ID: 1093596540

View in Genome Browser
Species Human (GRCh38)
Location 12:20969044-20969066
Sequence GTTTCTCCCAAAAAGGAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093596538_1093596540 -5 Left 1093596538 12:20969026-20969048 CCATAATGAAAAACAGAGGTTTC No data
Right 1093596540 12:20969044-20969066 GTTTCTCCCAAAAAGGAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093596540 Original CRISPR GTTTCTCCCAAAAAGGAGTC TGG Intergenic
No off target data available for this crispr