ID: 1093591093

View in Genome Browser
Species Human (GRCh38)
Location 12:20903706-20903728
Sequence GTTGAATTGGAGAAGGAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 10, 3: 32, 4: 244}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093591093_1093591100 27 Left 1093591093 12:20903706-20903728 CCAGGTTCCTTCTCCAATTCAAC 0: 1
1: 0
2: 10
3: 32
4: 244
Right 1093591100 12:20903756-20903778 AAACCATATCTTTCAATCCCTGG 0: 1
1: 2
2: 95
3: 597
4: 1602

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093591093 Original CRISPR GTTGAATTGGAGAAGGAACC TGG (reversed) Intronic
901559387 1:10058260-10058282 TTTGAGTTGGATAAGTAACCTGG + Intronic
904317546 1:29675497-29675519 GTGGAATTGGAGGAGGGGCCTGG - Intergenic
905320935 1:37116702-37116724 GTCGTATTGGAGGAGGAGCCTGG - Intergenic
906256813 1:44356638-44356660 TTTAAATTGGAGAGGGAAGCTGG + Intergenic
907704127 1:56818555-56818577 GGAGAATTGGAGAAGGAAAAAGG + Intronic
908092299 1:60698982-60699004 CTTGATTTGCAAAAGGAACCAGG + Intergenic
908620503 1:65974607-65974629 ATTGAATTGGAGGAGGGATCTGG + Intronic
909098894 1:71325151-71325173 CTTGAGTAGGAGAAGGAAGCTGG - Intergenic
909699107 1:78500605-78500627 TGTGAAGTGGAGAAGGAAGCAGG - Intronic
909922441 1:81399253-81399275 GTTGAATTGGAGGCAGAGCCTGG - Intronic
910290584 1:85596660-85596682 CTGGAATTGTAGAAGGAAGCGGG - Intergenic
910616434 1:89204012-89204034 GTCGAATTGGAGGAGGGGCCTGG + Intergenic
913551069 1:119917235-119917257 GATGAATGAGAGAAGGAAGCAGG + Intronic
915079040 1:153338722-153338744 GTTGAGTGGGAGGAGGAAGCAGG - Intronic
917523414 1:175766646-175766668 GTCGAATTGGAGGAGGGGCCTGG + Intergenic
918107615 1:181427389-181427411 GTTGAGATGGAGAAGGAATGAGG - Intronic
919409001 1:197220695-197220717 GTCGAATTGGAGGAGGGGCCTGG + Intergenic
919597049 1:199577361-199577383 GTTGATATGTAGAAAGAACCAGG + Intergenic
919943896 1:202306454-202306476 GTTGAATGGGAGATGGACCCTGG - Intronic
920508650 1:206534749-206534771 GATGAATTAGAAAAGAAACCTGG - Intronic
920660780 1:207912396-207912418 GTTGCACAGGAGAAGGATCCAGG + Intergenic
922213768 1:223504814-223504836 GATGAGTTGGAGAAGGCACTGGG - Intergenic
924089616 1:240488549-240488571 GCTGAATTCCAGAAGGAATCTGG + Intergenic
1064857295 10:19783809-19783831 GTGGAATTGGAGGAGGGGCCTGG + Intronic
1066055221 10:31674327-31674349 GATAAAGTGGAGAAGGAACGGGG - Intergenic
1069507417 10:69013166-69013188 ATTAAATTGGAGGAGGGACCTGG - Intronic
1070304663 10:75233264-75233286 GGGGAGGTGGAGAAGGAACCAGG - Intergenic
1070700586 10:78598925-78598947 CTTGGATTGGCGAAGGGACCTGG - Intergenic
1071526587 10:86363078-86363100 GGAGGCTTGGAGAAGGAACCAGG + Intronic
1074930881 10:118124777-118124799 GTTGAATTGGAGGAAGTGCCTGG + Intergenic
1076434903 10:130433708-130433730 GTCAAATTGGAGGAGGAGCCTGG - Intergenic
1078566534 11:12419030-12419052 GTTGAATTTATGAAGTAACCAGG + Intronic
1079818649 11:25095127-25095149 GTTGAATTGGAGGAGGGACCTGG - Intergenic
1080997124 11:37617901-37617923 GTTGAATTGGAGGAGGGGCCTGG + Intergenic
1080999128 11:37645719-37645741 TTTGAATGGGAAAAGGAACTTGG - Intergenic
1081310898 11:41570669-41570691 GTTGAATAGAAGAAGGAGCTTGG - Intergenic
1082645865 11:55724204-55724226 TTTGAAAGGGAGAAGGAATCAGG - Intergenic
1083179450 11:60974783-60974805 GGTGAATTAGAGACGGGACCAGG - Intronic
1083389204 11:62335753-62335775 GTGGGATAGGAGAAGGAATCTGG - Intergenic
1083424071 11:62574003-62574025 GCTGAATTGGAAAAAGAACTGGG + Exonic
1085217016 11:74842141-74842163 TTAGGATTGGAGAAGGTACCTGG + Exonic
1086472283 11:87127473-87127495 TTAGAATGGGAGAAAGAACCTGG - Intronic
1087706279 11:101496211-101496233 GTTGAATTGGAGGAGGGGCCTGG - Intronic
1088164807 11:106921547-106921569 AAGGAATTGGAGAAGGAAACTGG - Intronic
1088982518 11:114876468-114876490 GTTGAATTAGACACGGAACAAGG + Intergenic
1089017686 11:115180408-115180430 GTTTAATTGGAGAAGGGAGCTGG + Intronic
1089179211 11:116569405-116569427 GTTGAATTGGAGCAGGAAGATGG + Intergenic
1089535494 11:119158477-119158499 GTAGACTTGGAGTAGGAACTCGG - Intronic
1090031926 11:123213948-123213970 GTTGTCTTGGAGAAGAAAACTGG - Intergenic
1090258727 11:125303711-125303733 GTAGAACTGGAGAAGGAACTGGG + Intronic
1092573668 12:9754629-9754651 GTTGGACTGAAAAAGGAACCTGG - Exonic
1093146714 12:15575306-15575328 TTTGCAGTGGGGAAGGAACCTGG - Intronic
1093591093 12:20903706-20903728 GTTGAATTGGAGAAGGAACCTGG - Intronic
1093591417 12:20906101-20906123 GTTATATTGGAGAAGGGGCCTGG - Intronic
1094382469 12:29857721-29857743 GTTAAATTGGAGAAGAGGCCTGG + Intergenic
1094473247 12:30822701-30822723 GTGGATTTGGAGAAGGGAGCGGG - Intergenic
1094793247 12:33939202-33939224 GATGAATTGGAGAGGAGACCAGG + Intergenic
1095104522 12:38215959-38215981 GATGAATTGGAGAGGAGACCAGG + Intergenic
1095420873 12:42022262-42022284 GTTGAATTGGAAGAGGTTCCTGG - Intergenic
1095967389 12:47878259-47878281 GATGAATTGGGGCAGGAACTGGG - Intronic
1095978491 12:47956272-47956294 GTTGAATTGGTGGAGGGGCCTGG + Intergenic
1096916095 12:55035100-55035122 GATGAATTGTAGAAGGAAGGAGG - Intergenic
1097285464 12:57873734-57873756 GATGGTTTGGAGATGGAACCAGG + Intergenic
1098131230 12:67352705-67352727 GTTGAATTGGAGGAGGGGACTGG + Intergenic
1099946186 12:89247201-89247223 ATTGAATTGGCCCAGGAACCGGG + Intergenic
1100608644 12:96172114-96172136 CTTGAGTGGCAGAAGGAACCTGG - Intergenic
1101560515 12:105853321-105853343 GTAGAATTGGAGAAGGCTCAAGG - Intergenic
1102840437 12:116114124-116114146 GTTGACTTGGTGAAGAAACCAGG + Intronic
1106428423 13:29656384-29656406 GTCGAATTGGAGGAGGGGCCTGG - Intergenic
1106719079 13:32420339-32420361 GCAGAATTGGGGAAGGAATCAGG + Intronic
1106872549 13:34037476-34037498 GTTGAACAGTAGAAGGAAGCGGG + Intergenic
1108278911 13:48841174-48841196 GTTAAATAGGAGAAGAAAACTGG + Intergenic
1109130318 13:58576083-58576105 GTTGAATTGGAGGAGGGGTCTGG - Intergenic
1109395501 13:61753385-61753407 GTTGAATTAGAGGAGGGGCCTGG + Intergenic
1110667340 13:78133462-78133484 AATGAATTGGAGAAAGAACTTGG - Intergenic
1111271685 13:85895236-85895258 GTTTAATTTGAGAAGGAAAATGG + Intergenic
1111578543 13:90191313-90191335 GCTGAATTGGAGGAGGGGCCTGG - Intergenic
1112029527 13:95444315-95444337 CTTGAATTGCAGAAGGCAGCAGG + Intronic
1112455577 13:99559218-99559240 GTTCAATAGGAGAAAGAGCCTGG + Intronic
1112742830 13:102494842-102494864 GTTGAATTGGAGGAGGAGCCTGG - Intergenic
1113225213 13:108152216-108152238 GTTGAATTGGAAGAGGGAACTGG + Intergenic
1113969836 13:114180443-114180465 GTTGAGCTGGGGAAGGAGCCGGG - Intergenic
1116060054 14:39912088-39912110 GTTTAGTGGGAGAAGAAACCTGG - Intergenic
1121577275 14:94998420-94998442 CTTGATTTGGAGAAGGAAGTAGG + Intergenic
1122013344 14:98772172-98772194 GGGGATTTGGAGAAGGACCCTGG + Intergenic
1122700261 14:103583595-103583617 GTGGAATTAGAGAAGACACCAGG - Intronic
1125411112 15:39407274-39407296 GTTGAATTTGGGAAGGAGACTGG - Intergenic
1125927827 15:43577679-43577701 GCTGAACTGGAGAAAGAACCAGG - Exonic
1125940970 15:43677244-43677266 GCTGAACTGGAGAAAGAACCAGG - Intergenic
1127195549 15:56582033-56582055 GTTGAATTGGAGAATAACTCAGG - Intergenic
1130886735 15:88099323-88099345 GATGATTTGGAGAAGGAACATGG + Intronic
1131336924 15:91558092-91558114 GTGGAATTGGAGGAGGGGCCTGG - Intergenic
1133442797 16:5835147-5835169 GTAGAATTGCAGAAGGCAACTGG + Intergenic
1133530878 16:6653809-6653831 GATGAATGGGAGAAGGATGCAGG + Intronic
1136061170 16:27727497-27727519 GTTGATTTGGAGAATGGATCAGG + Intronic
1138842769 16:60529045-60529067 GTCAAATTGGAGGAGAAACCTGG + Intergenic
1140465866 16:75181962-75181984 GTCGAATTGGAGGAGGGGCCTGG - Intergenic
1141344783 16:83234516-83234538 GTTGCACTGGAGCAGGAATCTGG - Intronic
1142732166 17:1867096-1867118 TTTAAATTGGAGAGGGAATCGGG + Intronic
1149618970 17:58027440-58027462 GTTGAATAGGTGAAGCAATCAGG + Intergenic
1150543071 17:66123419-66123441 GCTGAGCTGGAGAAGGAACAGGG + Intronic
1153416037 18:4846651-4846673 GCTGAGTTGCAGAAGGAAGCAGG - Intergenic
1154253517 18:12764173-12764195 GTCAAATTGGAGGAGGAGCCTGG + Intergenic
1155055715 18:22181094-22181116 TCTAAATTGGAGAAGAAACCAGG + Intronic
1155293971 18:24368888-24368910 GTTGAATTGGAGCAGGGGCCTGG + Intronic
1155808942 18:30207700-30207722 GTTGAATTGGAGGAGGGGCATGG - Intergenic
1156470497 18:37374709-37374731 CTTCCATGGGAGAAGGAACCGGG - Intronic
1157384698 18:47251160-47251182 GTTGAACTGAGAAAGGAACCTGG + Intergenic
1158101633 18:53835660-53835682 GTCAAATTGGAGAATGAGCCTGG + Intergenic
1158147818 18:54335641-54335663 GTTGAATTGGAGGATCAGCCTGG + Intronic
1158381947 18:56941467-56941489 CTTGAATTGCAGAGGGAACCAGG + Intronic
1158591185 18:58780331-58780353 GTTGAGTTGGAGGAGGGGCCTGG - Intergenic
1158942570 18:62419195-62419217 GTTGAATTGGAGGACGGGCCTGG + Intergenic
1159750237 18:72291968-72291990 TGTGAAATGCAGAAGGAACCTGG - Intergenic
1159892189 18:73963607-73963629 GATGAATTGGAGGAGGGGCCTGG - Intergenic
1159892474 18:73965594-73965616 GTTGAATTGGATGAGGGGCCTGG - Intergenic
1160806595 19:994810-994832 GTGGGATTGAGGAAGGAACCGGG + Intronic
1163808344 19:19414361-19414383 GTTGACTTGCAGAAGGAATGAGG + Intronic
1164434322 19:28216162-28216184 GATGAATTGGAGAATGCACATGG - Intergenic
1168399512 19:56076944-56076966 GCTGAAGTGGAGAAGCATCCAGG + Intergenic
925069330 2:954198-954220 GTGGAAATGGAGAAGGAAGGAGG + Intronic
926057570 2:9783652-9783674 GTCGAATTGGAGGAGGGGCCTGG - Intergenic
927302957 2:21536704-21536726 GTTGAATTGGAGGAGAGGCCTGG + Intergenic
928717171 2:34074403-34074425 GTGCAATTGAGGAAGGAACCTGG + Intergenic
929612964 2:43285271-43285293 GTTGAATTGGAGGCGGGGCCTGG + Intronic
929876452 2:45800729-45800751 TTAAAATTGGAGAAGGAACTTGG + Intronic
930452578 2:51560709-51560731 GTCAAATTGGAGAAGGAGACTGG - Intergenic
930961371 2:57266356-57266378 GTTGAATTGGAGGAGGAGCCTGG - Intergenic
931707443 2:64958821-64958843 GTTGAAATGAAGAGAGAACCAGG + Intergenic
931995625 2:67836789-67836811 GTAGAGTTGGAAGAGGAACCAGG - Intergenic
932644721 2:73488378-73488400 GTGTAATTGGAGCGGGAACCAGG + Intronic
933334007 2:80930896-80930918 GTTGAATTGGAGGAGGGGCCTGG - Intergenic
933358393 2:81244591-81244613 GGTGGATTGGAGCAGGAACAAGG - Intergenic
934164515 2:89282075-89282097 GTAGAAATAGAGAAAGAACCTGG - Intergenic
934202759 2:89900449-89900471 GTAGAAATAGAGAAAGAACCTGG + Intergenic
934519618 2:95011714-95011736 TCTGCATTGAAGAAGGAACCTGG + Intergenic
936438606 2:112530333-112530355 GGTGAAGTGGAGAAGGTCCCAGG + Exonic
936482062 2:112893239-112893261 GTGGAATCTAAGAAGGAACCTGG + Intergenic
937290602 2:120779489-120779511 CCTGACTTGGAGAAGGAACTAGG + Intronic
937334301 2:121052060-121052082 GTTACAGTGGAGAAGGAAACAGG + Intergenic
937955066 2:127417503-127417525 GCAGACTTGGAGAAGGAACGTGG + Intergenic
939568291 2:143810819-143810841 GTTAAATGAGAGAAGGAACCAGG - Intergenic
942499957 2:176579029-176579051 GTAGAAATGGAGAAAGACCCTGG - Intergenic
943519078 2:188925096-188925118 GTCGAGTTGGAGAAGCAGCCTGG + Intergenic
944322176 2:198359074-198359096 GTTGAATTGATGAAAGAACATGG - Intronic
945426934 2:209717406-209717428 GTTGAATTGGAGGAGGGACCTGG - Intronic
945962086 2:216146212-216146234 GTTGAAATGGGGAAGGGAGCAGG + Intronic
946051187 2:216863928-216863950 TTTGAATTGGAGAAGTGACATGG - Intergenic
946937552 2:224737333-224737355 GTTGAATTGGAGGTGGGGCCTGG + Intergenic
948239666 2:236419516-236419538 GTGGAATTAGGGAAGGAACTGGG - Intronic
1169876240 20:10300030-10300052 GTTAAACTGGAAATGGAACCTGG - Intronic
1170812376 20:19684563-19684585 GGTGAAAGGGAGAAGGAACAGGG - Intronic
1172314003 20:33939467-33939489 GTTGAATTGGAGGAGGGACCTGG + Intergenic
1177654354 21:23998600-23998622 TTTGATTTGGAGAAGGGGCCAGG - Intergenic
1179193363 21:39142334-39142356 GTTGAATTGGAGGAGGGACCTGG + Intergenic
1179915097 21:44472036-44472058 GTCGAATTGGAGGAGGGGCCTGG - Intergenic
1182272525 22:29164302-29164324 GTTGAAGGAGAGAAGGAGCCTGG + Intronic
1184881448 22:47306923-47306945 GTAGAATTGGAGGAGGGGCCTGG + Intergenic
949156802 3:837523-837545 GTTGAATTGGAGGAGGAGACTGG - Intergenic
950201541 3:11048098-11048120 GTCCAATGGGAGAAGGGACCTGG + Intergenic
953465985 3:43119948-43119970 CTGGAATTGGAGAAGGAGCATGG - Intergenic
953501845 3:43443975-43443997 GATGAAATAGAGAAGGATCCGGG - Intronic
954287195 3:49627309-49627331 GTGAACTTGGAGAAGGGACCAGG - Intronic
958187988 3:90148048-90148070 GTTGAATTGGAGGAGGGGCCTGG - Intergenic
958410533 3:93809945-93809967 GTCGAATTGGAGGAGGGGCCTGG - Intergenic
958469499 3:94499403-94499425 GTTGAATTGGAGGAGGGGCCTGG + Intergenic
958475069 3:94569748-94569770 GTTGAAGTGGAGGAGGAGCCTGG + Intergenic
959125146 3:102282208-102282230 GTTAAATTGGAGGAGGGACCTGG + Intronic
960166027 3:114402352-114402374 ATTGAATTGAAGAAGCAAACAGG + Intronic
960233024 3:115251006-115251028 GTTGAAGTCTAGAAGGAACATGG - Intergenic
961067470 3:123888816-123888838 GTTGAATTGGAGGAGGGGCCTGG - Intergenic
962859188 3:139382166-139382188 GTCAAATTGGAGGAGGACCCTGG + Intronic
963065796 3:141263426-141263448 TTTGAATTGTAGAAGGGAACAGG + Intronic
963083907 3:141419289-141419311 GTTGAACTGGAGGAGGGGCCTGG - Intronic
964896453 3:161602401-161602423 GTTGGATTGGAGGAGGGGCCTGG - Intergenic
965089891 3:164148921-164148943 GTTAAATTGGAGGAGGGGCCTGG - Intergenic
965845275 3:172953805-172953827 CTTGAAAAGGAGAAGGAAGCTGG + Intronic
967491479 3:190096261-190096283 GTTGAACTGGAGAAGGGGCTTGG + Intronic
967719680 3:192802309-192802331 GTCGAAGTGGGGAAGGAAGCAGG - Intronic
970487598 4:16540182-16540204 GTTGATTTGGAGGAGGGGCCTGG - Intronic
971157224 4:24096030-24096052 CTTGAATTGGAGGAGGGGCCTGG + Intergenic
971427297 4:26529230-26529252 GTTGAGTGGGTGCAGGAACCAGG + Intergenic
972888059 4:43517554-43517576 GTCGAATTGGAGGAGGGATCTGG - Intergenic
974981613 4:68964583-68964605 ATTGAATTGGAAAAGGGGCCTGG - Intergenic
975461932 4:74664046-74664068 TTTGAATTGGAGAGAGAAACTGG + Intergenic
976287436 4:83384304-83384326 GTCAAATTGGAGGAGGAGCCTGG - Intergenic
976287725 4:83386255-83386277 GTTGAATTGGAGGAGGGGCCTGG - Intergenic
976706157 4:88021791-88021813 GCTGAATTGGAAAAGCAACGTGG - Intronic
976853545 4:89576603-89576625 GTTGAATTGGAGGAGGGGCCTGG + Intergenic
977424674 4:96852810-96852832 GTTAAATTGAAGTAGGATCCTGG + Intergenic
977552475 4:98457007-98457029 GTCGAATTGGAGGAGGGACGTGG - Intergenic
978255875 4:106692312-106692334 GTTGAATTGGAGGAGGGGCCTGG + Intergenic
978391293 4:108228232-108228254 GTCGAATTGGAGGAGGGGCCTGG - Intergenic
978497632 4:109377277-109377299 GTTGAATGGAAGAATGAACAAGG - Intergenic
980841032 4:138261694-138261716 GTTGAATTGGAGGAGGGTCTTGG - Intergenic
981392094 4:144203003-144203025 GTTGAATTGGAGAAGGGGCCTGG + Intergenic
981506261 4:145503615-145503637 TTTGTATTGGAGGAGGAAACAGG - Intronic
981853029 4:149254354-149254376 GTAGCATTGGAGATGGACCCAGG - Intergenic
982619311 4:157683569-157683591 GTACACTTGGAGAAGGAGCCTGG - Intergenic
983002509 4:162434935-162434957 GTCAAATTGGAGGAGGGACCTGG - Intergenic
983812195 4:172076867-172076889 GTGGAATTGGAGGAGAGACCTGG + Intronic
984341087 4:178456944-178456966 TTTGAATGAGAGAAAGAACCGGG + Intergenic
985388389 4:189468596-189468618 GTAGAAATCGAGAAGGAGCCTGG + Intergenic
986123441 5:4864415-4864437 GTCGAATTGGAGGAGGGTCCTGG - Intergenic
986481632 5:8194773-8194795 GTTGAATTGGAGGAGGCGCCTGG - Intergenic
986493794 5:8320908-8320930 GAAGAATTGGAGAAAGATCCTGG - Intergenic
986654843 5:10000626-10000648 GTCGAATTGGAGGAGGGGCCTGG - Intergenic
991455698 5:66801243-66801265 GTAGAATTTCAGAAGGGACCTGG + Intronic
991662089 5:68960767-68960789 GTTGAATTGGAGGAGGGGCTTGG - Intergenic
992438675 5:76779483-76779505 GTTGCCTTGGAGAAGCAAACAGG + Intergenic
992969778 5:82044343-82044365 GTTGAATTAGAGGAGGGGCCTGG - Intronic
993800681 5:92331711-92331733 GCTGCATTGAAGAAGGAATCCGG + Intergenic
994128925 5:96201691-96201713 GTGGTATTGGAGCAGGGACCTGG - Intergenic
994921312 5:106047869-106047891 GTTGTAGTGAAGTAGGAACCAGG - Intergenic
997575399 5:134971833-134971855 ATAAAATTGGAGGAGGAACCAGG + Intronic
997856883 5:137380742-137380764 GTTGAATTGCAGGAGGGGCCAGG - Intronic
999068182 5:148714824-148714846 GTTGAATTGGAGGAGGAGCCTGG + Intergenic
999409965 5:151342205-151342227 GTGGAACTGAAGAAGGAGCCAGG - Intronic
999685466 5:154098806-154098828 GTTGATCTGGAGAAGGTATCAGG - Intronic
1000230112 5:159307921-159307943 GTTGCTTAGGAGAAGGAAACAGG + Intergenic
1001173464 5:169443708-169443730 GTTGAAGAGGAGCAGGGACCAGG + Intergenic
1001855648 5:175008154-175008176 GTTGAAATGGAAAAGGAAGTAGG + Intergenic
1003172234 6:3728994-3729016 CTTGGATTTGAGAAGGCACCAGG - Intronic
1007814903 6:44514823-44514845 GCTGAACTGGAGCAGCAACCAGG + Intergenic
1009791344 6:68404886-68404908 GTTGAATTGGACGAGGGGCCTGG - Intergenic
1011287792 6:85743637-85743659 GTTGAATTGGAGGAACAGCCTGG + Intergenic
1011354445 6:86459553-86459575 GTTGAATTTGAGGAGGTTCCTGG + Intergenic
1012092566 6:94918082-94918104 GTTGAATTGGAGGAGACTCCTGG + Intergenic
1012420563 6:99060091-99060113 TTTGAATTGGAGAATAGACCAGG - Intergenic
1012675291 6:102105448-102105470 GTTGTTTTGTAGAAGGTACCGGG - Intergenic
1012732076 6:102895720-102895742 GTGGAATTAGAGAACGGACCTGG + Intergenic
1012756408 6:103237495-103237517 GTTGAATTGGAGTGAGGACCTGG + Intergenic
1012883047 6:104814682-104814704 GTTGAATTGGAGGAGGGACCTGG + Intronic
1012992158 6:105937150-105937172 TTTGATGTTGAGAAGGAACCTGG - Intergenic
1013272256 6:108556193-108556215 GAAGAAATGGAGAAGGAACAAGG + Intergenic
1014898843 6:126938589-126938611 GTCGAATTGGAGAAAGGGCCTGG + Intergenic
1015429399 6:133112946-133112968 GTGGAATGGGAGCAGAAACCAGG - Intergenic
1015639438 6:135315188-135315210 GTTGAACTGGTCAAGGAACTAGG - Intronic
1016264206 6:142212881-142212903 GTTGAATTGAAGGAGGGGCCTGG - Intronic
1016863549 6:148745839-148745861 ATTGGATTTAAGAAGGAACCAGG - Intergenic
1017860759 6:158395088-158395110 GTCAAATTGGAGGAGGGACCTGG - Intronic
1022272227 7:28819877-28819899 GTGGAAATGGAGAAGAAAACTGG - Exonic
1022523817 7:31024603-31024625 GTTGAATTGGAGGAGGGGCCTGG - Intergenic
1024895899 7:54261532-54261554 GTTGAATTGGAGGAGGGGCCAGG - Intergenic
1030752292 7:113242572-113242594 GTTGAATTGGAGGTGGGGCCTGG + Intergenic
1030907812 7:115207916-115207938 GTGGAAGCGGAGAAGGAACAAGG + Intergenic
1031265715 7:119577552-119577574 GTCAAATTGGAGGAGGGACCTGG - Intergenic
1033632091 7:143168789-143168811 GTTGAATTAGAGGAGGGACCTGG - Intergenic
1034593909 7:152169597-152169619 GTTTGATTGAAGAAGAAACCAGG - Intronic
1034643537 7:152624190-152624212 GTCGAATTGGAGGAGGCACCTGG - Intergenic
1036523982 8:9518323-9518345 GTGGAACTGGAGAAGTAATCGGG + Intergenic
1037039396 8:14211780-14211802 GTTGAATTGGAGAAGGGGCCTGG - Intronic
1037090783 8:14915484-14915506 GGTGAATGCCAGAAGGAACCAGG + Intronic
1038503447 8:28064053-28064075 GGTGAATGGGAGAAGGAGCATGG - Intronic
1038522547 8:28245665-28245687 GTTGAATTGGAGGAGGGGCCGGG - Intergenic
1039457305 8:37716014-37716036 ATTGAAGGGGAGAAGGAGCCAGG + Intergenic
1042817429 8:72892699-72892721 GTAGTATAGGAGAAGGAAACGGG - Intronic
1044765660 8:95571370-95571392 GTTGAATTGGAAGAGGGGCCTGG + Intergenic
1045124021 8:99069745-99069767 GTTGAACTTGAGAAGGAAATTGG + Intronic
1045219561 8:100185195-100185217 GTGGGAGTGGAGAAGGAACAAGG - Intronic
1046437323 8:114208390-114208412 GTTGAATTGCTGAAGGAAGCAGG - Intergenic
1048462114 8:134629517-134629539 GTTGAATTGGAGGAGAGGCCTGG + Intronic
1050309228 9:4335799-4335821 GTTCAATGGGGGAAGGACCCTGG - Intronic
1051057306 9:13003015-13003037 GTTGAAGTGGAGAAGGTGTCAGG + Intergenic
1051811420 9:21053960-21053982 GTGGAATTGGAGGAGGGGCCTGG + Intergenic
1051988344 9:23119049-23119071 GTTGAATTGGAGGAGGGGCCTGG - Intergenic
1052139242 9:24958090-24958112 GTTCATTTGAAGAAGGAATCAGG - Intergenic
1053464383 9:38294722-38294744 GCTGGCTTGGAGAGGGAACCAGG - Intergenic
1054710313 9:68504467-68504489 GTTGGAGTGGAGAAAGAAGCAGG - Intronic
1055223707 9:73968833-73968855 GTTGAATTCGAGGAGGCATCTGG + Intergenic
1061267017 9:129512135-129512157 GAGGAGTTGGAGAAGGAGCCAGG - Intergenic
1061447247 9:130647050-130647072 GTTGAATTTGAGGAGGGGCCTGG - Intergenic
1061531603 9:131218497-131218519 TTTGAAAGGCAGAAGGAACCAGG - Intronic
1061538877 9:131266617-131266639 GTTGAATAGCAGGAGGCACCTGG - Intronic
1203772654 EBV:57517-57539 GAAGAAGTGGAGAAGGAGCCGGG + Intergenic
1203772665 EBV:57568-57590 GAAGAAGTGGAGAAGGAGCCGGG + Intergenic
1188102493 X:26107038-26107060 TTTGAATTGGAGAAGGATTGAGG + Intergenic
1189131131 X:38498948-38498970 GATGAATTGGGGAAGCAACCAGG - Intronic
1189588649 X:42488505-42488527 GTGGAAGTGGAGAGGGAAGCGGG - Intergenic
1190282734 X:48941699-48941721 GTTGAATAGTGGAAGGAACGTGG - Intronic
1192494737 X:71608165-71608187 CTTGAACTAGAGTAGGAACCAGG + Intronic
1194352832 X:92841373-92841395 GTCAAATTGGAGGAAGAACCTGG - Intergenic
1194450572 X:94040563-94040585 GTTGAATTGGAGTGGGGGCCTGG + Intergenic
1199077605 X:143542317-143542339 GTTGAATAGGAGTAGGAAAATGG - Intergenic
1199986757 X:152958376-152958398 GTTGAACTGCAGCAGGAACAAGG + Intronic
1200661134 Y:5958115-5958137 GTCAAATTGGAGGAAGAACCTGG - Intergenic
1201896741 Y:18999970-18999992 CCTGACTTGGAGAAGGAACATGG - Intergenic