ID: 1093604741

View in Genome Browser
Species Human (GRCh38)
Location 12:21076211-21076233
Sequence CCCTATATTCATAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 119}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093604741 Original CRISPR CCCTATATTCATAGGGAAGA AGG (reversed) Intronic
907522053 1:55030330-55030352 CCCTATATCCTTGGGGAAGCAGG - Intergenic
908825921 1:68132497-68132519 CCCTTGTTTCATAGGAAAGATGG - Intronic
923374041 1:233342106-233342128 CTTTATATTCATAGGGAATAAGG + Intronic
924736689 1:246763440-246763462 CCCATTATTTAAAGGGAAGAAGG - Intronic
1068794076 10:61058623-61058645 ATCTATATTCAGATGGAAGATGG - Intergenic
1072703970 10:97666592-97666614 CCCTATTATCATATGGGAGAAGG + Intronic
1074512075 10:114122650-114122672 CCATATATTCAGAGGGCAGAAGG + Exonic
1075864859 10:125709075-125709097 CCCTCTCTTCTTAGGGAAGGCGG - Intergenic
1079146762 11:17859046-17859068 CCATATATCCCTAGGGAGGATGG - Intronic
1080711556 11:34752684-34752706 CATTATACTCATAGGGAAGAGGG + Intergenic
1081852311 11:46282187-46282209 CCCCACATTCTTAGAGAAGAGGG + Intronic
1089774076 11:120824021-120824043 CCCTGCATTAATAAGGAAGATGG - Intronic
1093604741 12:21076211-21076233 CCCTATATTCATAGGGAAGAAGG - Intronic
1094289244 12:28827860-28827882 CCCAATTTTCTTAGTGAAGAGGG + Intergenic
1095555421 12:43498057-43498079 ACCTTTATTCATAGGGAATTTGG - Intronic
1096480301 12:51935861-51935883 CTCTGTGTGCATAGGGAAGAAGG - Intergenic
1097102952 12:56602101-56602123 CTCCATCTTCATAGAGAAGAGGG + Exonic
1100188889 12:92168853-92168875 CCATGAATTCATAAGGAAGAGGG - Intergenic
1101300309 12:103472826-103472848 CCCTGTACCCATGGGGAAGACGG + Intronic
1104451487 12:128872324-128872346 CACTGCATTTATAGGGAAGATGG - Intronic
1108208757 13:48117500-48117522 TCCTAGAATCATTGGGAAGAAGG + Intergenic
1110700921 13:78547676-78547698 CCCTTTATTCAGAGAGAAAATGG + Intergenic
1115079668 14:29435736-29435758 CTGTATACTCATAGGGAAGCTGG - Intergenic
1116055188 14:39855102-39855124 TCCAATTTTCATAGAGAAGAGGG + Intergenic
1118160386 14:63283504-63283526 CCCTATATTCATACTAAATATGG - Intronic
1119272069 14:73315728-73315750 CCCAATATTCACAGGGAAATAGG - Intronic
1120015406 14:79467586-79467608 CCCTATATACATGGGGAAGAAGG - Intronic
1120424424 14:84329218-84329240 CCCTATATCATTAGTGAAGAAGG + Intergenic
1125330584 15:38578239-38578261 CTCTATATTCACAGAGAACATGG - Intergenic
1126119026 15:45234650-45234672 CCCTTTGTTCTTAGGGCAGATGG + Intergenic
1126178836 15:45765276-45765298 CCTTATATTCAAAGGCAAGTAGG - Intergenic
1126272089 15:46831785-46831807 CTCAAGATTCATAGGGCAGAAGG + Intergenic
1127112345 15:55688222-55688244 CCATAAAATAATAGGGAAGAAGG - Intronic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1135300952 16:21326710-21326732 ACCTTTATCCAAAGGGAAGAGGG - Intergenic
1137467690 16:48725829-48725851 CCACATTTTCATTGGGAAGATGG - Intergenic
1137844168 16:51670816-51670838 CCCTATTTTAATTGTGAAGAGGG + Intergenic
1138302595 16:55944919-55944941 CCCTATACTCAAGGGAAAGAAGG + Intronic
1139100477 16:63760644-63760666 CTCTTTGTTCTTAGGGAAGATGG - Intergenic
1141684608 16:85563105-85563127 CCGTGTATTCGAAGGGAAGAGGG + Intergenic
1148292089 17:46461760-46461782 CCTTATATTATTGGGGAAGATGG + Intergenic
1148314278 17:46679455-46679477 CCTTATATTATTGGGGAAGATGG + Intronic
1149291675 17:55223941-55223963 CCCTTTATTCCCAGAGAAGAAGG + Intergenic
1152384833 17:79966184-79966206 ACCCATATACAGAGGGAAGAAGG - Intronic
1153885055 18:9457214-9457236 GCCAATATTCATGGGGAAAATGG - Intergenic
1153905523 18:9658258-9658280 CACTCTATTAATATGGAAGAAGG + Intergenic
1156704473 18:39862759-39862781 CCCTATGTTCACAGGGAAACTGG - Intergenic
1157870450 18:51225708-51225730 GCCTCTACTCTTAGGGAAGAAGG - Intergenic
1160037512 18:75315582-75315604 ACCTATATTCAGTGGGAAAAAGG + Intergenic
1164726705 19:30470152-30470174 GCCAAAAATCATAGGGAAGATGG - Intronic
1166238222 19:41471873-41471895 CACAATATTCAGAGGGAAAAAGG - Intergenic
926008118 2:9388559-9388581 CTATATATTCACAGGGATGACGG - Intronic
926199556 2:10784467-10784489 CCGTATAATCATAGGTACGAAGG - Intronic
926970427 2:18462292-18462314 CACTTTCTTCATAGGGATGATGG + Intergenic
928665876 2:33550318-33550340 CTCTATCTTCATAAGCAAGATGG - Intronic
930668831 2:54126264-54126286 AACTATATTCATAAGGAAGTAGG + Intronic
935319833 2:101875690-101875712 CCCTACATTCCTAGGGAATTGGG - Intronic
935545264 2:104394557-104394579 CGCTATATTCAAAGGCAAGGAGG - Intergenic
935576952 2:104720767-104720789 TCCCATATTCCTAGGAAAGAAGG + Intergenic
936025211 2:109026501-109026523 CCCTTGCTTCAGAGGGAAGAGGG - Intergenic
940597195 2:155810318-155810340 TGTAATATTCATAGGGAAGAAGG - Intergenic
940701744 2:157053300-157053322 CCCTAGATTAATATGAAAGATGG - Intergenic
941119339 2:161510863-161510885 CCCTAAATTAATAGAAAAGATGG - Intronic
945262941 2:207861705-207861727 CTCTATGTTCTTGGGGAAGATGG - Intronic
947393636 2:229665757-229665779 CCATCTTTGCATAGGGAAGAAGG + Intronic
948301501 2:236910797-236910819 GCCTGTTTTCATAGGGCAGATGG + Intergenic
1171394255 20:24821282-24821304 CCCTATGTCCACAGGGAAGTGGG + Intergenic
1172287725 20:33752954-33752976 GCCTACTTTCATAGGGAAAAGGG + Intronic
1177296337 21:19181147-19181169 CTCTTTGTTCTTAGGGAAGATGG + Intergenic
956951305 3:74286636-74286658 ACCAATATTCAAAGGGAAAAAGG + Intronic
957813772 3:85264001-85264023 TACTTTATTCATAGGGAAAATGG + Intronic
957935840 3:86941106-86941128 ACATATATTTAAAGGGAAGATGG - Exonic
965631802 3:170740817-170740839 CACTATATACAAAGGAAAGAAGG + Intronic
969878784 4:10156072-10156094 CCCTATAGTCCTAGGGAGGAAGG - Intergenic
969922911 4:10557527-10557549 CCCTAGATGCAGAGGGATGAGGG - Intronic
970866848 4:20769028-20769050 CCCTCTAACCATATGGAAGAAGG + Intronic
972182356 4:36484282-36484304 CTTTATATTCATGGGGAATATGG - Intergenic
972256437 4:37360804-37360826 CTGCATATTTATAGGGAAGAGGG + Intronic
974827573 4:67150848-67150870 CCCTCTGTTCATTGGCAAGATGG + Intergenic
975931923 4:79534830-79534852 CCCTATATCCACTAGGAAGAAGG + Intergenic
979266888 4:118714122-118714144 CTCTATATTAATAGAGAAGCAGG + Exonic
980052151 4:128049416-128049438 CCCTACACTCCTAGGGAACAGGG - Intergenic
980669856 4:135990927-135990949 CCTTATATTCATAGGTAATTGGG - Intergenic
984745756 4:183215030-183215052 CCCTTTATTCATAGGGCATATGG + Intronic
987910471 5:24137240-24137262 CCATATCCTCATAGGGCAGAGGG - Intronic
987921513 5:24287691-24287713 ACCTCTATTCATAAGGGAGATGG + Intergenic
988369995 5:30356310-30356332 GTCTATATTCAAAGGGAAAATGG - Intergenic
991277411 5:64865626-64865648 CCTTATTTTTAGAGGGAAGATGG + Intronic
991608349 5:68425568-68425590 CCCAATAATAAAAGGGAAGAGGG + Intergenic
992635910 5:78725902-78725924 CCCAATATTCTTTGTGAAGAAGG + Intronic
994726893 5:103446656-103446678 CCCTATCTTCTTAGTTAAGAGGG + Intergenic
997685699 5:135786226-135786248 TCGTATATTCAGAGGGGAGAGGG + Intergenic
1000911491 5:167028162-167028184 CCCTTTATTCATGGGAATGATGG - Intergenic
1004996798 6:21201127-21201149 CCCTGCGTTCATGGGGAAGATGG + Exonic
1007289259 6:40772826-40772848 TCCCATTTTCATAGGGAAGAGGG - Intergenic
1007909401 6:45498380-45498402 ACCTATCTTGATAGGGATGAAGG - Intronic
1013123003 6:107157449-107157471 CCCTATAATTAAAGGGGAGAAGG - Intronic
1016294678 6:142562278-142562300 CTCTATTCTCACAGGGAAGAGGG + Intergenic
1022806827 7:33830893-33830915 CCCCATTTTTATAGGGATGAGGG + Intergenic
1023828372 7:44024756-44024778 CCCAAAAGCCATAGGGAAGAGGG + Intergenic
1025724306 7:64043534-64043556 TTCAACATTCATAGGGAAGAGGG + Intronic
1025753219 7:64311455-64311477 TTCAACATTCATAGGGAAGAGGG - Intronic
1025934729 7:66026402-66026424 GCCCATATTCAAGGGGAAGAGGG - Intergenic
1027993149 7:85389843-85389865 AACTATATTCATTGGTAAGAGGG - Intergenic
1028192236 7:87866880-87866902 CTCTTTGTTCTTAGGGAAGATGG - Intronic
1028496711 7:91469466-91469488 CCCTATATACATCGGGAACTGGG - Intergenic
1029774612 7:102677272-102677294 CCCAAAAGCCATAGGGAAGAGGG + Intergenic
1037583209 8:20258794-20258816 CCCCAGATCCATAGGGATGATGG - Intronic
1038039860 8:23715415-23715437 CCCTATATTCAGTGGGCACAAGG - Intergenic
1040610313 8:48977069-48977091 CCCGGTATTCCTAGGGGAGACGG - Intergenic
1045847280 8:106652679-106652701 CCCTAGTTTCATAAGGCAGAAGG - Intronic
1046551584 8:115724402-115724424 ACCTATATTTATAGGCAAAATGG - Intronic
1046608797 8:116401749-116401771 CCCTAAATTACTGGGGAAGAGGG - Intergenic
1048110366 8:131461498-131461520 CCCTAATCTCTTAGGGAAGATGG - Intergenic
1048277604 8:133078801-133078823 ACCTATATTCAGAGGACAGACGG + Intronic
1055902707 9:81259319-81259341 CCCTATATTCTTATGGAGAATGG + Intergenic
1060709413 9:125843096-125843118 ACCTGTATTCACAGAGAAGAAGG - Intronic
1187916136 X:24153739-24153761 CTCTATATTCACAGTGTAGAAGG - Intronic
1188233925 X:27702418-27702440 ATCTATATTCATAAGGAATATGG - Intronic
1190626301 X:52341573-52341595 CACTATGTTCATAGACAAGAAGG - Intergenic
1192684933 X:73293914-73293936 CCCTAAAGACATAGGGAAAATGG + Intergenic
1195793169 X:108612361-108612383 CCCTATATTCATAGATGACATGG + Intronic
1196628071 X:117901102-117901124 CCCTATAATGCTAAGGAAGAAGG + Intronic
1201663803 Y:16426801-16426823 ATCTATATATATAGGGAAGAAGG - Intergenic
1202254761 Y:22909422-22909444 CCTTCTATTCAGAGGGATGATGG + Intergenic
1202407752 Y:24543171-24543193 CCTTCTATTCAGAGGGATGATGG + Intergenic
1202463029 Y:25126910-25126932 CCTTCTATTCAGAGGGATGATGG - Intergenic