ID: 1093603794

View in Genome Browser
Species Human (GRCh38)
Location 12:21064846-21064868
Sequence ACTGATATGGAGGCGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 154}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093603787_1093603794 -8 Left 1093603787 12:21064831-21064853 CCACATTTCAGGCCCACTGATAT 0: 1
1: 0
2: 1
3: 11
4: 136
Right 1093603794 12:21064846-21064868 ACTGATATGGAGGCGGTGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093603794 Original CRISPR ACTGATATGGAGGCGGTGGA AGG Intronic
900806155 1:4769590-4769612 ACTGACAGGGTGGTGGTGGAAGG + Intronic
903253290 1:22072693-22072715 AGTGACAGGGTGGCGGTGGAAGG - Intronic
905631408 1:39521156-39521178 ACAGATTTGGAGGAGGTGGGAGG - Intronic
905666346 1:39765015-39765037 ACAGATTTGGAGGAGGTGGGAGG + Intronic
906726406 1:48047676-48047698 ACTGAGATGGAGGAGGATGAGGG + Intergenic
912055477 1:105592925-105592947 ACTGAAGTGGGGGCTGTGGATGG - Intergenic
912406281 1:109440828-109440850 ACTGATATGGAGAAGGCTGAAGG - Intergenic
912428791 1:109617544-109617566 GCTGGTATGGAGTGGGTGGAGGG + Exonic
913081657 1:115394052-115394074 ACTAATATGGGCGCGGTGGCGGG + Intergenic
918024867 1:180733312-180733334 AATGATATGGAAGCGGGGAAGGG - Intronic
920722733 1:208402700-208402722 ATTGGTAAGGAGGTGGTGGATGG - Intergenic
1063097084 10:2917785-2917807 TCTGATATGGAGGAGGGAGAGGG - Intergenic
1065988205 10:30978594-30978616 ACTGATCTGGAGGCAGTACAAGG - Intronic
1067228817 10:44392725-44392747 ACTGGTGTGGAGGGGGTGAAGGG - Intergenic
1067419510 10:46134052-46134074 ACTGATGTGGAGGGGCAGGAAGG + Intergenic
1067426507 10:46215359-46215381 ACTGATGTGGAGTGGGAGGAAGG - Intergenic
1067504862 10:46840649-46840671 ACTGATGTGGAGGGGCAGGAAGG + Intergenic
1068265247 10:54639971-54639993 GCTGATCTGGAGGCTGAGGAAGG + Intronic
1070739906 10:78895892-78895914 GCGGAGATGGAGGCGGAGGAAGG - Intergenic
1076085090 10:127620414-127620436 AATGAAATGGGGGCGGTGGGGGG - Intergenic
1076205681 10:128599554-128599576 GCTGAGGTGGAGGCGGTGGTGGG - Intergenic
1079532517 11:21472274-21472296 ACTGAGCTGGAGGCAGAGGAGGG - Intronic
1079588682 11:22156103-22156125 AGTGAAATGAAGGCAGTGGAAGG + Intergenic
1080378915 11:31746731-31746753 ACTGTTGTGGGGTCGGTGGAGGG + Intronic
1080517179 11:33035281-33035303 ACAGAGGTGGAGGAGGTGGAAGG - Intergenic
1083430244 11:62610690-62610712 ACTGAGATGGAGGAGGTCGAGGG + Intronic
1084111261 11:67015452-67015474 CCTGGTGTGGAGGCGGTGGTGGG + Intronic
1087290693 11:96317118-96317140 ACTGAAATGGTGCCTGTGGAAGG + Intronic
1093590181 12:20893546-20893568 ATTGATGTGGAGGTTGTGGAAGG + Intronic
1093603794 12:21064846-21064868 ACTGATATGGAGGCGGTGGAAGG + Intronic
1094497752 12:30999198-30999220 ACTGCTATGGAGGCTGAGGTAGG + Intergenic
1096078635 12:48819503-48819525 GCAGAGATGGAGGGGGTGGAAGG - Intronic
1097590894 12:61573940-61573962 ACTCACATGGAGGAGGTGGAAGG - Intergenic
1100688111 12:97009014-97009036 ACTGATCTGGAGGCTCTGTATGG + Intergenic
1102223932 12:111214766-111214788 ACTGCAAGGGAGGCGGTGAAGGG - Intronic
1102589240 12:113945234-113945256 TGTGATATGGAGGAGCTGGATGG + Intronic
1103180028 12:118902759-118902781 ACTGCTCTGGAGGCTGAGGAAGG - Intergenic
1103295360 12:119881738-119881760 ACTGAAATGGAGGCCGGGCATGG + Intergenic
1103373854 12:120439882-120439904 ACTGTGATGGGGGCGGGGGAGGG - Intronic
1103923842 12:124413089-124413111 ATTGAAATGGAGGCTGTGGTGGG - Intronic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1108290434 13:48954941-48954963 GCTGAAAAGGAGGCTGTGGAAGG - Intergenic
1108313624 13:49218476-49218498 ACTGAAGTGGAGGTGGAGGAAGG + Intergenic
1109904979 13:68829091-68829113 ATTGATATGGCGGGTGTGGAGGG - Intergenic
1111012718 13:82331813-82331835 ACTGTTGTGGAGTCGGGGGAGGG - Intergenic
1114765061 14:25361451-25361473 ACTGTTGTGGAGTGGGTGGAGGG + Intergenic
1116663797 14:47748719-47748741 ACTGAGATGGAGGAGGAAGAAGG - Intergenic
1118713195 14:68539415-68539437 ACTGAGAGGCAGGCGGAGGAGGG - Intronic
1119961395 14:78860848-78860870 GAAGATATGGAGGAGGTGGAAGG + Intronic
1127744560 15:61953387-61953409 ACTGTTATGGGGTCGGGGGAGGG - Intronic
1129337845 15:74864401-74864423 AAGGTTATGGAGGCTGTGGAGGG + Intronic
1130337730 15:82971765-82971787 ACTGATATGGGGGTGGGGGAGGG + Intronic
1133588011 16:7214472-7214494 ATGGAGATGGAGGCAGTGGATGG - Intronic
1137524897 16:49226286-49226308 ACTGATATGGGGGAGGTTGTGGG - Intergenic
1140841073 16:78839643-78839665 ACTGTTATGGAGGGTGGGGAGGG + Intronic
1143039597 17:4023982-4024004 ACTGATAGGGAGGTCATGGAGGG - Intronic
1145030703 17:19502739-19502761 ACTGTTGTGGAGGAGGCGGAAGG - Intronic
1149690042 17:58567873-58567895 GCTGAAATGGAGGAGGTGAATGG + Intronic
1151491141 17:74432770-74432792 ACCGAGAGGCAGGCGGTGGAGGG - Intronic
1157644562 18:49254182-49254204 ATTGCTATGGAGGGGGTGAATGG - Intronic
1161628106 19:5338617-5338639 GCTGATATTTTGGCGGTGGAAGG - Intronic
1162153807 19:8663467-8663489 ACTGAGATGGGGAAGGTGGAGGG + Intergenic
1162153825 19:8663525-8663547 ACTGAGATGGGGAAGGTGGAGGG + Intergenic
1165861798 19:38912889-38912911 ACTGATCTGGAGGCTGAGGCAGG - Intergenic
1167768986 19:51502009-51502031 ACTGAGAGGGAGGCAGTGGGCGG - Intergenic
1168019936 19:53601843-53601865 ACTGATATGTGGGGGCTGGAGGG + Intronic
925542491 2:4980689-4980711 ACTGATAAGGAGGAGCTGGAGGG + Intergenic
925894561 2:8461352-8461374 ACAGAGATGGAGGCAGTGGTAGG + Intergenic
926735345 2:16069655-16069677 ACAGATAAGGGGGCGGTGGCGGG - Intergenic
928229009 2:29479756-29479778 ACTCATCTGGGGGCGGTGGTAGG - Intronic
932347482 2:71005115-71005137 ACAGAGATGACGGCGGTGGAGGG + Intergenic
932889549 2:75580067-75580089 AATGATATGGAAGAGGAGGAAGG + Intergenic
933322501 2:80794804-80794826 ACTGACATGGAGGCAGTGAAAGG + Intergenic
933759166 2:85662368-85662390 ACTGAAATGGAGGTGGAGGGAGG - Intronic
937004365 2:118497616-118497638 ACTGAGATGGTGGTGGTGGATGG - Intergenic
937873248 2:126801605-126801627 ACTGATATGCAGGTGGGTGAGGG - Intergenic
937929852 2:127195551-127195573 ACTGAAACAGAGGCGGTGGCAGG + Intronic
938510873 2:131941893-131941915 ACTGCTATGGAGGCTGAGGCAGG + Intergenic
939259761 2:139792213-139792235 ACTATTATGGAGGTGGGGGATGG + Intergenic
939778393 2:146413513-146413535 ATTGATATGGGAGCGGGGGAAGG - Intergenic
941508141 2:166373425-166373447 ATTGATATGGAGGCTGTGGCAGG + Intronic
944663957 2:201943905-201943927 GCAGAGATGGAGGAGGTGGAAGG + Intergenic
945285534 2:208078035-208078057 GCTTGTATGGTGGCGGTGGAGGG + Intergenic
947634263 2:231672290-231672312 CCTGTTATGAAGGCGGGGGAGGG - Intergenic
1168787967 20:556298-556320 ACGTATATGGAGAGGGTGGAGGG + Intergenic
1174181658 20:48678927-48678949 TGTGATATGGAGGCGTTTGAAGG + Intronic
1174872535 20:54196350-54196372 ACTGATAGGGAGGAAGGGGAGGG + Intergenic
1175259854 20:57667549-57667571 ACTGTTGGGGTGGCGGTGGAGGG - Intronic
1175511189 20:59527447-59527469 ACTGATATGGAAGGGGGGCAGGG + Intergenic
1178794149 21:35728106-35728128 GCAGAGATGGAGGAGGTGGAAGG - Intronic
1179352643 21:40627386-40627408 ACTCATATAGTGGGGGTGGAAGG - Intronic
1179901207 21:44395729-44395751 AGGGATGTGGAGGCTGTGGAGGG + Intronic
1179901232 21:44395807-44395829 AGGGATGTGGAGGCTGTGGAGGG + Intronic
1179901314 21:44396069-44396091 AGGGATGTGGAGGCTGTGGAGGG + Intronic
1179901430 21:44396430-44396452 AGGGATGTGGAGGCTGTGGAGGG + Intronic
1180047914 21:45318312-45318334 ACTGACCTGGAGGTGGTGGGGGG - Intergenic
1181464443 22:23103287-23103309 ACTGGCATGGAGGCGGGGGCTGG - Intronic
1181515075 22:23405545-23405567 CCTGATGTGCAGGCGGTGGCTGG - Intergenic
1181546852 22:23607079-23607101 ACTGATGTGGAAGCTGTAGAGGG + Intergenic
1181906538 22:26201593-26201615 ACGTATCTGGAGGCGGTAGAAGG + Intronic
1182477520 22:30584297-30584319 ACAGATATGGATGTGGAGGAAGG - Intronic
950092397 3:10305142-10305164 ACTGTTAGGGAGGAGGAGGACGG - Exonic
951280897 3:20748137-20748159 ACTGATGTGGAGACTGTGGAAGG + Intergenic
952298855 3:32086061-32086083 ACTGATATGGAAGGGGGGCAGGG - Intergenic
952965244 3:38617015-38617037 ACTGATTTAGAGGCTGTGGGAGG - Intronic
953138621 3:40206114-40206136 GCTGATATGGAGTCCATGGATGG - Intronic
954778780 3:53045032-53045054 GCTGAAAAGGAGGCTGTGGAGGG - Intronic
959180053 3:102967864-102967886 ACTGTTGTGGAGTCGGGGGAAGG - Intergenic
959820843 3:110733566-110733588 GCTGATATGGACCCGGTGGGAGG + Intergenic
966168563 3:177050580-177050602 ACTGATATGATGGAAGTGGATGG - Exonic
969259324 4:6023589-6023611 ACTGAAATGTAGGCAGTTGAGGG - Intergenic
972356648 4:38285342-38285364 AATGATGTGGAGGTGATGGAAGG - Intergenic
976396200 4:84558357-84558379 ATTGGTATGGGGGCGGGGGAGGG - Intergenic
978829506 4:113067308-113067330 AGTGAAATGGAGGGGGCGGAGGG + Intronic
979089002 4:116453604-116453626 AATGATATGGAAGCGGGGAAGGG - Intergenic
980094849 4:128478979-128479001 AGTAATATGGAGTGGGTGGAGGG - Intergenic
981048628 4:140289754-140289776 ACAGAGATGGAGGCTGTGTATGG - Intronic
983194910 4:164796431-164796453 ACCGATAGAGAGGAGGTGGAAGG - Intergenic
989764022 5:45057715-45057737 ACTTAAATGGAGGAGGAGGATGG - Intergenic
989814591 5:45720973-45720995 AGTGATGTGGAGGCCGGGGAAGG + Intergenic
990207959 5:53450616-53450638 ACTGCTATGCTGGAGGTGGAGGG - Intergenic
990436721 5:55799817-55799839 ACTAAAATGGAGGGTGTGGATGG - Intronic
990636792 5:57736984-57737006 GCTGGTAGGGAGGTGGTGGACGG - Intergenic
997212503 5:132085760-132085782 GCTGATATGAAGGAGATGGATGG - Intergenic
997447854 5:133954665-133954687 ACTGTTTTGCAGGCTGTGGAGGG - Intergenic
998137340 5:139681094-139681116 CCTGACATGGAGGCTGTGGCAGG + Exonic
998244431 5:140485705-140485727 ACTGATCTTGAGAAGGTGGAGGG - Exonic
999927329 5:156393088-156393110 AATGATATGGAAGCGGGGCAGGG - Intronic
1002382238 5:178839205-178839227 ACAGATCTGGAGGGGGTGGTGGG + Intergenic
1002525454 5:179813249-179813271 TCTGATAAGGTGGCTGTGGATGG - Intronic
1005551180 6:26918323-26918345 ACTGTTATGGGGTCGGGGGAGGG - Intergenic
1009829837 6:68915875-68915897 ACTGCTATGGAAGTTGTGGAAGG + Intronic
1016733938 6:147455627-147455649 TCTGTTATGGAGGAGGAGGAAGG + Intergenic
1019286973 7:228520-228542 ACTGCCATGGGGGCTGTGGAGGG + Exonic
1021746602 7:23746774-23746796 ACAGAGATGGAAGAGGTGGAGGG + Intronic
1031001009 7:116414708-116414730 ACTGTTATGGGGTCGGGGGAGGG + Intronic
1031209787 7:118808363-118808385 AAAGAGATGGAGGAGGTGGAAGG + Intergenic
1031346506 7:120673547-120673569 AATGATATGGAGAAGGAGGATGG - Intronic
1032079425 7:128851259-128851281 ACTGACATGGCGGCTGTTGATGG - Exonic
1033537423 7:142324548-142324570 ACAGATATAGAGTCGGGGGACGG - Intergenic
1035759073 8:2055956-2055978 CCTGGGAAGGAGGCGGTGGAGGG - Intronic
1035966636 8:4199282-4199304 ATTGATATGCAGGCAGTGTATGG + Intronic
1037287274 8:17314798-17314820 CCTGATATGCAGTCGGTGAAGGG + Intronic
1038616387 8:29099484-29099506 ACTGCTATGGAGGCTGAGGCGGG - Intronic
1039306262 8:36266675-36266697 GCTGATATGGAGGCTGTAGAAGG - Intergenic
1041202733 8:55466478-55466500 ACTGTTATGGAGTGGGGGGAGGG + Intronic
1044515992 8:93139492-93139514 ACTCCTATGGAGGTGGTGAAGGG - Intronic
1044600076 8:93995271-93995293 ACTGTTGTGGAGTCGGGGGAGGG - Intergenic
1044965364 8:97568983-97569005 ACTGAGATGGAAGCCATGGAGGG + Intergenic
1047640985 8:126821285-126821307 AGTGATATGGAAGCGGGGAAGGG - Intergenic
1048083050 8:131149269-131149291 AATGATATGGAGGAGGGGCAGGG - Intergenic
1050123261 9:2330328-2330350 GGTGAGATGGAGGGGGTGGAGGG - Intergenic
1050387648 9:5108005-5108027 GCTGATAAGTAGGCTGTGGATGG - Intronic
1051666978 9:19474823-19474845 ATTGATAAGGAGGAGGAGGAGGG - Intergenic
1057644756 9:96862881-96862903 ACTAATCTGGCGGCGGTGGGTGG + Intronic
1060843498 9:126814887-126814909 ACTGAAATGAAGGTGGGGGAGGG - Intronic
1061129966 9:128703132-128703154 ACTGATTTGGAGACTGTGCAAGG - Intronic
1186429533 X:9493068-9493090 ACTGATAAGAAGCAGGTGGAGGG - Intronic
1193927368 X:87504404-87504426 ACTGTTGTGGAGTCGGGGGAGGG - Intergenic
1195397747 X:104429576-104429598 ACAGATATGGAGGAGTAGGATGG - Intergenic
1195646678 X:107238565-107238587 ACTGATATAAAGGCAGTTGAAGG + Intronic
1195691222 X:107627422-107627444 ACTGAGATGGAGGTGGGAGAGGG - Intergenic
1197104206 X:122694406-122694428 ACTGTTATGGGGTCGGGGGATGG - Intergenic
1199814204 X:151383232-151383254 TCTGATATGGAGGTGGGAGAAGG + Intergenic
1201262467 Y:12173372-12173394 ACTGTTGTGGAGTCGGGGGAGGG + Intergenic