ID: 1093590278

View in Genome Browser
Species Human (GRCh38)
Location 12:20894681-20894703
Sequence CTCAAAGGAGATTTTGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 438
Summary {0: 1, 1: 1, 2: 1, 3: 46, 4: 389}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093590278 Original CRISPR CTCAAAGGAGATTTTGGGAA GGG (reversed) Intronic