ID: 1093594884

View in Genome Browser
Species Human (GRCh38)
Location 12:20948247-20948269
Sequence TGACCTCTGTTGTTGACATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093594878_1093594884 18 Left 1093594878 12:20948206-20948228 CCAGTTATTGAAAGTGTCTACCC No data
Right 1093594884 12:20948247-20948269 TGACCTCTGTTGTTGACATGTGG No data
1093594881_1093594884 -2 Left 1093594881 12:20948226-20948248 CCCATACCAGGATGTATTGGATG No data
Right 1093594884 12:20948247-20948269 TGACCTCTGTTGTTGACATGTGG No data
1093594882_1093594884 -3 Left 1093594882 12:20948227-20948249 CCATACCAGGATGTATTGGATGA No data
Right 1093594884 12:20948247-20948269 TGACCTCTGTTGTTGACATGTGG No data
1093594883_1093594884 -8 Left 1093594883 12:20948232-20948254 CCAGGATGTATTGGATGACCTCT No data
Right 1093594884 12:20948247-20948269 TGACCTCTGTTGTTGACATGTGG No data
1093594877_1093594884 19 Left 1093594877 12:20948205-20948227 CCCAGTTATTGAAAGTGTCTACC No data
Right 1093594884 12:20948247-20948269 TGACCTCTGTTGTTGACATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093594884 Original CRISPR TGACCTCTGTTGTTGACATG TGG Intergenic
No off target data available for this crispr