ID: 1093604457

View in Genome Browser
Species Human (GRCh38)
Location 12:21073501-21073523
Sequence TTAGTTCACCGGTTTTGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 47, 3: 59, 4: 196}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093604454_1093604457 -5 Left 1093604454 12:21073483-21073505 CCTTGGTTGTATTTTTGTTTAGT 0: 21
1: 145
2: 192
3: 222
4: 774
Right 1093604457 12:21073501-21073523 TTAGTTCACCGGTTTTGTGTGGG 0: 1
1: 0
2: 47
3: 59
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093604457 Original CRISPR TTAGTTCACCGGTTTTGTGT GGG Intronic
906578836 1:46917609-46917631 TTAGTGCACTGGTTTTGTTTTGG + Intergenic
906594507 1:47062927-47062949 TTAGTGCACTGGTTTTGTGTTGG - Intergenic
906750783 1:48257823-48257845 TTAGATCTATGGTTTTGTGTTGG + Intergenic
906753896 1:48291185-48291207 TAAGTTCACTGGTTTTGTGTTGG + Intergenic
910708469 1:90154783-90154805 TTAGTGCACCAGTTTTGTGTTGG + Intergenic
910919531 1:92329086-92329108 TAAGTGCGCTGGTTTTGTGTTGG + Intronic
911562084 1:99418277-99418299 TTAGTGTGCCAGTTTTGTGTTGG - Intergenic
911806126 1:102210877-102210899 TTAGTGTGCTGGTTTTGTGTTGG + Intergenic
912033077 1:105274400-105274422 TTAGTGTGCTGGTTTTGTGTTGG + Intergenic
912181047 1:107219845-107219867 TAAGTGCACTGGTTTTGTGTTGG + Intronic
913236242 1:116785604-116785626 TAAGTGCGCTGGTTTTGTGTTGG - Intergenic
914375178 1:147066751-147066773 GTAGTTGAGCGGTTTTGAGTGGG - Intergenic
914927614 1:151902312-151902334 TTGGTTCCACGATTTTGTGTTGG - Intronic
915404210 1:155647011-155647033 TTAGCTCACCTGTCATGTGTGGG - Intergenic
916331637 1:163624597-163624619 TAAGTGCACTGGTTTTATGTTGG + Intergenic
917913597 1:179677804-179677826 TTAGTACACTGGCTTTGTGTTGG + Intronic
918589285 1:186222407-186222429 TTAATGCACTGGTTTTGTGTTGG - Intergenic
918819696 1:189236846-189236868 TTAGTGCTCTGGTTTTGTGTTGG + Intergenic
919254899 1:195108490-195108512 GTAGTTGAGCGGTTTTGAGTGGG - Intergenic
921532846 1:216306982-216307004 TTATTGCACTAGTTTTGTGTTGG + Intronic
921762839 1:218937070-218937092 TAAGTGCTCTGGTTTTGTGTTGG + Intergenic
924691531 1:246356028-246356050 TTAGTGTGCTGGTTTTGTGTTGG - Intronic
924894259 1:248318295-248318317 TTAGTGTACTGGTTTTGTGTTGG - Intergenic
1063561253 10:7130276-7130298 TTAGTGCGCTGGTTTTGTGTTGG + Intergenic
1065462397 10:25982488-25982510 TTAGTGCACTGGTTTTGTGTTGG - Intronic
1065894540 10:30151862-30151884 TTAGTGTGCTGGTTTTGTGTTGG + Intergenic
1066784913 10:38992907-38992929 GTAGTTGAGCGGTTTTGAGTGGG + Intergenic
1066992510 10:42529505-42529527 GTAGTTGAGCGGTTTTGAGTGGG + Intergenic
1067234157 10:44434536-44434558 TTATTGCACCATTTTTGTGTTGG + Intergenic
1068114749 10:52724460-52724482 TAAGTGCACCGGTTTAGTGTTGG - Intergenic
1068690826 10:59912098-59912120 TTAGTTCAGCCTTTTGGTGTGGG - Intergenic
1068808579 10:61228445-61228467 TAAGTGCACTGGTTTTGTGTTGG - Intergenic
1069129534 10:64681885-64681907 ATAGTGCACTGGTTTCGTGTTGG + Intergenic
1071015825 10:80996575-80996597 TAAGTGCACTGGTTTTGTATTGG + Intergenic
1072381712 10:94879339-94879361 TTAGTGTGCTGGTTTTGTGTTGG + Intergenic
1075331137 10:121574840-121574862 TTTGTTCTCCGTTTTTATGTTGG - Intronic
1077834230 11:5910357-5910379 TTAGTGCACTGGTTTTGTGTTGG + Intronic
1079806034 11:24932207-24932229 TTATTACACTGGTTTTGTGTTGG + Intronic
1079979725 11:27137426-27137448 TTAGTTCATCAGATTTTTGTAGG + Intergenic
1081091080 11:38867177-38867199 TTAGTGCACTTGTTTTGTGTTGG + Intergenic
1082120820 11:48378196-48378218 TTGGTGCACTGGTTTGGTGTTGG + Intergenic
1082253012 11:50002446-50002468 TTGGTGCACTGGTTTGGTGTTGG - Intergenic
1082941193 11:58707062-58707084 TTAGTGCACTCATTTTGTGTTGG - Intronic
1085240589 11:75050824-75050846 TTGGTGCACCGGTTTTGTGTTGG + Intergenic
1086844405 11:91730604-91730626 TTAGTGCACTGGTGTTGTGTTGG - Intergenic
1087804368 11:102539548-102539570 TTAGTGTGCTGGTTTTGTGTTGG - Intergenic
1087866083 11:103228639-103228661 TTAGTGTGCTGGTTTTGTGTTGG + Intronic
1088387443 11:109275390-109275412 TTAGTATACTGGTTTTATGTTGG + Intergenic
1089837006 11:121379409-121379431 TTAGTGCGCTGGTTTTGTGTTGG - Intergenic
1090307317 11:125702533-125702555 TAAGTGCACTGGTTTTGTGTTGG - Intergenic
1091955760 12:4640854-4640876 TTATTTCAATGGTTTTGGGTTGG + Intronic
1093291043 12:17322447-17322469 TTAGTGTGCTGGTTTTGTGTTGG + Intergenic
1093332347 12:17858250-17858272 GTAGTTCAGCGGCTTTGAGTGGG - Intergenic
1093604457 12:21073501-21073523 TTAGTTCACCGGTTTTGTGTGGG + Intronic
1093684530 12:22041188-22041210 TAAGTCCACTGGTTTTGTGGTGG - Intergenic
1093684544 12:22041367-22041389 TAAGTCCACTGGTTTTGTGGTGG + Intergenic
1093963794 12:25303715-25303737 TAAGTGCACTGGTTTTGTGTTGG - Intergenic
1095800140 12:46263543-46263565 TTATTGAACCGGTTTTGTTTAGG - Intronic
1097607184 12:61769428-61769450 TTAATGCAATGGTTTTGTGTTGG - Intronic
1098212056 12:68176936-68176958 CTACTTCACAGGTTTTTTGTGGG + Intergenic
1099042037 12:77667840-77667862 TTAGTGCACCAGTTTTGTGTTGG - Intergenic
1099522114 12:83676968-83676990 TTTGTTCACTTGTTTTGTTTCGG + Intergenic
1100669474 12:96795190-96795212 TTAGTGCACTGGTTTTGTGTTGG + Intronic
1100730517 12:97462380-97462402 TTTATTCACCCGGTTTGTGTTGG + Intergenic
1100951314 12:99853276-99853298 TAAGTGCCCTGGTTTTGTGTTGG - Intronic
1101544387 12:105697899-105697921 TTAACGCACTGGTTTTGTGTTGG + Intergenic
1105029463 12:132872772-132872794 TGAGTTCACCGGGGTTGTGATGG - Intronic
1106378204 13:29210874-29210896 TTAGTGCACTGGATTAGTGTTGG + Intronic
1106392201 13:29346105-29346127 TTAGTGCACTGGCTTAGTGTTGG + Intronic
1107625407 13:42276722-42276744 TTAGTTAATAGGTTCTGTGTGGG + Intronic
1108134263 13:47338471-47338493 TTAGTGTATTGGTTTTGTGTTGG - Intergenic
1108298673 13:49052625-49052647 TTAGTGTGCTGGTTTTGTGTTGG + Intronic
1108831710 13:54487269-54487291 TTAGTGTACTGGTTTTGTGCTGG - Intergenic
1109197088 13:59390300-59390322 TTAGTGTGCTGGTTTTGTGTTGG + Intergenic
1110375930 13:74794055-74794077 TTAGTGCACTACTTTTGTGTTGG + Intergenic
1111593913 13:90387459-90387481 TTAGTTCACTATATTTGTGTGGG - Intergenic
1112332442 13:98486699-98486721 GTAGTTCAGCGGTTCTCTGTTGG - Intronic
1112916085 13:104552149-104552171 CAAGTTCACCAGTTTTCTGTGGG + Intergenic
1114230671 14:20779168-20779190 TTAGTTCACTGTATTTGTGTGGG + Intergenic
1115393171 14:32877123-32877145 TTAGTGCACTGGTTTTGTGTTGG + Intergenic
1116320404 14:43454742-43454764 TTAGAGCAGCTGTTTTGTGTTGG - Intergenic
1116323755 14:43503555-43503577 TTTGTTTGCAGGTTTTGTGTTGG - Intergenic
1116413583 14:44653625-44653647 ATTGTTCATCCGTTTTGTGTGGG - Intergenic
1117103740 14:52378082-52378104 TTAGTGCACTGGTTTTGTGTTGG + Intergenic
1117716819 14:58589598-58589620 GTAGTTGAGCGGTTTTGAGTGGG + Intergenic
1117848057 14:59934800-59934822 TTATTTCAAAGGTTTTTTGTTGG - Intronic
1118413217 14:65504341-65504363 TTATTTGAATGGTTTTGTGTGGG + Intronic
1120400289 14:84022748-84022770 TTAGTGTGCTGGTTTTGTGTTGG + Intergenic
1120450882 14:84665686-84665708 TCAGTGCACTGGTTTTGTGTTGG + Intergenic
1120995267 14:90412771-90412793 TAAGTGCACTGGTTTTGAGTTGG + Intergenic
1121848396 14:97196185-97196207 TTAGTGTGCTGGTTTTGTGTTGG + Intergenic
1124910602 15:33916216-33916238 TTATTGCACAAGTTTTGTGTTGG - Intronic
1126201217 15:45988676-45988698 TTAGTTGACCTCATTTGTGTGGG + Intergenic
1126626651 15:50692081-50692103 TTAGTTGACTGTGTTTGTGTGGG - Intergenic
1132412816 15:101597479-101597501 TAAGTGCACTGGTTTTGTGATGG + Intergenic
1133374214 16:5270572-5270594 TTCTTTCATCTGTTTTGTGTTGG + Intergenic
1153396338 18:4625650-4625672 TTATTGCACCAGTTTTGTGCTGG + Intergenic
1153451310 18:5232654-5232676 TTAGTGCACTGGTTTTGTGTTGG + Intergenic
1154090063 18:11349713-11349735 TTAGTGTGCTGGTTTTGTGTTGG - Intergenic
1156607072 18:38679534-38679556 TTAGTGCACTGGGTTTTTGTTGG + Intergenic
1158377246 18:56884834-56884856 TTATTGCACCAGTTTTGTGTTGG - Intronic
1159453999 18:68638358-68638380 TTAGTGCACTAGTTTTGTGCTGG + Intergenic
1167669754 19:50843959-50843981 TTAGTGCGCTGGTTTTGTGTTGG + Intergenic
925441859 2:3895050-3895072 TAAGTGCACAGGATTTGTGTTGG + Intergenic
925652276 2:6104077-6104099 TTAGTACACTGCCTTTGTGTTGG + Intergenic
925795623 2:7539421-7539443 TTAGTGCTCTGGTTTTGTGTTGG + Intergenic
927036664 2:19184873-19184895 TTAGTGCACTGGTTTTGTGTTGG + Intergenic
927176721 2:20415145-20415167 TTAGTGCACTGGTTTTGTGTTGG + Intergenic
928685385 2:33744399-33744421 TTAGTGCACTGGTTTTGTGTTGG + Intergenic
929275933 2:40024670-40024692 GTAGTTGAGCGGTTTTGAGTGGG - Intergenic
930448587 2:51505789-51505811 TTAGTGCACTGGTTTTGTGTTGG - Intergenic
932650457 2:73550245-73550267 TTACTTCCCCGTTTTTCTGTAGG + Exonic
935007170 2:99089949-99089971 TTATTGCACTGGTTTTGTGCTGG - Intronic
936782606 2:116052238-116052260 GTAGTTGAGCGGCTTTGTGTGGG + Intergenic
936899253 2:117465875-117465897 TTAGTGGGCTGGTTTTGTGTTGG + Intergenic
938216606 2:129523056-129523078 TAAGTGCACTGGTTTTGTGTTGG + Intergenic
938564196 2:132503519-132503541 TTAGTGCACTGGTTTTGTGTTGG + Intronic
939424638 2:142019291-142019313 TTAGTTCAGTAGTTTAGTGTTGG + Intronic
940045879 2:149409354-149409376 TTAGAGCACTGATTTTGTGTTGG + Intronic
940423690 2:153508121-153508143 TTAGTGTACTGATTTTGTGTTGG + Intergenic
940802200 2:158145172-158145194 TTAATGCACCGGTTTTGCGCTGG - Intergenic
941883364 2:170503874-170503896 TTGGTGCGCTGGTTTTGTGTTGG + Intronic
943348768 2:186772535-186772557 TTAGTGCACTGGTTTTGTGTTGG - Intergenic
944485431 2:200200147-200200169 TCAGTGCACTGGTTTTGTGTTGG - Intergenic
947709815 2:232306552-232306574 TTAGTTCTCTGTGTTTGTGTTGG + Intronic
948576770 2:238956831-238956853 TTGGTGCACTGATTTTGTGTTGG - Intergenic
1170086301 20:12535837-12535859 TTAGTGCACTGGTTTTATGTTGG - Intergenic
1171038632 20:21739393-21739415 TTAGTGCGCTGGTTTTGTGCTGG + Intergenic
1173568403 20:44058588-44058610 TAAGTGCACTGGTTTTGTGTTGG - Intronic
1173745361 20:45432604-45432626 TTAGTTCACAGGTTTTCAGATGG + Intergenic
1177127783 21:17217341-17217363 TTAGTGCACTGGTGTTGTGTTGG - Intergenic
1177661252 21:24086178-24086200 TTAGTGCACTGGTTTTGTGTTGG - Intergenic
949377404 3:3405596-3405618 TTAGTGCACTGGTTTTGTGTTGG - Intergenic
949396492 3:3619823-3619845 TTATTTCACCTGGTTAGTGTTGG - Intergenic
951262184 3:20523403-20523425 TTAGTGCACTGGTTTTGTTTTGG + Intergenic
951268405 3:20597392-20597414 TTATTGCACTAGTTTTGTGTTGG + Intergenic
951435763 3:22662175-22662197 TTATTTGACCGTATTTGTGTGGG - Intergenic
952082920 3:29782220-29782242 TTAGTGCACTGGTTTTGTGTTGG - Intronic
952151781 3:30601293-30601315 TTAGTTCACTAATTTTGTTTAGG - Intergenic
952714867 3:36470513-36470535 TTATTGCACTGGTTTTGTGTTGG + Intronic
953185334 3:40632012-40632034 TTATTGCACTAGTTTTGTGTTGG - Intergenic
957068058 3:75542509-75542531 TTCTTTCATCTGTTTTGTGTTGG - Intergenic
959009696 3:101061010-101061032 TTAGTGCACTGGTTTTGTGTTGG + Intergenic
961285102 3:125795504-125795526 TTCTTTCATCTGTTTTGTGTTGG + Intergenic
961967909 3:130925526-130925548 TTAGTGTGCTGGTTTTGTGTTGG + Intronic
962012954 3:131411059-131411081 TAAGTGCACTGGTCTTGTGTTGG - Intergenic
962994962 3:140617379-140617401 TAAGTACAGTGGTTTTGTGTTGG - Intergenic
963373827 3:144437839-144437861 TTAGTGAGCTGGTTTTGTGTTGG + Intergenic
963832513 3:150023228-150023250 TTAGTGCACTGGTTTTGTGTTGG - Intronic
964017529 3:151965272-151965294 TTAGTGCACTGGTTTTGTGTTGG - Intergenic
964075712 3:152688966-152688988 TGAGTGCACCAGTTTTGTGTTGG - Intergenic
964299404 3:155271308-155271330 TTAGTATGCTGGTTTTGTGTTGG - Intergenic
965179046 3:165377378-165377400 TTTCTTCACTGGTTTAGTGTAGG - Intergenic
969012409 4:4077071-4077093 TTCTTTCATCTGTTTTGTGTTGG - Intergenic
969553578 4:7890221-7890243 TCAGTTGACCGTTTATGTGTGGG - Intronic
969741445 4:9030684-9030706 TTCTTTCATCTGTTTTGTGTTGG + Intergenic
969800807 4:9563569-9563591 TTCTTTCATCTGTTTTGTGTTGG + Intergenic
970283001 4:14478759-14478781 TTAGTGCACTGCTTTTGTGTTGG - Intergenic
971050362 4:22855246-22855268 TTAGTGCACCTGTTTTGTGTGGG + Intergenic
972464269 4:39338588-39338610 GTAGTTTACCTTTTTTGTGTAGG + Intronic
974583398 4:63836773-63836795 TAAGTACACTGGTTTTGTGTTGG + Intergenic
975942873 4:79668619-79668641 TCAGTGCACTGGTTTTGTGTTGG - Intergenic
976887896 4:90008084-90008106 TAAGTGCACTGGTTTTGTGTTGG - Intergenic
976918196 4:90404553-90404575 TTAGTGCACTGGTTTTGTGTTGG - Intronic
977175657 4:93816634-93816656 TTAGTTCATAGTTTTTGTGATGG - Intergenic
977513738 4:97994750-97994772 TAAGTGTACTGGTTTTGTGTTGG + Intronic
977777582 4:100939206-100939228 TTAGTGCACTAGTTGTGTGTTGG - Intergenic
977826132 4:101533794-101533816 TTATTGCACTAGTTTTGTGTTGG - Intronic
977976077 4:103268589-103268611 TTAGAGCACTGGTTTTGTGTTGG + Intergenic
978201920 4:106032590-106032612 TTAGTGCACTGGTTTTGTGTTGG + Intergenic
980409911 4:132403726-132403748 TTAGTGGGCTGGTTTTGTGTTGG + Intergenic
980536260 4:134127342-134127364 TTAGTACACTGGTTTTGTGTTGG - Intergenic
980761385 4:137238652-137238674 TTAGTGCACCTGTTTTGTGTGGG + Intergenic
983251512 4:165351507-165351529 TTAGTGTGCTGGTTTTGTGTTGG + Intergenic
983582233 4:169320532-169320554 GTAGTTGAGCGGTTTTGAGTGGG - Intergenic
984190565 4:176600946-176600968 TCAGTGCATTGGTTTTGTGTTGG + Intergenic
984234335 4:177137596-177137618 TTAGTGCACTGGTTTTGTGTTGG - Intergenic
985108267 4:186520549-186520571 TGAGTGCGCTGGTTTTGTGTTGG + Intronic
985108269 4:186520584-186520606 TGAGTGCACTGGTTTTGTGTTGG + Intronic
985326394 4:188775890-188775912 TTATTGTACCAGTTTTGTGTTGG + Intergenic
986106328 5:4662761-4662783 CTAGTGCTCAGGTTTTGTGTTGG - Intergenic
986259062 5:6126497-6126519 TTAGTGCACTGGTTTCATGTTGG - Intergenic
987440565 5:17951476-17951498 TTATTGCACTAGTTTTGTGTTGG + Intergenic
987901948 5:24023655-24023677 TTAGTGGGCTGGTTTTGTGTTGG - Intronic
988929592 5:36024097-36024119 TAAATGCACTGGTTTTGTGTTGG - Intergenic
989431502 5:41360809-41360831 TTAATGCATTGGTTTTGTGTTGG + Intronic
989562745 5:42870634-42870656 TTAGTGCACTGGTTTTGTGTTGG + Intronic
989727500 5:44604085-44604107 TAAGTGCACTGGTTTTGTGTTGG - Intergenic
991623036 5:68565890-68565912 TAAGTGCACTGATTTTGTGTTGG - Intergenic
992514505 5:77477519-77477541 GTAGTTGAGCGGTTTTGAGTGGG - Intronic
992599799 5:78387885-78387907 TAAGTACGCTGGTTTTGTGTTGG + Intronic
994034077 5:95178440-95178462 TTAGTGTGCTGGTTTTGTGTTGG - Intronic
994220776 5:97192744-97192766 TTAGTGCACTGGTTTTGTGTTGG + Intergenic
994870944 5:105350359-105350381 TTAGTGTGCTGGTTTTGTGTTGG + Intergenic
996197859 5:120631924-120631946 TTAGTGTGCTGGTTTTGTGTTGG - Intronic
996495262 5:124148366-124148388 TTAGTGCACTGGTTTTATGTTGG + Intergenic
997094982 5:130900376-130900398 GTAGTTGAGCGGTTTTGAGTGGG - Intergenic
998746125 5:145261370-145261392 GTTGTGCACTGGTTTTGTGTTGG - Intergenic
999522743 5:152368754-152368776 TTAGTTCACAATATTTGTGTGGG + Intergenic
1001693728 5:173653839-173653861 TTAGTGCACTGGTTTTGAGTTGG + Intergenic
1004888579 6:20075124-20075146 TTAGTGCCCTGGTTTTGTGTTGG - Intergenic
1005244160 6:23862384-23862406 CTAGTGCACTGGTTTTGTGTTGG - Intergenic
1005691471 6:28311156-28311178 TTATTGCACTAGTTTTGTGTTGG + Intergenic
1007125326 6:39421476-39421498 TTAGTTGACTGGGATTGTGTTGG + Intronic
1007359943 6:41347714-41347736 TTAGGTCACAGGTTTTTTGGGGG + Intronic
1007845346 6:44750270-44750292 GTAGTTGAGCGGTTTTGAGTGGG - Intergenic
1008042236 6:46814995-46815017 TTAGTGTGCTGGTTTTGTGTTGG + Intronic
1008402273 6:51077947-51077969 TTAGTGCGCTGGTTTTGTGTTGG + Intergenic
1008637432 6:53424945-53424967 TTATCTCACAGTTTTTGTGTTGG + Intergenic
1009389658 6:63130616-63130638 TTAGTATGCTGGTTTTGTGTTGG + Intergenic
1009589176 6:65643619-65643641 TCAGTGCACTGGTTTTGTGTTGG - Intronic
1009866963 6:69409428-69409450 GTTGTGCACTGGTTTTGTGTTGG - Intergenic
1010518423 6:76802993-76803015 TTAGTGCACTGGTTTTGTGTCGG + Intergenic
1011156585 6:84340570-84340592 TTATTACACCAATTTTGTGTTGG + Intergenic
1011366077 6:86584325-86584347 TTATTGCACTAGTTTTGTGTTGG + Intergenic
1011375476 6:86681914-86681936 TTAGTGCACTGGTTTTTTGTTGG + Intergenic
1011832266 6:91387896-91387918 TAGGTGCACTGGTTTTGTGTCGG - Intergenic
1011923915 6:92618026-92618048 CTAGTTTTCTGGTTTTGTGTTGG + Intergenic
1012564616 6:100632667-100632689 TTAGTTGACCTTGTTTGTGTGGG - Intronic
1013018155 6:106180108-106180130 ATAGTTCACCTTTTTTGAGTGGG - Intergenic
1013946536 6:115728870-115728892 TAAGTGCACTAGTTTTGTGTTGG + Intergenic
1014481992 6:121950719-121950741 TTAGTGCACTGGTTTTGTGTTGG + Intergenic
1014566607 6:122956615-122956637 TAAGTACACTGGTTTTGTGTTGG - Intergenic
1015644171 6:135368292-135368314 TTAGTGTGCTGGTTTTGTGTTGG + Intronic
1016351708 6:143176251-143176273 TTTGTGCACTGGTTTTGTGTTGG + Intronic
1016485073 6:144528751-144528773 TAAGTTCGCTGGTTTTCTGTTGG + Intronic
1018596778 6:165489137-165489159 TTAGTGCACTGGTTTTGTGTTGG - Intronic
1018755331 6:166843460-166843482 TCAGTGCACTGGTTTTGTGTTGG - Intronic
1019123419 6:169823713-169823735 TTAGTGCAGTGGTTTTATGTTGG + Intergenic
1019123421 6:169823748-169823770 TTAGTGCAGTGGTTTTATGTCGG + Intergenic
1020694425 7:11395987-11396009 GTAGTTGAGCGGTTTTGAGTGGG - Intronic
1023537694 7:41231198-41231220 TTAGTGCGCCGGTTTTGCGTTGG + Intergenic
1024613507 7:51087460-51087482 ATATTCCACCTGTTTTGTGTGGG + Intronic
1024876161 7:54026306-54026328 TAAGTGCGCTGGTTTTGTGTTGG + Intergenic
1024918326 7:54528456-54528478 TTTGTATACTGGTTTTGTGTGGG + Intergenic
1027691645 7:81354317-81354339 TTAGTGTGCTGGTTTTGTGTTGG + Intergenic
1028197793 7:87927151-87927173 TTAGTGTACTGGTTTTGTGTTGG - Intergenic
1028261728 7:88674448-88674470 TAAGTGCTCTGGTTTTGTGTTGG - Intergenic
1029071062 7:97898700-97898722 TTCTTTCATCTGTTTTGTGTTGG - Intergenic
1030972373 7:116075962-116075984 ATAGTGCACTGGTTTTATGTTGG - Intronic
1031090376 7:117347649-117347671 TTAGTGCCCTGGTTTTGTGTTGG + Intergenic
1031576706 7:123423032-123423054 TTAGTGTGCTGGTTTTGTGTTGG - Intergenic
1032448871 7:132009639-132009661 TCAGTGCACTGGTTTTGTGTTGG + Intergenic
1032935749 7:136729490-136729512 TTAGTGCACTGGTTTTATATTGG - Intergenic
1033026887 7:137782682-137782704 TTAGTGCACTGGTTTTGTGTTGG - Intronic
1033262369 7:139854829-139854851 TTAGTTCTCCTGTTTTCTGTAGG + Intronic
1033389503 7:140913011-140913033 TTAGTTCAAAGATTCTGTGTCGG - Intronic
1036887620 8:12570710-12570732 TTCTTTCATCTGTTTTGTGTTGG - Intergenic
1037320770 8:17640726-17640748 TTATTGCACTAGTTTTGTGTTGG + Intronic
1037545193 8:19913290-19913312 GTAGTTGAGCGGTTTTGAGTGGG + Intronic
1039000952 8:32979682-32979704 TTATTGCACTAGTTTTGTGTTGG + Intergenic
1041963324 8:63645916-63645938 TTAGATAAACGTTTTTGTGTGGG - Intergenic
1043556712 8:81439001-81439023 TTATTGCGCTGGTTTTGTGTTGG + Intergenic
1043876380 8:85491408-85491430 TTAGTGTACTGGTTTTGTGTTGG + Intergenic
1046303558 8:112330964-112330986 TTAGTTCTCTGGCTTTATGTAGG + Intronic
1047147894 8:122226193-122226215 TCAGTTGAGCGTTTTTGTGTTGG - Intergenic
1047890381 8:129302650-129302672 TTAGTGTGCTGGTTTTGTGTTGG + Intergenic
1050857042 9:10372308-10372330 TTATTTGACAGGTTTTGAGTAGG + Intronic
1050903510 9:10975026-10975048 TTAGTGCAGTGGTTTTGTATTGG - Intergenic
1051053233 9:12955168-12955190 TTAGTTCGCTGGTTTTGTGTTGG + Intergenic
1051929510 9:22367657-22367679 TTAGTGCACTGCTTGTGTGTTGG - Intergenic
1055156364 9:73067287-73067309 TTAGTGCACTGGTTTTGTGTTGG - Intronic
1057098843 9:92338700-92338722 TTATCTCACCTATTTTGTGTGGG + Intronic
1057475765 9:95399689-95399711 TAAGTGCCCTGGTTTTGTGTTGG - Intergenic
1060559189 9:124528787-124528809 TTATTACACTGGTTTTTTGTTGG - Intronic
1187588897 X:20693756-20693778 TTAGTGTGCTGGTTTTGTGTTGG - Intergenic
1188389311 X:29600473-29600495 TTAGTGCACTGGTTTTGTGTTGG + Intronic
1189567247 X:42255337-42255359 TTAGTGCGTTGGTTTTGTGTTGG - Intergenic
1191026565 X:55919954-55919976 TTAGTGGGCTGGTTTTGTGTTGG - Intergenic
1191223210 X:58013963-58013985 TTAGTGCACTGGTTTTGTGTTGG + Intergenic
1191805087 X:65127452-65127474 TTAGTGCATTGGTTTTGTGTTGG + Intergenic
1191813666 X:65218860-65218882 TAAGTGCACTGTTTTTGTGTTGG - Intergenic
1191820505 X:65300765-65300787 TTAGTTCGGTAGTTTTGTGTTGG - Intergenic
1192596627 X:72415237-72415259 TTAGTTGGCCGTATTTGTGTGGG + Intronic
1192609702 X:72554962-72554984 TAAGTGCACCGGTTTTGTGTTGG - Intronic
1192691177 X:73366616-73366638 TTATTGCACTAGTTTTGTGTTGG + Intergenic
1192950918 X:76015024-76015046 TTAGTGCACTAGTTTTGTGCTGG - Intergenic
1192993913 X:76492289-76492311 TTATTGTACCGGTTTTGTGTTGG + Intergenic
1193007903 X:76642009-76642031 TTATTGCACTAGTTTTGTGTTGG + Intergenic
1193366324 X:80638053-80638075 TTAGTGCACTGGTTTTGTGTTGG - Intergenic
1193469842 X:81887219-81887241 TAAGTGTGCCGGTTTTGTGTTGG + Intergenic
1193937161 X:87637036-87637058 TTAGTATGCTGGTTTTGTGTTGG - Intronic
1193994845 X:88352850-88352872 TTAGTGCACTGGTTTTGTTTTGG - Intergenic
1194381146 X:93192842-93192864 TTAGTTTGCCGGTTTTGTGTTGG - Intergenic
1194470203 X:94285032-94285054 TTAGTTTGCTGGTTTTGTGTTGG + Intergenic
1194516011 X:94854916-94854938 TTAGTGTGCTGGTTTTGTGTTGG - Intergenic
1194601318 X:95924521-95924543 TTAGTGTGCTGGTTTTGTGTTGG - Intergenic
1194967395 X:100304109-100304131 TTAGTGCACTGGCTTTGTGTTGG - Intronic
1195216412 X:102708386-102708408 TTAGTTGACCGTATTTCTGTGGG - Intergenic
1195734419 X:107997868-107997890 TTAGTGCACTGGTTTTGTGTTGG - Intergenic
1195972777 X:110491714-110491736 TCAGTGCACTGGTTTTGTGTAGG + Intergenic
1196389845 X:115195900-115195922 TTAGTTCTCAGGAATTGTGTGGG - Intronic
1196949047 X:120857570-120857592 TTCATGCACTGGTTTTGTGTTGG - Intergenic
1197034610 X:121859084-121859106 TTAGTGTGCTGGTTTTGTGTTGG + Intergenic
1197081702 X:122426203-122426225 TTAGTGCACTGGTTTTGTGTTGG + Intergenic
1197083576 X:122446712-122446734 TTAGTGCACTGGTTTTGTGTTGG - Intergenic
1197364344 X:125545228-125545250 TTAGTCCACTGGTTTTGTGTTGG - Intergenic
1197393301 X:125895346-125895368 TTAGTGCACTGGTTTTGTATTGG + Intergenic
1197545239 X:127816032-127816054 TAAGTGCACTGGCTTTGTGTTGG - Intergenic
1198559864 X:137837965-137837987 TTAGTGCACTGGTTTTGTGTTGG + Intergenic
1199014911 X:142804179-142804201 TTAATACACTGGTTTTGTGTTGG + Intergenic
1199121634 X:144061169-144061191 TTAGTGTGCTGGTTTTGTGTTGG - Intergenic
1200889569 Y:8308990-8309012 GTAGTTGAGCGGTTTTGAGTGGG + Intergenic