ID: 1093607236

View in Genome Browser
Species Human (GRCh38)
Location 12:21107421-21107443
Sequence CTTGCTAGGTCCCATCTAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 52}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093607236_1093607242 4 Left 1093607236 12:21107421-21107443 CCTATTAGATGGGACCTAGCAAG 0: 1
1: 0
2: 0
3: 3
4: 52
Right 1093607242 12:21107448-21107470 ACTGTATATCAGGTAAGAAAGGG 0: 1
1: 0
2: 4
3: 21
4: 261
1093607236_1093607240 -6 Left 1093607236 12:21107421-21107443 CCTATTAGATGGGACCTAGCAAG 0: 1
1: 0
2: 0
3: 3
4: 52
Right 1093607240 12:21107438-21107460 AGCAAGTGGGACTGTATATCAGG 0: 1
1: 0
2: 0
3: 3
4: 124
1093607236_1093607243 5 Left 1093607236 12:21107421-21107443 CCTATTAGATGGGACCTAGCAAG 0: 1
1: 0
2: 0
3: 3
4: 52
Right 1093607243 12:21107449-21107471 CTGTATATCAGGTAAGAAAGGGG 0: 1
1: 0
2: 2
3: 38
4: 427
1093607236_1093607241 3 Left 1093607236 12:21107421-21107443 CCTATTAGATGGGACCTAGCAAG 0: 1
1: 0
2: 0
3: 3
4: 52
Right 1093607241 12:21107447-21107469 GACTGTATATCAGGTAAGAAAGG 0: 1
1: 0
2: 2
3: 8
4: 165
1093607236_1093607245 9 Left 1093607236 12:21107421-21107443 CCTATTAGATGGGACCTAGCAAG 0: 1
1: 0
2: 0
3: 3
4: 52
Right 1093607245 12:21107453-21107475 ATATCAGGTAAGAAAGGGGGTGG 0: 1
1: 0
2: 0
3: 15
4: 292
1093607236_1093607244 6 Left 1093607236 12:21107421-21107443 CCTATTAGATGGGACCTAGCAAG 0: 1
1: 0
2: 0
3: 3
4: 52
Right 1093607244 12:21107450-21107472 TGTATATCAGGTAAGAAAGGGGG 0: 1
1: 0
2: 2
3: 27
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093607236 Original CRISPR CTTGCTAGGTCCCATCTAAT AGG (reversed) Intronic
900828862 1:4949583-4949605 CTTCCTAGGCCACATCTGATGGG - Intergenic
918891602 1:190279385-190279407 CTTTCTATGTCCCATCACATAGG + Intronic
920620863 1:207544874-207544896 CTGCCCATGTCCCATCTAATAGG - Intronic
920622645 1:207563430-207563452 CTGCCCATGTCCCATCTAATAGG - Intronic
922916791 1:229264372-229264394 CTGGGTGGGCCCCATCTAATCGG + Intergenic
924472420 1:244354253-244354275 CTTGCTAGTTTTCATTTAATTGG + Intronic
1068223375 10:54072747-54072769 CATGGGAGGTCCCATCTAATAGG + Intronic
1070789134 10:79179339-79179361 CTAACTAGGTCCCATCTGAGTGG - Intronic
1079067705 11:17311549-17311571 CTAGCTAGGTTATATCTAATAGG + Intronic
1092411791 12:8258606-8258628 CTTCCTAGGTCCCAGGAAATGGG - Intergenic
1093187903 12:16042721-16042743 GTTTCTTGGTCCCATATAATAGG + Intergenic
1093607236 12:21107421-21107443 CTTGCTAGGTCCCATCTAATAGG - Intronic
1097227155 12:57484377-57484399 CTAGTTAGGGCCCCTCTAATGGG - Intronic
1102287828 12:111673641-111673663 ATAGTTAGATCCCATCTAATGGG + Intronic
1116747029 14:48833281-48833303 CTTGATAAGTCCAATCCAATGGG - Intergenic
1117850265 14:59960327-59960349 TTTGCCAGGTCTCATCTATTTGG - Intronic
1125281482 15:38046417-38046439 ATTGCTAGATCTCATCTCATCGG - Intergenic
1138047530 16:53741472-53741494 GTTCCTAGGTAACATCTAATGGG - Intronic
1139931363 16:70529395-70529417 CTTTCTACTTCCCATCTAGTTGG + Intronic
1143621379 17:8082276-8082298 CTTACTAGGTCCCAGGTATTGGG + Intronic
1146715933 17:35087370-35087392 TCTGCTTGGTACCATCTAATAGG - Intronic
1156409960 18:36818156-36818178 CTTCCTAGATCCCATCTACCTGG + Intronic
1157010957 18:43648033-43648055 CTTGCTGGGTCCCCCCAAATTGG - Intergenic
1158226864 18:55210483-55210505 CTTGTTAGGTCCCAGACAATGGG + Intergenic
1161640614 19:5420401-5420423 CTGGGCAGGTCCCATCTTATAGG - Intergenic
1163962611 19:20711412-20711434 CTTGCTCTGTCCCATGTTATAGG + Intronic
932370887 2:71186793-71186815 CTTGTTAGGTCACATGTCATAGG - Exonic
937262997 2:120598288-120598310 TTTGCTAGCACCCATCTCATGGG + Intergenic
946574768 2:221062909-221062931 CTGCCTAGGTACAATCTAATAGG - Intergenic
1173111668 20:40196742-40196764 CTTGGTAGGTATCATCTAGTTGG + Intergenic
1174077370 20:47947476-47947498 CTTGCTGGGTTCCATCCACTTGG + Intergenic
954872531 3:53778645-53778667 CTTGCAAGTTCCCATCCATTGGG + Intronic
957231233 3:77518483-77518505 CTTGTTATGTCCCATCACATTGG - Intronic
981386473 4:144137472-144137494 CTTGCTAGCTGCTATTTAATTGG - Intronic
981720399 4:147796225-147796247 CTTGCTGGGTCCCATGCAATAGG + Intronic
984111738 4:175625647-175625669 CTTGCTATGTGCCATGTAATAGG + Intergenic
987533070 5:19145706-19145728 CTGGCTAGGTAACATTTAATAGG - Intergenic
987882273 5:23763465-23763487 CTTCCTAGCTTCCATCAAATTGG + Intergenic
988587233 5:32517910-32517932 CTTTCCAGGTCCCATATAGTTGG - Intergenic
990741568 5:58917746-58917768 CTTGGATGATCCCATCTAATTGG - Intergenic
994435601 5:99727538-99727560 CTAGATAGCTCCCATCTAGTCGG + Intergenic
1001761732 5:174213515-174213537 CTTTCTATTTGCCATCTAATTGG + Intronic
1002809668 6:615404-615426 ATTGCTTGGACTCATCTAATTGG - Intronic
1013254069 6:108366361-108366383 CTTGTTAGTTTCCACCTAATTGG - Intronic
1015917708 6:138234213-138234235 CTTCCCAGGTGCCATCTACTTGG - Intronic
1016402010 6:143691034-143691056 ATTGCTGGGTCCCATATTATAGG + Intronic
1019163457 6:170084170-170084192 GATGCTAGGACCCATCTCATAGG - Intergenic
1021894264 7:25219412-25219434 CTTGTTAGCTCCCATTTATTGGG + Intergenic
1028910197 7:96199264-96199286 TTTGGTAGGTCCCCTCTAAAAGG - Intronic
1036120182 8:6008379-6008401 CTTGCCAAGTCCAATCAAATTGG - Intergenic
1037369039 8:18153685-18153707 CTGGGTGGGTACCATCTAATCGG + Intergenic
1041266637 8:56072113-56072135 CTTGTTAAGTCCCAGCTACTAGG + Intronic
1049271662 8:141699312-141699334 CTGGGCAGGTCTCATCTAATTGG + Intergenic
1050842492 9:10170286-10170308 CTGGCAAGGTCCCTTCTGATGGG + Intronic
1053515373 9:38726021-38726043 CTTCCTAGGTCTCATCTGTTAGG - Intergenic
1185982458 X:4794756-4794778 CTTGCTTGGTCCAATGGAATTGG + Intergenic