ID: 1093590594

View in Genome Browser
Species Human (GRCh38)
Location 12:20897180-20897202
Sequence CTGCTGTCCTTTGTCAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 151}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093590593_1093590594 -1 Left 1093590593 12:20897158-20897180 CCTCAGCTGTGCTAACAAAGTGC 0: 1
1: 0
2: 1
3: 12
4: 145
Right 1093590594 12:20897180-20897202 CTGCTGTCCTTTGTCAAAGCAGG 0: 1
1: 0
2: 2
3: 21
4: 151
1093590592_1093590594 0 Left 1093590592 12:20897157-20897179 CCCTCAGCTGTGCTAACAAAGTG 0: 1
1: 0
2: 1
3: 4
4: 164
Right 1093590594 12:20897180-20897202 CTGCTGTCCTTTGTCAAAGCAGG 0: 1
1: 0
2: 2
3: 21
4: 151
1093590591_1093590594 18 Left 1093590591 12:20897139-20897161 CCTCAGTGTAGTTTTGTGCCCTC 0: 1
1: 0
2: 2
3: 16
4: 188
Right 1093590594 12:20897180-20897202 CTGCTGTCCTTTGTCAAAGCAGG 0: 1
1: 0
2: 2
3: 21
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093590594 Original CRISPR CTGCTGTCCTTTGTCAAAGC AGG Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
900673161 1:3868408-3868430 CTGCTGACCTTGGTCACAGTTGG - Intronic
901207697 1:7506225-7506247 CTGCTCTCCTTTGCCACACCTGG - Intronic
904206006 1:28855625-28855647 CTGCTGTAGTTGGTCCAAGCGGG - Intronic
906807877 1:48796936-48796958 CTGCTTTCCTGTGTCAGAGTAGG - Intronic
907459499 1:54597038-54597060 CTGCTGTCTTGTCTCAGAGCTGG + Intronic
908657590 1:66404469-66404491 CTGTTTTGCTTTGACAAAGCTGG + Intergenic
911905799 1:103567396-103567418 CTGATACCCTTCGTCAAAGCTGG + Intronic
913127208 1:115803602-115803624 CTGCCCTCCGTTGTCAAAGATGG + Intergenic
915626361 1:157116299-157116321 CTCCTGTCCTCTGTCACTGCTGG + Intergenic
918415226 1:184299141-184299163 CTACTGTCCTCTGTCTTAGCCGG - Intergenic
918420840 1:184362980-184363002 CTGATGTCATTTGTCAAATGTGG - Intergenic
920737070 1:208542543-208542565 CTGCTGTCCATATCCAAAGCAGG - Intergenic
923255736 1:232219906-232219928 CTCATGGTCTTTGTCAAAGCGGG + Intergenic
1063246236 10:4221995-4222017 CAGCTTTTTTTTGTCAAAGCTGG + Intergenic
1065750647 10:28883536-28883558 GTCCTTTCCTTTGTCAAAGGAGG + Intergenic
1067053266 10:43037325-43037347 CTGCTGTCCATTCTCACAGAGGG + Intergenic
1070240520 10:74675632-74675654 CTGCTGTGCTTTGTCACAGCAGG + Intronic
1070548109 10:77468722-77468744 CTGTAGTACTTTGTCACAGCAGG + Intronic
1071759003 10:88579339-88579361 CTGCCTTCCTTTGTAAAAACTGG - Intronic
1072210361 10:93240569-93240591 CTGCTGTCCTTTGATCAAGTGGG + Intergenic
1072537160 10:96372398-96372420 ATTGTGTCCTTTGTCAGAGCTGG - Intronic
1073608627 10:104921232-104921254 CTGCTGTGCTTTGTAAAAACAGG + Intronic
1075744330 10:124716093-124716115 CTGCTGTCCTTAGACAGAGAGGG + Intronic
1077964628 11:7115702-7115724 CTGCTGACATTTGTCAATGTGGG + Intergenic
1079639034 11:22781147-22781169 CTGCTGTCCTTTGGCAAACAAGG + Intronic
1087117413 11:94540618-94540640 CTGCTGTCATTGGCCAAACCTGG - Intergenic
1089711034 11:120314928-120314950 CTGCTGTCCTCAGCAAAAGCAGG + Intronic
1090310068 11:125728664-125728686 CTGCTTTCCTTTTTAAAAGGGGG + Intergenic
1091353295 11:134914754-134914776 CTGTTGTCCTTTATCTAAGCAGG + Intergenic
1091364621 11:135007332-135007354 GTGGTGTCCTTAGTGAAAGCAGG - Intergenic
1091636844 12:2203573-2203595 CTGCAGTCCTATGGCCAAGCCGG + Intronic
1092731663 12:11540452-11540474 CAGCTGTTCTTTGTCTAGGCTGG + Intergenic
1093590594 12:20897180-20897202 CTGCTGTCCTTTGTCAAAGCAGG + Intronic
1095728377 12:45476819-45476841 CTGCTGTCCCCAGTCAAAGGAGG - Intergenic
1095987646 12:48010335-48010357 CTGCGGTCTTTTTTTAAAGCAGG + Intergenic
1098226067 12:68326171-68326193 CTGCTCTCTTATGTCACAGCTGG - Intronic
1099172501 12:79381479-79381501 CTGCTCTCCTGTGTCTAAGATGG - Intronic
1103611996 12:122129658-122129680 CTGCTGTCTCATGTCAAAGTGGG - Intronic
1106636331 13:31532538-31532560 CTCCTGTCTTTTTTCAAATCTGG + Intergenic
1107401071 13:40069761-40069783 CTGCTGTCCTTGATAATAGCAGG - Intergenic
1108856760 13:54802342-54802364 TTGCTCTCCTTTTTCAAAGAGGG - Intergenic
1111945580 13:94661627-94661649 CTGCTCTCCTTTTTCCAAACAGG - Intergenic
1115172094 14:30520156-30520178 CTTCTCTCCTTTGTAAAGGCAGG - Intergenic
1118907590 14:70033796-70033818 CTACTGTCCTTGGTGAATGCAGG - Intergenic
1119602705 14:75987560-75987582 CTGCTGTCATTTTACAAAGGAGG - Intronic
1121334477 14:93069092-93069114 CTGCTGCCCTCTGTCACTGCAGG + Intronic
1123960878 15:25398587-25398609 ATGCTGTCATTTGTGACAGCAGG - Intronic
1125878297 15:43168778-43168800 CTGCAGTCCTTGGGCAAATCTGG - Intronic
1126245167 15:46496610-46496632 CTGCTGCCCTCTGTCAATTCTGG - Intergenic
1127805121 15:62512089-62512111 CTGCTGTCCTGGGTCACAGCTGG + Intronic
1128569955 15:68726683-68726705 GTTCTGTCATTTGTCAAAGGGGG - Exonic
1129664336 15:77571260-77571282 ATGCTGTCCTTTGTCCAGGTGGG - Intergenic
1133381668 16:5336202-5336224 CTGCTGCTCTCTGTCAAAGGGGG + Intergenic
1134523086 16:14927527-14927549 CTGCTGTCCTGTGTGAACGCAGG + Intronic
1134549544 16:15132531-15132553 CTGCTGTCCTGTGTGAACGCAGG - Intronic
1134710753 16:16326178-16326200 CTGCTGTCCTGTGTGAACGCAGG + Intergenic
1134718924 16:16370466-16370488 CTGCTGTCCTGTGTGAACGCAGG + Intergenic
1134811468 16:17170570-17170592 CTGCTTGCCTTTGCAAAAGCTGG + Intronic
1134948848 16:18342467-18342489 CTGCTGTCCTGTGTGAACGCAGG - Intergenic
1134955832 16:18381693-18381715 CTGCTGTCCTGTGTGAACGCAGG - Intergenic
1136427012 16:30175478-30175500 ATGTTGACCATTGTCAAAGCTGG + Intergenic
1137370898 16:47904853-47904875 GTGCTGTCCTTCCTCAAAGCAGG - Intergenic
1138853152 16:60654887-60654909 CACCTGGCCTTTGACAAAGCTGG + Intergenic
1140816992 16:78630410-78630432 CTGCTTTCCTTTGTGGAGGCTGG + Intronic
1142135154 16:88448606-88448628 ATTCTGACATTTGTCAAAGCTGG - Intergenic
1142598131 17:1039534-1039556 CTGCTGTCCCTCTTCAAGGCAGG - Intronic
1142625222 17:1187451-1187473 CTGCAGCCCTGTGTCCAAGCTGG - Intronic
1143796376 17:9340238-9340260 CTTCTCTCATTTATCAAAGCTGG + Intronic
1144440493 17:15276903-15276925 CTGCTGACCTCAGTCATAGCTGG + Intergenic
1146564515 17:33900886-33900908 CTGCTGTCTTTAGCCAAGGCTGG - Intronic
1146744285 17:35314106-35314128 CTGCTGTCCCCTGCCAAATCGGG - Intergenic
1146798545 17:35800191-35800213 CTGTTGTCTTCTGTCAGAGCAGG - Intronic
1147490362 17:40860263-40860285 CTGCTCTCCTTTCTCCTAGCTGG - Intergenic
1154508858 18:15072615-15072637 CTGCTTTCCTGTGAAAAAGCAGG - Intergenic
1156192598 18:34736918-34736940 CTGATGCCCTGTGGCAAAGCAGG - Intronic
1156256420 18:35401906-35401928 CTGCAATCCTTTTTTAAAGCTGG + Intergenic
1158857024 18:61553241-61553263 CTGGTGTGCTTTGTTATAGCTGG - Intronic
1160345528 18:78128979-78129001 CTGCTGTCCTTTTAAAAAGAGGG + Intergenic
1162050199 19:8028365-8028387 CTGCTCTCCTGGGTCAATGCAGG + Intronic
1166416162 19:42596092-42596114 CTGCTGTCCTTCGTGAAGCCAGG - Intronic
926276974 2:11411408-11411430 CTGCTGTCCTGTGTTAGATCTGG - Intergenic
926542403 2:14197557-14197579 CTGCCCTCTTTTGTCAATGCTGG + Intergenic
928693107 2:33820918-33820940 CTGGTGTCCTGTGTCCAAGCGGG - Intergenic
929114280 2:38431302-38431324 CTTCAGTCCTATTTCAAAGCTGG - Intergenic
929119131 2:38469399-38469421 CTTCTCTCTTTTGTCCAAGCTGG + Intergenic
929527836 2:42722487-42722509 CTTCTGTGCTCTGTCAAACCAGG - Intronic
931082584 2:58792135-58792157 CTGCTGTCATATGCCAGAGCTGG + Intergenic
932332029 2:70903295-70903317 TTGCTGTCCTATGTCAATGTTGG + Intronic
932491229 2:72122794-72122816 CTTATGTCTTTTGCCAAAGCTGG - Intergenic
933914425 2:86973946-86973968 CTGCTTTTCTATATCAAAGCTGG - Intronic
934008568 2:87795953-87795975 CTGCTTTTCTATATCAAAGCTGG + Intronic
935772214 2:106436959-106436981 CTGCTTTTCTATATCAAAGCTGG + Intronic
935907857 2:107858987-107859009 CTGCTTTTCTATATCAAAGCTGG - Intronic
936129649 2:109824095-109824117 CTGCTTTTCTATATCAAAGCTGG - Intronic
936215048 2:110547390-110547412 CTGCTTTTCTATATCAAAGCTGG + Intronic
936424185 2:112401953-112401975 CTGCTTTTCTATATCAAAGCTGG + Intronic
940881286 2:158949351-158949373 CTGCTTTCCGTAGTCAAAACAGG - Intergenic
941656308 2:168148419-168148441 CTGCTGTCCTGACTCAAAGGAGG + Intronic
943053198 2:182942098-182942120 CTGGTCTGGTTTGTCAAAGCTGG + Exonic
943490269 2:188544844-188544866 TTGATGTCCTTTGTCAAATCGGG - Intronic
944662675 2:201934293-201934315 CCGTTGTCATTTGTCAAAGGCGG - Intergenic
946341969 2:219075733-219075755 CTGCTTTCCTTTGCCAAACTTGG - Exonic
946909541 2:224445813-224445835 CTGCTGTACTGAGTCAGAGCTGG + Intergenic
948684934 2:239664441-239664463 GTCCTGGCCTTTGCCAAAGCGGG - Intergenic
1170350000 20:15428437-15428459 TTGCAGTCCTTTTTAAAAGCAGG + Intronic
1172096765 20:32464207-32464229 GCGCTGGCCTTTGTCAAAGCAGG - Intronic
1176789217 21:13299127-13299149 CTGCTTTCCTGTGAAAAAGCAGG + Intergenic
1177456135 21:21342534-21342556 CTGCTGTCTTTTGTGGCAGCAGG + Intronic
1177927983 21:27242737-27242759 CTCCTGTCCTTGGACAAATCTGG + Intergenic
1177988376 21:28007291-28007313 CTGCTTTCCTGTGAAAAAGCAGG + Intergenic
1182011653 22:27006301-27006323 CTGCTGTCCTTGCTCACAGTGGG + Intergenic
952965043 3:38615939-38615961 CTGCTGTCCTTAGCCACACCCGG - Intronic
953559894 3:43979443-43979465 CTGCTGTCCGTAATCAGAGCAGG - Intergenic
956763282 3:72462458-72462480 CTGCTATCATTTGTTAAAGGAGG - Intergenic
958124251 3:89335048-89335070 CTGATCTCCTTTTTAAAAGCTGG + Intronic
961548139 3:127650480-127650502 CTACTGTCATTTATCACAGCTGG - Intronic
962276564 3:134019029-134019051 CTGCTCCCCTTGGTCACAGCTGG + Intronic
968457074 4:705444-705466 CTGCTGTCCTTTGTGGGAGCCGG - Intergenic
969057715 4:4412548-4412570 CAGCTGCCCTTGGCCAAAGCTGG + Intronic
970723273 4:19013124-19013146 CTGCTTCCCTTTTTCAAACCAGG + Intergenic
977245603 4:94627186-94627208 GAGCTGTCCATTGTCAAAACTGG + Intronic
979820970 4:125171205-125171227 CTGCTTTATTTGGTCAAAGCAGG + Intergenic
985468453 5:20604-20626 CTGCTGTCCTTTGTGGAGGGTGG - Intergenic
986547766 5:8917881-8917903 ATGCTGTCCTCTGTCACACCTGG - Intergenic
988990031 5:36661678-36661700 CAGCTGTTCTTTGGCAAAGCAGG + Intronic
989019232 5:36981670-36981692 CTGCTTTCTTTTGTCAAAGAGGG + Intronic
994743775 5:103653642-103653664 CTGCTTTCCTTTGTGAAAGCAGG - Intergenic
998050315 5:139026983-139027005 CTGCTCTCCTTAGGCAAGGCAGG - Exonic
998797573 5:145835719-145835741 ATGCTGGCCTTTGTCACACCAGG - Intergenic
999444735 5:151630357-151630379 CTGTTGTCCTGTGTAAAGGCAGG + Intergenic
999811975 5:155136321-155136343 CTACTGTCTTCTGTTAAAGCTGG + Intergenic
1000714851 5:164629237-164629259 CTGCTGGACTTTATCAAAGATGG + Intergenic
1002853888 6:1020835-1020857 CTGCTGGCCTTGGTGAAGGCAGG - Intergenic
1003407634 6:5836945-5836967 CTGCTGTTGTTTGACAAAGTTGG - Intergenic
1003855402 6:10268624-10268646 CTGCTGTCCTCCGTGGAAGCCGG - Intergenic
1004553560 6:16673464-16673486 CTCCTCACCTTTGTCAAGGCAGG + Intronic
1004901146 6:20195318-20195340 CTGCTGTCAGTGGCCAAAGCTGG - Intronic
1006021682 6:31121219-31121241 CTGATGACCTCTGTCAAAGCTGG + Intronic
1010950534 6:82031772-82031794 CTCCTGACCTATTTCAAAGCTGG - Intergenic
1011800765 6:91013271-91013293 CTGGTGTCCTTTGTAAAGACAGG + Intergenic
1013006973 6:106082985-106083007 CTGCCTTCCTTTTTAAAAGCCGG - Intergenic
1013373606 6:109492129-109492151 CTGCTGCCCTTCGTAAAGGCAGG + Intergenic
1014072339 6:117197409-117197431 CAGCTGTCCTTTGTTAAGTCAGG + Intergenic
1016356129 6:143220136-143220158 CTGCTGGAGCTTGTCAAAGCTGG + Intronic
1016566567 6:145461776-145461798 CTGCTGTGCCTTCTCATAGCTGG - Intergenic
1017670764 6:156767257-156767279 CTCCTCTCCTTCATCAAAGCAGG + Intergenic
1019056453 6:169227132-169227154 CTGCTGTTCTGTCTCACAGCGGG - Intronic
1022952743 7:35354061-35354083 CTGCTTTCCTTTTGCAAATCAGG - Intergenic
1024316066 7:48017913-48017935 CTACTGTCCTTTGTCCCAGTTGG - Intronic
1024715044 7:52069405-52069427 TTGCTTTCCATTGTCACAGCAGG - Intergenic
1024757298 7:52549952-52549974 CTGCTGTCCAGGGTCAAAGCTGG - Intergenic
1025083849 7:56006813-56006835 CTGCTGTCCTCTTTAACAGCTGG - Intergenic
1028162109 7:87497800-87497822 CTGTAGTCCTTTGTCCCAGCTGG - Intergenic
1033215159 7:139487910-139487932 CTGCTGTGCTGTGTCACAGGAGG - Intergenic
1035957551 8:4098744-4098766 CTGCTCTCCTTTGTCAGACAGGG + Intronic
1040697616 8:50021328-50021350 TTGCTGTCTGTTGTCACAGCTGG + Intronic
1042089411 8:65142517-65142539 ATGCTGTCCTATGTCAAATGAGG - Intergenic
1048818491 8:138356662-138356684 CTGATGTCCTTCCTCAAAGTAGG - Intronic
1049882371 8:145075157-145075179 TTGCTGACCTTTGGCAGAGCAGG + Intergenic
1050182610 9:2936298-2936320 CTGTTTTCCTCTGGCAAAGCGGG - Intergenic
1051652725 9:19345211-19345233 CTGCTTTCTTTTTCCAAAGCTGG + Intronic
1060200018 9:121646741-121646763 CTCCTGTCCCTTGACAAAGCTGG + Intronic
1060407022 9:123377836-123377858 CTGTGGTCATTTGTCAAAGGGGG + Exonic
1060540596 9:124427564-124427586 CTGGTGGCCTGTGTCTAAGCTGG - Intergenic
1187790723 X:22947189-22947211 CTGCTTTCCTTGGTCAAGACTGG + Intergenic
1188124005 X:26345422-26345444 CAGCCTTCCTTTTTCAAAGCAGG - Intergenic
1189260161 X:39672848-39672870 CTGCTGTTCAATGCCAAAGCTGG + Intergenic
1191651032 X:63537674-63537696 TTACTGTCCTTTAGCAAAGCTGG - Intergenic
1194996829 X:100600193-100600215 CTGCTTTTCTGTGTAAAAGCTGG + Intergenic
1195234509 X:102883468-102883490 CTTCTGTCCTTTATCAAATAAGG + Intergenic
1195869867 X:109474678-109474700 CTTCTGCCTTTTCTCAAAGCAGG - Intronic
1197565309 X:128077013-128077035 CTGATGACCTTTGTCCAAGGAGG + Intergenic
1198279945 X:135132022-135132044 GTGCTGTACTCTGTTAAAGCTGG + Intergenic
1198291012 X:135240492-135240514 GTGCTGTACTCTGTTAAAGCTGG - Intergenic