAGG - Intergenic
942134735 2:172913384-172913406 TTATGCTCACAGATTTCTGTGGG + Intronic
942815745 2:180051654-180051676 AAATACACACACATTTCTATGGG - Intergenic
943296948 2:186153003-186153025 GTATACACATAGATTGTTTTGGG - Intergenic
945569178 2:211442607-211442629 GTATACACACATATATATTTTGG - Intronic
946136958 2:217655469-217655491 ATATATCCAGAGATTTCTCTAGG - Intronic
946712799 2:222523424-222523446 GCATATTCACAGACTTCTCTGGG - Intronic
948579913 2:238979694-238979716 GTTTACTCACAGATTTTTGTGGG + Intergenic
1169880215 20:10339522-10339544 TGATACACACAAATTTCCCTGGG - Intergenic
1170288019 20:14733603-14733625 ATCTACACACAGATAACTCTGGG + Intronic
1172092236 20:32441484-32441506 GTATAAACACAGATTTTATTAGG - Intergenic
1172399987 20:34641637-34641659 GTCTACACACAGATGCATCTGGG - Intronic
1172890247 20:38259240-38259262 GTGTACACACACATGGCTCTTGG - Intronic
1173045587 20:39506528-39506550 GTCTAGACATAGATTTCTTTAGG - Intergenic
1176993496 21:15526056-15526078 GTACACACACATAGTTTTCTTGG + Intergenic
1177199725 21:17940719-17940741 AGATACACCCTGATTTCTCTTGG - Intronic
1177786025 21:25672310-25672332 ATACACACCCAGATTTCTCAGGG - Intronic
1177998289 21:28130197-28130219 GCATACACAGAGCTATCTCTGGG + Intergenic
1179067386 21:38038589-38038611 GTATATCCACAGTTTTTTCTTGG - Intronic
1181656803 22:24308047-24308069 GTATACACACATAGTTTTTTTGG + Intronic
949788290 3:7765624-7765646 CTATACACACAAATGTCTCAGGG - Intergenic
951409915 3:22350491-22350513 TTATACACACAGATTTATCATGG - Intronic
951426414 3:22551190-22551212 ATACACACACATATTTCTGTTGG - Intergenic
951658364 3:25034478-25034500 GTATAGACAGTGATTTCTCTAGG + Intergenic
952785330 3:37149228-37149250 TAATACACACAGATTGCTGTGGG - Intronic
954114012 3:48454239-48454261 ATATACACAAAAATATCTCTGGG - Intronic
956603908 3:71052369-71052391 GTTTTCACTCAGATTTTTCTGGG - Intronic
957124480 3:76140971-76140993 GTAAACACTCAGATTTAACTTGG + Intronic
957448953 3:80351144-80351166 GTATATACAGACAGTTCTCTAGG - Intergenic
958821654 3:98981021-98981043 ATATACACACAGCTCTTTCTGGG - Intergenic
960568682 3:119163915-119163937 CTATACACACACATATATCTAGG - Intronic
960831591 3:121855365-121855387 GTATAGACAAAAATTGCTCTAGG + Intronic
962341994 3:134593623-134593645 CTATACACATTGATTTCACTTGG - Intergenic
962626936 3:137235156-137235178 ATATACACTTACATTTCTCTTGG + Intergenic
964070050 3:152620448-152620470 GTATTTACTCAGATTTTTCTTGG - Intergenic
964111611 3:153093576-153093598 GAATAGACACAGAATTGTCTAGG + Intergenic
964359988 3:155885546-155885568 GTATAAACACAGTTTTCTAAAGG + Intronic
964487811 3:157203936-157203958 ATATACACACTCATTTTTCTAGG + Intergenic
966950756 3:184815022-184815044 GCAAACACACACATTACTCTAGG + Intronic
968379860 4:83081-83103 GTATATACACACATTTTTCAGGG + Intronic
971044941 4:22795187-22795209 CAATACACTTAGATTTCTCTGGG + Intergenic
974426996 4:61754589-61754611 ATATACACTCAGATCTTTCTAGG - Intronic
975046081 4:69806395-69806417 ATATACTCACAGATTTCTCTTGG - Intergenic
975197554 4:71543197-71543219 GCATACACACTGATTTCTCTGGG - Intronic
976328214 4:83796997-83797019 ATATACACACACATTTCTGGTGG + Intergenic
976909179 4:90279290-90279312 GTATGCACATAGTTTTATCTGGG + Intronic
980013836 4:127625241-127625263 GTATATATACAGATTTGTTTAGG + Intronic
983389866 4:167116170-167116192 GTACACATACAGATACCTCTTGG - Intronic
983809280 4:172038238-172038260 ATATACACACATATTTTTCCTGG + Intronic
984190994 4:176605531-176605553 TTATACCAACAGATTTTTCTAGG - Intergenic
987046237 5:14111820-14111842 GTTGTGACACAGATTTCTCTAGG + Intergenic
988412156 5:30900198-30900220 TCATACACACAGATTTTTCTTGG - Intergenic
989359029 5:40578470-40578492 GCATACATACAGGGTTCTCTAGG + Intergenic
990521684 5:56587373-56587395 TTATACACATATATTTCTCTAGG - Intronic
990998046 5:61753116-61753138 GTATAAACAGAGATTGTTCTGGG - Intergenic
992189066 5:74272850-74272872 GAACGCCCACAGATTTCTCTGGG - Intergenic
992523964 5:77587331-77587353 GTATAAACACACATTTCTGCTGG + Intronic
992695811 5:79285791-79285813 GTACATTCACAGATTTATCTTGG + Intronic
993160560 5:84285284-84285306 GCATACACACCTATTTCTGTTGG - Intronic
994101878 5:95902717-95902739 GTATACACCCAGATTTCTTGAGG + Intronic
994632682 5:102305390-102305412 CTATACTCACTGATTTCTTTAGG - Intergenic
995166054 5:109042940-109042962 GTATAATCAAAGTTTTCTCTAGG + Intronic
996463272 5:123771306-123771328 GGATAGTCACATATTTCTCTAGG + Intergenic
996497166 5:124172067-124172089 GTATAAACACATATTTCTGGGGG - Intergenic
997223600 5:132191755-132191777 ATATAAACACATATTTCTGTAGG - Intergenic
997523829 5:134539983-134540005 GTATAGACAGTGTTTTCTCTGGG + Intronic
997686356 5:135790345-135790367 GTACACCCACATATTTCCCTAGG - Intergenic
998026603 5:138821559-138821581 TTATAGCCATAGATTTCTCTTGG - Intronic
998254356 5:140573475-140573497 TTATAAACACAGAATTCTGTGGG - Intronic
999979489 5:156944317-156944339 GTGTGCACACACATTTTTCTGGG - Intronic
1000012011 5:157241898-157241920 ATATACAAGCACATTTCTCTAGG + Intronic
1000817859 5:165946137-165946159 GTATACACACACAATGCTTTGGG + Intergenic
1000831333 5:166104663-166104685 ATATACACACAAATTTATGTGGG - Intergenic
1004175508 6:13336479-13336501 GTATACACAGTGAGTTATCTTGG - Intergenic
1005382699 6:25253151-25253173 GCATACACCCAGATTACACTGGG - Intergenic
1005418327 6:25624705-25624727 GTGTACACACAGCTTACACTGGG + Intergenic
1005737331 6:28760332-28760354 GTAGACATCCAGGTTTCTCTGGG - Intergenic
1006099379 6:31676688-31676710 GTTTACACACAAATTTATTTGGG + Intronic
1007050613 6:38825041-38825063 GTATACAGACAGAGTGCGCTGGG + Intronic
1007308756 6:40928090-40928112 TTATACAGACAGATGTGTCTGGG - Intergenic
1007334657 6:41145944-41145966 GTGTACATGCAGAATTCTCTAGG - Intergenic
1009534726 6:64865727-64865749 GTAGAAACACAGATATCTGTTGG + Intronic
1011793003 6:90918174-90918196 GTATTCACATAGTATTCTCTAGG + Intergenic
1012300722 6:97584650-97584672 TAATTCACACAGAATTCTCTGGG - Intergenic
1012787106 6:103644897-103644919 GGATTTAAACAGATTTCTCTAGG + Intergenic
1014670261 6:124295034-124295056 GTGTACACAAAGATTTCCCTTGG + Intronic
1014732571 6:125050801-125050823 CAACACACACTGATTTCTCTTGG + Intronic
1015563474 6:134541242-134541264 GTAGACACACAGATATATGTAGG - Intergenic
1017332295 6:153213960-153213982 GGACACACACAGACATCTCTTGG - Intergenic
1019756293 7:2772795-2772817 ATATATGCACTGATTTCTCTTGG - Intronic
1022163309 7:27733246-27733268 CTCTAGAAACAGATTTCTCTGGG - Intergenic
1027454287 7:78368557-78368579 TTATATACACATATTTTTCTTGG - Intronic
1027754325 7:82192546-82192568 TTATACACAGATATTTCTCAAGG - Intronic
1028125860 7:87112758-87112780 ATATACAGAAAGATTTCTTTAGG + Intergenic
1029641205 7:101821030-101821052 GCACACACACACACTTCTCTCGG - Intronic
1030000060 7:105050139-105050161 GAATACAAACAGCTTTCTCAAGG - Intronic
1030038189 7:105426000-105426022 GTAGACAAACAGCTTTCTTTTGG - Intergenic
1030385851 7:108867263-108867285 GAAAACAGACAGATGTCTCTGGG - Intergenic
1030492097 7:110250200-110250222 GTAGACACACAGGTCTCTTTTGG - Intergenic
1030794553 7:113771327-113771349 ATATTCACACAGATTTCTGTGGG + Intergenic
1031218993 7:118939478-118939500 GTATACAGACAGATGTGTGTAGG + Intergenic
1033967303 7:146992051-146992073 ATATACACACACATCTCCCTTGG + Intronic
1034209485 7:149350514-149350536 ATATACACAAAGATTTATTTTGG - Intergenic
1034841821 7:154405018-154405040 GTACACACACATATTTATGTAGG - Intronic
1034979011 7:155463951-155463973 GTAAACACACATATTTATCTTGG - Exonic
1037140459 8:15512880-15512902 ATATATACACACAATTCTCTCGG + Intronic
1038330724 8:26607036-26607058 GTTTACATATAGATTACTCTAGG - Intronic
1038763173 8:30403629-30403651 GTGTATACACAGATTTAGCTAGG - Intronic
1039215937 8:35271443-35271465 GTATACACACATATGTGTGTAGG + Intronic
1039533909 8:38290234-38290256 CTATAAACACAGATTATTCTAGG - Intronic
1041065890 8:54082700-54082722 TTTTTCACACAGATTTCTCATGG + Intronic
1041692357 8:60701194-60701216 TTTTACACACAGCTCTCTCTTGG - Intronic
1041906369 8:63037972-63037994 GTCCACACACAAATTTCTTTGGG + Intronic
1044914051 8:97093300-97093322 GTATACACACAGCATTTGCTGGG - Intronic
1045886261 8:107101032-107101054 GAATACATACAAACTTCTCTGGG - Intergenic
1046862237 8:119106509-119106531 GGATAGACACAGAGTGCTCTAGG - Exonic
1047025492 8:120819134-120819156 GTAAACACATAGCTTTCTTTTGG - Intergenic
1048110355 8:131461382-131461404 CTATAGACACAGATTCCTGTGGG + Intergenic
1048908082 8:139107629-139107651 CTATACACACAGCTTTCTCATGG - Intergenic
1050632031 9:7569918-7569940 GTATGCCCACAGCTTTATCTTGG + Intergenic
1052682535 9:31712056-31712078 GTATACACACATATTTATGTAGG - Intergenic
1053549732 9:39063699-39063721 GTATATACTCATATTTCTTTAGG + Intergenic
1053813845 9:41883792-41883814 GTATATACTCATATTTCTTTAGG + Intergenic
1054616751 9:67303648-67303670 GTATATACTCATATTTCTTTAGG - Intergenic
1056808602 9:89746856-89746878 GTACATACAGAGATTTCTCATGG + Intergenic
1057727486 9:97578502-97578524 AGATACACACAGATGTGTCTGGG - Intronic
1059969994 9:119657356-119657378 GTCTAAACACTGATTTTTCTTGG + Intergenic
1186899630 X:14039951-14039973 GTATACTGTCAGATTTTTCTTGG + Intergenic
1187050101 X:15687394-15687416 GTATAGACACTGAGCTCTCTTGG - Intergenic
1187723230 X:22173596-22173618 GTATAGACACACATTACTTTTGG + Intronic
1188642016 X:32517818-32517840 GAATCCAGAAAGATTTCTCTAGG + Intronic
1188967342 X:36570759-36570781 GTATTAACACAGATGTCTCTAGG + Intergenic
1189015755 X:37094868-37094890 GTGTATACACAGATTTAGCTAGG - Intergenic
1190388696 X:49910678-49910700 GTACACACACAGATTTAGGTAGG - Intergenic
1194310028 X:92294828-92294850 GTACACACATATGTTTCTCTAGG - Intronic
1194383633 X:93225178-93225200 ATATATACACAGATTGCTGTTGG - Intergenic
1195345095 X:103941622-103941644 ACATAAACACAGATATCTCTAGG + Intronic
1195362591 X:104098477-104098499 GTATAAACACAGGTATCTCTAGG - Intergenic
1196318058 X:114253160-114253182 CTATACACACGGATTCCTCAGGG - Intergenic
1196701766 X:118677655-118677677 GTATACTTACATATATCTCTTGG + Intronic
1198524441 X:137486453-137486475 GTAGATACACAGATTTATTTCGG - Intergenic
1198563440 X:137878395-137878417 ACACACACACAGTTTTCTCTTGG + Intergenic
1198791393 X:140350795-140350817 ATATACACACAGGTATCTATAGG + Intergenic
1200160596 X:154006280-154006302 ACATACACACTCATTTCTCTTGG - Intergenic
1200618318 Y:5409126-5409148 GTACACACATATGTTTCTCTAGG - Intronic
1200816092 Y:7534194-7534216 GGATACATACAGTTGTCTCTAGG - Intergenic
1201345648 Y:12981406-12981428 GCATACATTCAGAATTCTCTTGG - Intergenic
1201747832 Y:17398749-17398771 GTATACACACAGACTTCACAGGG - Intergenic