ID: 1093607952

View in Genome Browser
Species Human (GRCh38)
Location 12:21117182-21117204
Sequence ACTCAATGAACACTACCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 415
Summary {0: 1, 1: 0, 2: 3, 3: 47, 4: 364}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093607952_1093607953 -10 Left 1093607952 12:21117182-21117204 CCTTGGGGTAGTGTTCATTGAGT 0: 1
1: 0
2: 3
3: 47
4: 364
Right 1093607953 12:21117195-21117217 TTCATTGAGTTAAATTTGCTTGG 0: 1
1: 0
2: 63
3: 388
4: 856

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093607952 Original CRISPR ACTCAATGAACACTACCCCA AGG (reversed) Intronic
900124484 1:1063376-1063398 ACTCAATGAGCCCTCCCCAAGGG - Intergenic
906027421 1:42685242-42685264 ATTCAATGAACAGTATCTCATGG - Intronic
907023410 1:51090865-51090887 ACCCAATTAAGACTAACCCAAGG + Intergenic
908175379 1:61550846-61550868 ACTCAAATAAGACTACCTCAAGG - Intergenic
909271774 1:73630817-73630839 ACCCAAAGAAGACTACCTCAAGG + Intergenic
909316424 1:74225009-74225031 ACCCAAAGAAGACTACCTCAAGG + Intronic
911274507 1:95844563-95844585 ACTCACTAGACAATACCCCATGG - Intergenic
911343760 1:96672492-96672514 ACCCAAAGAAGACTACCTCAAGG - Intergenic
912242854 1:107928927-107928949 ACCCAAAGAAGACTACCTCAAGG + Intronic
912640611 1:111342097-111342119 ACTCAAATAAGACTACCCCAAGG + Intergenic
912644136 1:111374632-111374654 ACTCCAGGAAGACTACCTCAAGG + Intergenic
912798856 1:112708319-112708341 ACTCAATGAACATTTCTCGAGGG + Intronic
913377972 1:118175386-118175408 ACACAAATAAGACTACCCCAAGG + Intronic
913408617 1:118525180-118525202 ATTCAAATAAGACTACCCCAAGG - Intergenic
913416680 1:118617052-118617074 ACCCAAAGAAGACTACCTCAAGG - Intergenic
916220532 1:162440386-162440408 ACTCAAATAAGACTACCCCAAGG - Intergenic
916369285 1:164072376-164072398 ACCCAAGGAAGACTACCTCAAGG - Intergenic
917226239 1:172786905-172786927 ACCCAAAGAAGACTACCTCAAGG - Intergenic
917396444 1:174599793-174599815 ACCCAAAGAAGACTACCTCAGGG - Intronic
918229775 1:182517341-182517363 ACCCAAATAAGACTACCCCAAGG - Intronic
919477947 1:198053038-198053060 ACCCAAAGAAGACTACCTCAAGG - Intergenic
920048913 1:203151578-203151600 ACTCAATGAACAGTAGCACCAGG - Intronic
920594753 1:207257982-207258004 ACTCAAAGAAGACTATCTCAAGG - Intergenic
922394267 1:225180076-225180098 ACTCAAATAAGACTACCCCAAGG - Intronic
922642882 1:227253012-227253034 ACTGAATGAACACTACAAAACGG + Intronic
923960225 1:239073069-239073091 ACCCAAAGAAGACTACCTCAAGG + Intergenic
924792700 1:247268050-247268072 ACCCAAAGAAGACTACCTCAAGG + Intergenic
1065426751 10:25614107-25614129 ACTCAAAGAAGACTACTTCAAGG - Intergenic
1065461033 10:25965069-25965091 ACCCAAAGAAGACTACCTCAAGG - Intronic
1066142795 10:32524847-32524869 ACCCAAAGAAGACTACCTCAAGG - Intronic
1066148655 10:32590951-32590973 ACCCAAAGAAAACTACCTCAAGG - Intronic
1068999392 10:63246241-63246263 ACCCAAATAAGACTACCCCAAGG + Intronic
1069611788 10:69777878-69777900 ACACAAAGAAAACTACACCAAGG + Intergenic
1071180615 10:82979194-82979216 AATCAATGAATAAAACCCCAAGG - Intronic
1071869553 10:89779474-89779496 ACTCAAAGAAGACTACCTCAAGG - Intergenic
1072115330 10:92365232-92365254 ACCCAAAGAAGACTACCTCAAGG - Intergenic
1072853558 10:98923360-98923382 ACCTAAAGAAGACTACCCCAAGG - Intronic
1072862874 10:99024595-99024617 ACCCAAAGAAGACTACCTCAAGG + Intronic
1074970866 10:118536067-118536089 AATAAATCAACACTACCACAGGG - Intergenic
1075195121 10:120349770-120349792 ACCCAAAGAAGACTACCTCAAGG + Intergenic
1076717917 10:132375842-132375864 ACTCAGTGGACTCCACCCCAGGG + Exonic
1077427655 11:2491747-2491769 ACCCAAAGAAGACTACCTCAAGG + Intronic
1077827130 11:5823106-5823128 ACTCAGTGAAAACTTGCCCATGG - Intronic
1077835647 11:5924897-5924919 ACCCAAAGAAGACTACCTCAAGG + Intronic
1078636304 11:13053596-13053618 ACACAATGAAAACAACCACATGG - Intergenic
1079183725 11:18216966-18216988 ACTCAAAGAACACTACCTCAAGG + Intronic
1079558365 11:21790467-21790489 ACACAATGAAAACTACCTCAAGG - Intergenic
1080084038 11:28257355-28257377 ACCCAAAGAAGACTACCTCAAGG - Intronic
1080707035 11:34705945-34705967 ACCCAAAGAAGACTACCTCAAGG - Intergenic
1082823923 11:57564125-57564147 ACCCAAAGAAGACTACCTCAAGG + Intronic
1083285250 11:61654587-61654609 ATTCAATGGACACTTCCCCATGG - Intergenic
1083512596 11:63225597-63225619 ACCCAAAGAAGACTACCTCAAGG - Intronic
1085192449 11:74639756-74639778 ACTCACTGAACCCTTCCCAAGGG - Intronic
1085814559 11:79723578-79723600 ACCCAATGAAGACTATCTCAAGG + Intergenic
1086007170 11:82050387-82050409 ACCCAAAGAAGACTACCTCAAGG + Intergenic
1086068940 11:82777537-82777559 ACCCAAAGAAGACTACCTCAAGG + Intergenic
1086828421 11:91528235-91528257 ACCCAAGGAAAACTACCTCATGG + Intergenic
1087245941 11:95837025-95837047 AATCAATGATTCCTACCCCAAGG + Intronic
1087492216 11:98843271-98843293 ACCCAAAGAATACTACCTCAAGG - Intergenic
1087692166 11:101333643-101333665 ACACAATGCAAACTACACCAAGG - Intergenic
1088570170 11:111215051-111215073 ACCCAAAGAAGACTACCTCAAGG + Intergenic
1089192751 11:116665978-116666000 ACCCAAATAAGACTACCCCAAGG + Intergenic
1089946688 11:122481299-122481321 ACACAAAGAAGACTACCTCAAGG + Intergenic
1090111371 11:123912674-123912696 ACCCAAAGAAGACTACCTCATGG + Intergenic
1090318114 11:125815677-125815699 ACCCAAAGAAGACTACCTCAGGG - Intergenic
1091967007 12:4753132-4753154 ACCCAAAGAAAACTACCTCAAGG - Intronic
1093607952 12:21117182-21117204 ACTCAATGAACACTACCCCAAGG - Intronic
1094165640 12:27440019-27440041 ACCCAAATAAAACTACCCCAAGG + Intergenic
1094657998 12:32439640-32439662 ACCCAAAGAAGACTACCTCAAGG - Intronic
1095133834 12:38573610-38573632 ACCCAAAGAAGACTACCTCAAGG + Intergenic
1095150136 12:38784547-38784569 ACCCAAAGAAGACTACCTCAAGG + Intronic
1095181523 12:39152495-39152517 ACTCAAAGAAGATTACCTCAAGG - Intergenic
1095227768 12:39697041-39697063 ACCCAAAGAAGACTACCTCAAGG + Intronic
1097889424 12:64762086-64762108 ACTCAAAGATCACTTCCTCAGGG - Intergenic
1098142702 12:67467532-67467554 ACCCAAAGAAGACTACCTCAAGG - Intergenic
1098736415 12:74111298-74111320 ACCCAAAGAAGACTACCTCAAGG - Intergenic
1099435395 12:82636101-82636123 ACTCAAATAAGACTACCACAAGG + Intergenic
1099992458 12:89738594-89738616 ACCCAAAGAAGACTACCCCAAGG + Intergenic
1101337907 12:103813080-103813102 AATCAATGAACACTGCCACTGGG + Intronic
1101463419 12:104921302-104921324 ACCCAAATAAGACTACCCCAAGG + Intronic
1102318144 12:111906626-111906648 ACCCAAAGAAGACTACCTCAAGG + Intergenic
1103000366 12:117381254-117381276 AATCAATGAACACAAGTCCAAGG - Intronic
1104330179 12:127837263-127837285 AGTCAATCAACACTGACCCAGGG + Intergenic
1104795766 12:131516390-131516412 ACCCAAATAAAACTACCCCAAGG + Intergenic
1105336203 13:19472138-19472160 ACTCAAAGAAGACTACCTCAAGG - Intronic
1107083763 13:36404091-36404113 ACCCAAAGAAGACTACCTCAAGG - Intergenic
1107228359 13:38077910-38077932 ACCCAATGAAGACCACCTCAAGG + Intergenic
1107549266 13:41459116-41459138 TCACAATGGAGACTACCCCAGGG + Intronic
1108631502 13:52288098-52288120 ACTCAAAGAAGACTACCTCAAGG - Intergenic
1108655189 13:52524497-52524519 ACTCAAAGAAGACTACCTCAAGG + Intergenic
1109022573 13:57117513-57117535 ACCCAAAGAAGACTACCTCAAGG - Intergenic
1110020624 13:70465202-70465224 AATTAATAAACATTACCCCATGG - Intergenic
1110388549 13:74944450-74944472 ACACAAAGAAGACTACCTCAAGG + Intergenic
1110974353 13:81809930-81809952 ACCCAAAGAAGACTACCTCAAGG + Intergenic
1111542921 13:89691414-89691436 ACCCAAAGAAGACTACCTCAAGG + Intergenic
1112770176 13:102786769-102786791 AATGAATGAACACTGCCCCATGG + Intronic
1114836849 14:26212620-26212642 GCTGAATGAACAGTACCCTATGG + Intergenic
1115134071 14:30087966-30087988 ACCCAAAGAAGACTACCTCAAGG + Intronic
1116021451 14:39467360-39467382 ACCCAAAGAATACTACCTCAAGG - Intergenic
1116724976 14:48552342-48552364 ACCCAAAGAAGACTACCTCAAGG - Intergenic
1118006461 14:61568292-61568314 ACAGACTGAACTCTACCCCAGGG - Intronic
1119096614 14:71838865-71838887 ACCCAAAGAAGACTACCTCAAGG - Intergenic
1120439489 14:84518881-84518903 ACTCAAAGAAGACTACCTGAGGG - Intergenic
1121376143 14:93412459-93412481 ACCCAAAGAAGACTACCTCAAGG + Intronic
1122476359 14:102012570-102012592 ACACAATGATCACTACTCCATGG - Intronic
1124142892 15:27093019-27093041 AGTCACTGAACCCTACCCCACGG + Intronic
1125002496 15:34786023-34786045 ACAGAAAGAAAACTACCCCAAGG - Intergenic
1125044311 15:35229016-35229038 ACCCAAGGAAGACTACCTCAGGG - Intronic
1126294822 15:47128226-47128248 ACCCAAAGAAGACTACCTCAAGG - Intergenic
1126571945 15:50162242-50162264 ACTCAGAGAAGACTACCTCAAGG - Intronic
1126708580 15:51430747-51430769 ACGCAAAGAAGACTACCTCAGGG + Intergenic
1126716895 15:51527064-51527086 ACTCAAAGAAGACTACCTCGAGG + Intronic
1127012626 15:54646346-54646368 ACCCAAAGAAGACTACCTCAGGG + Intergenic
1127022466 15:54763743-54763765 ACCCAAAGAAGACTACCTCAAGG + Intergenic
1127155560 15:56121492-56121514 ACCCAAAGAAGACTACCTCAAGG - Intronic
1127406769 15:58657157-58657179 ACCCAATGAAGACTAACTCAAGG - Intronic
1127463369 15:59220688-59220710 ACTGAATGAACACTACTGAAAGG - Intronic
1127493466 15:59486579-59486601 ACTCAAAGAAGACCACCTCATGG + Intronic
1128313567 15:66646438-66646460 ACGCACTGACCACTATCCCAGGG - Intronic
1128565649 15:68699156-68699178 TCTCACTGACCACCACCCCAGGG - Intronic
1129501305 15:76040089-76040111 ACCCAAAGAAGACTACCTCAAGG + Intronic
1130867041 15:87942065-87942087 ACCAAAAAAACACTACCCCAAGG - Intronic
1131959189 15:97770623-97770645 ACATAATGAAAACTACCCTAGGG + Intergenic
1133666757 16:7975683-7975705 ACTCAATGAACACTGATACATGG + Intergenic
1135051089 16:19193754-19193776 ACTCAGTGTAGCCTACCCCAGGG + Intronic
1137376870 16:47959232-47959254 GCTCAATGATCACTTCCTCAAGG + Intergenic
1138974149 16:62183427-62183449 CCACAAAGAAGACTACCCCAAGG - Intergenic
1140646447 16:77036841-77036863 ACCCAAAGAAGACTACCTCAAGG - Intergenic
1143431428 17:6889912-6889934 ACCCAAAGAAAACTACCTCAAGG - Intronic
1152909546 17:82992225-82992247 ACCCAAAGAAGACTACCTCAAGG + Intronic
1154143300 18:11844692-11844714 ACTCAATGCAGACTAGCCCTGGG + Intronic
1155068048 18:22285574-22285596 ATTCAATCAACAGTATCCCATGG - Intergenic
1156369441 18:36459465-36459487 ACCCAATAACAACTACCCCAAGG - Intronic
1156625099 18:38899338-38899360 AGCCAATGAACAACACCCCATGG - Intergenic
1157022560 18:43804279-43804301 ACCCAAAGAAAACTACCTCAAGG - Intergenic
1160264092 18:77323788-77323810 ACTCAATAAACACTTGCCAAGGG + Intergenic
1162194325 19:8972599-8972621 ACTCAATCAACAGCACCCAAAGG - Exonic
1162611056 19:11753410-11753432 ACCCAAGGAAGACTACCTCAAGG - Intergenic
1162666585 19:12218722-12218744 ACTCAAAGAAGACTACCTCAAGG - Intergenic
1162692636 19:12446672-12446694 ACCCAAAGAAGACTACCTCAAGG - Intronic
1164862658 19:31574733-31574755 ACTCAATGCAGACTTCCCCATGG + Intergenic
1166408076 19:42537663-42537685 ACACAAAGAAGACTACCTCAAGG - Intronic
926971118 2:18468472-18468494 CCTCCATGGCCACTACCCCAGGG - Intergenic
929498132 2:42464725-42464747 GCTCAAGGATCACCACCCCAGGG + Intronic
930095506 2:47563122-47563144 ACTTACTGAACACTTACCCAAGG + Intronic
930230508 2:48839512-48839534 ACCCAAAGAAGACTACCTCAAGG - Intergenic
930743634 2:54859058-54859080 ACTCAGTGAACACTAACCCCAGG - Intronic
931161773 2:59700825-59700847 ACCCAAAGAAGACTACCTCAAGG - Intergenic
932858595 2:75265352-75265374 ACCCAAAGAAGACTACCTCAAGG - Intergenic
936778048 2:115997699-115997721 ACCCAAAGAAGACTACCTCAAGG - Intergenic
939144695 2:138398028-138398050 ACTCAAAGAAGACTACCTCAAGG + Intergenic
939172601 2:138712801-138712823 ACTCCATGAAGACTAGACCAAGG + Intronic
939257029 2:139757940-139757962 ACCCAAAGAAGACTACCCCAAGG - Intergenic
939443021 2:142274434-142274456 ACCCAAAGAAGACTACCTCAAGG - Intergenic
939707726 2:145476434-145476456 ACTCAAAGAAGACTACCTCAAGG - Intergenic
939930284 2:148225917-148225939 ACCCAAAGAAGACTACCCTAAGG - Intronic
940503591 2:154525877-154525899 ACCCAAAGAAGACTACCTCAAGG - Intergenic
940795577 2:158073513-158073535 ACTCAAGGAAGACTACCTCAAGG + Intronic
941477199 2:165964695-165964717 ACCCAAATAACACTACCCCAAGG - Intergenic
941745778 2:169085960-169085982 ACCCAAAGAAGACTACCACAAGG - Intronic
942349095 2:175034257-175034279 ACCCAAAGAAGACTACCTCAAGG - Intergenic
943857762 2:192819956-192819978 ACTCAAATAAGACTATCCCAAGG + Intergenic
944095866 2:195967809-195967831 ACCCAAAGAAGACTACCTCAAGG - Intronic
944760632 2:202810016-202810038 ACCCAAAGAAGACTACCTCAAGG + Intronic
945211007 2:207381933-207381955 ACCCAAAGAAGACTACCTCAAGG + Intergenic
945575839 2:211527119-211527141 ACCCAAAGAAGACTACCTCAAGG + Intronic
947008964 2:225545155-225545177 ACCCAAAGAAAACTACCTCATGG - Intronic
947335859 2:229082363-229082385 ACTCACTGACCTTTACCCCATGG + Intronic
947686964 2:232096386-232096408 ACTAAAAGAAAACTACCCCAAGG - Intronic
947892885 2:233641973-233641995 ACCCAAAGAAAACTACCTCAAGG - Intronic
948937279 2:241175208-241175230 ACTCACTGTACACTTCCACATGG - Intronic
1170086778 20:12542906-12542928 ACCCAAAGAAGACTACCTCAGGG - Intergenic
1170863365 20:20129527-20129549 ACTCAAATAAGACTCCCCCAAGG - Intronic
1172825864 20:37785230-37785252 ACCCAAAGAAGACTACCTCAAGG - Intronic
1172935098 20:38614568-38614590 AGTCACTGAACACTTACCCAAGG + Intronic
1174831621 20:53818766-53818788 ACCCAAAGAAAACTACCTCAAGG - Intergenic
1176737352 21:10562929-10562951 ACTCAAAGAAGACTACCTCAAGG + Intronic
1180563354 22:16640466-16640488 ACTCAAAGAAGACTACCTCAAGG + Intergenic
1182855242 22:33511294-33511316 ACTCAATAAATATTACCACATGG - Intronic
1183531771 22:38359668-38359690 ACTCAAAGAAGACTACCTCAAGG - Intronic
949235508 3:1804566-1804588 ACCCAATGAAGATTACCTCAAGG - Intergenic
951107765 3:18765528-18765550 ACTCTATAAACTCTAGCCCAGGG - Intergenic
951171975 3:19553227-19553249 ACCCAAAGAAGACTACCTCAAGG - Intergenic
951423302 3:22512444-22512466 ACTCAAAGAAGACTACCTGAAGG + Intergenic
952066269 3:29575467-29575489 ACCCAAAGAAGACTACCTCAAGG - Intronic
952149250 3:30568610-30568632 ACTCAAAGAAGACTACCTCAAGG + Intergenic
952222151 3:31333771-31333793 ACTCAAAAAAGACTACCTCAAGG + Intergenic
952725920 3:36584135-36584157 ACCCAAAGAAGACTACCTCAAGG + Intergenic
952968331 3:38634706-38634728 TCTCAATCCACACTTCCCCAGGG - Intronic
958052083 3:88361586-88361608 ACTCAAATAAGACTACCTCAAGG - Intergenic
958613331 3:96456408-96456430 ACTCAAATAAGACTACCCCAAGG + Intergenic
958617707 3:96516337-96516359 ACTCAAAGAAGACTACCTCTAGG + Intergenic
959118322 3:102204565-102204587 ACCCAAAGAAGACTACCTCAAGG - Intronic
960200112 3:114823283-114823305 TCTCATTGTACACTACTCCAGGG - Intronic
960214278 3:115011328-115011350 ACCCAAAGAAGACTACCTCAGGG + Intronic
960749088 3:120926514-120926536 ACTCAAATAGGACTACCCCAAGG - Intronic
960870179 3:122240062-122240084 ACCCAAAGAAGACTACCTCAAGG + Intronic
961121823 3:124378887-124378909 ACACAAAGAAAACTACACCAAGG - Intronic
962078555 3:132112973-132112995 ACCCAAAGAAGACTACCTCAAGG - Intronic
962638636 3:137359985-137360007 ACTCAAACAAAACTACCTCAAGG - Intergenic
963365221 3:144325278-144325300 ACCCAAAGAAGACTACCTCAAGG + Intergenic
963448233 3:145441674-145441696 ACTCAAAGAAAACTTCCTCAAGG + Intergenic
963515486 3:146302830-146302852 ACTCGAAGAAGACTACCTCAAGG + Intergenic
963591972 3:147271330-147271352 ACTCAAAGAAGACTACCTCAAGG + Intergenic
966312822 3:178613790-178613812 ACCCAAAGAAGACTACCTCAAGG - Intronic
966337317 3:178883070-178883092 ACCCAAAGAAAACTACCTCAAGG + Intergenic
967549424 3:190773129-190773151 ACCCAAAGAACTCTACCCCAAGG - Intergenic
968378940 4:71959-71981 ACTCAATGACCACCCTCCCAAGG - Intronic
970071038 4:12160540-12160562 CCTCAAAGAAGACTGCCCCAAGG - Intergenic
970156541 4:13148015-13148037 ACTGAATGAACATTTCCACATGG - Intergenic
970693606 4:18648064-18648086 ACCCAAAGAAGACTACCTCAAGG + Intergenic
971891628 4:32530768-32530790 ACTCAAAAAAGACTACCTCAAGG + Intergenic
972237286 4:37149336-37149358 ACCCAAAGAAGACTACCTCAAGG - Intergenic
972278258 4:37579742-37579764 ACCCAAAGAAGACTACCTCAAGG - Intronic
972468496 4:39381938-39381960 ACTCAAAGAAGACTACCTCAAGG - Intergenic
972851787 4:43058926-43058948 ACCCAAAGAAGACTACCTCAAGG + Intergenic
972856715 4:43115699-43115721 ACCCAAAGAAGACTACCTCAAGG + Intergenic
972928607 4:44042349-44042371 ACCCAAAGAAGACTACCACAAGG + Intergenic
973852932 4:54978980-54979002 ACCCAAAGAACACTATCTCAAGG + Intergenic
974586389 4:63884397-63884419 ACCCAAAGAAGACTACCTCAAGG - Intergenic
974593098 4:63981813-63981835 ACTCAATGAAGACTACCTGAAGG - Intergenic
974867755 4:67601813-67601835 ACTCAAAGAAGACTACTTCAAGG - Intronic
974893071 4:67905802-67905824 ACCCAAAGAAGACTACCTCAAGG - Intergenic
975335654 4:73172097-73172119 ACCCAAAGAAGACTACCCCAAGG + Intronic
975629942 4:76389636-76389658 ACTCAAAGAAGACTATCTCAAGG + Intronic
976045995 4:80948569-80948591 ACTCAAAGCAAACTATCCCATGG - Intronic
976453761 4:85222111-85222133 ACCCAAAGAAGACTACCTCAAGG - Intergenic
977084921 4:92582356-92582378 ACTCACTTAACACTATTCCAAGG + Intronic
977166752 4:93709547-93709569 ACCCAAAGAATACTACCTCAAGG - Intronic
977399361 4:96511681-96511703 ACTCAAAGAAGACTACCTCAAGG + Intergenic
977805308 4:101290810-101290832 AATCAATGAATACCACCTCATGG + Intronic
977854897 4:101877225-101877247 ACCCAAAGAAGACTACCTCAAGG + Intronic
978212498 4:106155321-106155343 ATTCAAAGAAGACTACCTCAAGG - Intronic
978520223 4:109607857-109607879 ACCCAAAGAAGACTACCTCAAGG - Intronic
979213107 4:118131038-118131060 ACTCAAAGAAGACTAACTCAAGG - Intronic
980035179 4:127875111-127875133 ATTCAATGAAAACCACACCAAGG - Intergenic
980443173 4:132873156-132873178 ACACAAAGAAGACTACCTCAAGG + Intergenic
980769317 4:137351068-137351090 ACTCACTGAACAAGACCCCGTGG - Intergenic
980956364 4:139433022-139433044 ACCCAAAGAAGACTACCTCAAGG - Intergenic
981159498 4:141480848-141480870 ACTCAAATTGCACTACCCCAAGG - Intergenic
981886402 4:149678201-149678223 ACTCAAATAAGACTACTCCATGG + Intergenic
982340020 4:154286885-154286907 ACCCAAAGAAGACTACCTCAAGG + Intronic
983860904 4:172705938-172705960 ACCCAAATAAAACTACCCCAAGG - Intronic
983931970 4:173462228-173462250 ACCCAAAGAAGACTACCTCAAGG + Intergenic
984529543 4:180900132-180900154 ACCCAAAGAAGACTACCTCAAGG - Intergenic
986657399 5:10029080-10029102 ACCCAAAGAAGACTACCTCAAGG - Intergenic
988955915 5:36318834-36318856 ACCCAAAGAAGACTACCTCAAGG + Intergenic
988956191 5:36322700-36322722 ACCCAAAGAAGACTACCTCAAGG - Intergenic
990828117 5:59924405-59924427 ACCCAAAGAAGACTACCTCAAGG + Intronic
990900131 5:60740805-60740827 ACCCAAAGAAGACTACCTCAAGG + Intergenic
991107295 5:62859482-62859504 TCCCAAAGAACACTACCTCAAGG - Intergenic
991626857 5:68611357-68611379 ACACCATGAACACCACCCAAGGG + Intergenic
993078503 5:83267166-83267188 ACTCAAAGAACACTTCCTCCTGG - Intronic
993919685 5:93785630-93785652 TCTCAATGAATACTACCTAATGG + Intronic
993981454 5:94547384-94547406 ACCCAAAGAAGACTACCTCAAGG + Intronic
994162179 5:96569020-96569042 ACTCCAGGAACACAAACCCATGG + Intronic
994627973 5:102244564-102244586 ACCCAAAGAAGACTACCTCAAGG + Intronic
994656473 5:102600107-102600129 CCTAACTGAACACTCCCCCAAGG + Intergenic
994854003 5:105092626-105092648 ACCCAAAGAAGACTACCTCAAGG + Intergenic
995265518 5:110154346-110154368 ACTCAAAGAAGACTACCTCAAGG + Intergenic
995557779 5:113346747-113346769 ACCCAAAGAAGACTACCTCAAGG + Intronic
996982659 5:129518655-129518677 ATTCAAAGAAGACTACCTCAAGG - Intronic
997783403 5:136683025-136683047 GCTCAATGAATACTTTCCCATGG + Intergenic
997829335 5:137135636-137135658 ACTCAATGATCACTACTCTGAGG + Intronic
999664194 5:153895630-153895652 ACTCAATGAACACTTCCAAATGG + Intergenic
999919339 5:156301976-156301998 ACCCAAAGAAGACTACCTCAAGG - Intronic
999948903 5:156627317-156627339 TCTCAAAAAACCCTACCCCAAGG - Intronic
1001177844 5:169488440-169488462 ACCCAAAGAAGACTACCTCATGG + Intergenic
1003079687 6:3011620-3011642 ACTCAAATAGGACTACCCCAAGG + Intronic
1003708564 6:8563103-8563125 ACTCAATGACATCTACCCCAAGG + Intergenic
1003719257 6:8682108-8682130 GCTCAAAGAACTTTACCCCATGG + Intergenic
1004333085 6:14739250-14739272 ACCTAATGAGCACCACCCCAAGG - Intergenic
1008215269 6:48780157-48780179 ACTGAAGGAAGACTACCTCAAGG + Intergenic
1008250187 6:49230547-49230569 ACCCAAAGAAGACTACCTCAAGG - Intergenic
1009200103 6:60734382-60734404 ACTCATTTAACACAAGCCCAAGG - Intergenic
1009373359 6:62937068-62937090 ACCCAAAGAAGACTACCTCAAGG - Intergenic
1010320735 6:74505851-74505873 ACTGAAAGAAGACTACTCCAAGG + Intergenic
1010626453 6:78141274-78141296 ACTCAAAGAAGACTACCTCAAGG + Intergenic
1010975687 6:82311129-82311151 ACCCAAAGAAGACTACCTCAAGG - Intergenic
1011280217 6:85669971-85669993 AATCTATGAACCCTACCCCTAGG - Intergenic
1011322662 6:86114412-86114434 ACTCAAAGAAGACTATCTCAAGG - Intergenic
1011498226 6:87959388-87959410 ACTCAAAGAAAACTATGCCAAGG - Intergenic
1011508171 6:88071008-88071030 ACCCAAATAAGACTACCCCAAGG - Intergenic
1011756784 6:90508095-90508117 ACCCAAATAAGACTACCCCAAGG - Intergenic
1011901529 6:92303829-92303851 ACCCAAAGAAGACTACCTCAAGG + Intergenic
1012712583 6:102627405-102627427 ACTCAAGTAAGACTACCTCAAGG - Intergenic
1012714591 6:102652178-102652200 ACCCAAAGAAGACTACCTCAAGG + Intergenic
1012761801 6:103311477-103311499 ACTCAAAGAAGACTACCTCAAGG + Intergenic
1012892295 6:104909899-104909921 ACCCAAAGAAGACTACCTCAAGG + Intergenic
1016315149 6:142777008-142777030 CCTCATTGAACACTCCCCTAAGG - Intronic
1016615267 6:146040712-146040734 ACCCAAATAAGACTACCCCAAGG - Intronic
1016643327 6:146376742-146376764 ACCCAAAGAAGACTACCTCAAGG - Intronic
1017613874 6:156223006-156223028 ACCCAAAGAAGACTACCGCAAGG + Intergenic
1020573191 7:9891871-9891893 ACCCAAAGAAGACTACCTCAAGG + Intergenic
1021026147 7:15669168-15669190 ACTCAATGAAAACTACTGAAAGG + Intronic
1021771663 7:24008719-24008741 ATTCAAATAAGACTACCCCAAGG - Intergenic
1022541836 7:31144801-31144823 ACCCAAAGAAAACTACCTCAAGG - Intergenic
1025017484 7:55450459-55450481 ACTCAATGCACACTTCCACTTGG - Intronic
1027405166 7:77853045-77853067 ACCCAAAGAAGACTACCTCAAGG - Intronic
1028052028 7:86200301-86200323 ACACAATGAACACTAACTGATGG - Intergenic
1030408119 7:109141202-109141224 ACCCAAAGAATACTACCTCAAGG - Intergenic
1030599197 7:111573298-111573320 ACCCAAAGAAGACTACCTCAAGG + Intergenic
1030815123 7:114026070-114026092 GTTCAATGAACTGTACCCCAGGG + Intronic
1031169488 7:118274682-118274704 ACCCAAATAAAACTACCCCAAGG - Intergenic
1031746354 7:125504045-125504067 ACTGAAAGAAGACTACCTCAAGG - Intergenic
1032431037 7:131861746-131861768 ACTCAATGAACACCAAGCAACGG + Intergenic
1032517841 7:132520075-132520097 ACCCAGTGAACACCACCCCTGGG - Intronic
1033899095 7:146114536-146114558 ACTCAATGAATGCTATTCCATGG - Intergenic
1036814789 8:11893859-11893881 ACCCAAAGAAGACTACCTCAAGG - Intergenic
1039927725 8:41952930-41952952 ACTCAAAGAACCCTATCCAATGG + Intronic
1040421291 8:47242637-47242659 GATAAATGAACACTTCCCCAGGG + Intergenic
1041681196 8:60594100-60594122 AACAAATGAACACTACCTCAGGG + Intronic
1043600403 8:81929994-81930016 ACCCAAAGAAGACTACCTCAAGG + Intergenic
1044878150 8:96693387-96693409 ACCCAAAGAAGACTACCTCAAGG + Intronic
1044929305 8:97236514-97236536 ACTCAGGGAACTATACCCCAAGG - Intergenic
1045159662 8:99524403-99524425 ACCCAAGGAAGACTACCTCAAGG + Intronic
1045800857 8:106098729-106098751 ACCCAAAGAACATTACCTCAAGG + Intergenic
1046267840 8:111854666-111854688 ACCCAAAGAAGACTACCTCAAGG + Intergenic
1046783504 8:118241055-118241077 AATCAATGAATACTATCCCAGGG - Intronic
1050578565 9:7026554-7026576 ACCCAAAGAAGACTATCCCAAGG - Intronic
1050914127 9:11109590-11109612 ACCCAAAGAAGACTACCTCAAGG + Intergenic
1051047363 9:12890495-12890517 ACCCAAAGAAGACTACCTCAAGG + Intergenic
1051454973 9:17245510-17245532 ACCCAAAGAAAACTACCTCAAGG - Intronic
1051469537 9:17422347-17422369 ACCCAAAGAAGACTACCTCAAGG - Intronic
1051581801 9:18684190-18684212 ACTCATTCAGTACTACCCCAAGG - Intronic
1051992247 9:23165100-23165122 ACCCAAAGAAGACTACCTCAAGG + Intergenic
1053028193 9:34749382-34749404 ACCCAAAGAAGACTACCTCAAGG + Intergenic
1055579789 9:77696690-77696712 ACCCAAAGAAGACTACCTCAAGG - Intergenic
1055886301 9:81067947-81067969 ACCCAAAGAAGACTACCTCAAGG - Intergenic
1055891695 9:81130790-81130812 AGTCAATGAATTCTACCCCTGGG - Intergenic
1056007535 9:82287983-82288005 ACCCAAAGAAGACTACCTCAAGG + Intergenic
1056337648 9:85590602-85590624 AATAAATGAACCCTACCCTAGGG + Intronic
1057039521 9:91837548-91837570 ACTTTATGAACACTACCCAAAGG + Intronic
1057241178 9:93410973-93410995 ACCCAAAGAATACTACCTCAAGG + Intergenic
1059132772 9:111771882-111771904 ACCCAAATAAGACTACCCCAAGG - Intronic
1059839268 9:118193553-118193575 ACTCAAATAAGACTACCTCAAGG + Intergenic
1060328863 9:122645459-122645481 ACACAAAGAAGACTCCCCCAAGG + Intergenic
1060965129 9:127707936-127707958 ACTCAGTGAGCACCAGCCCATGG - Intronic
1061402470 9:130375973-130375995 ACTCACTGAGCACTTCCACATGG - Intronic
1061481469 9:130899457-130899479 ATTGAATGAACAGTCCCCCATGG - Intergenic
1061915389 9:133749980-133750002 ACCCAAAGAAAACTACCTCAAGG - Intergenic
1186562046 X:10622908-10622930 ACTCAATGAACATTCTCCAAAGG - Intronic
1187618524 X:21025521-21025543 ACCCAAAGAAGACTACCTCAAGG - Intergenic
1187637023 X:21240096-21240118 ACCCAAAGAAGACTACCTCAAGG + Intergenic
1187941333 X:24385436-24385458 ACTCAAATAAGACTGCCCCAGGG - Intergenic
1188192133 X:27184055-27184077 ACCCAAAGAAGACTACCGCAAGG + Intergenic
1188742809 X:33807354-33807376 ACCCAAAGAAGACTACCTCAAGG - Intergenic
1188815138 X:34704150-34704172 ACTCAAAGTAGACTACCTCAAGG - Intergenic
1188846116 X:35074899-35074921 ACCCAAAGAAGACTACCTCAAGG - Intergenic
1188942992 X:36263362-36263384 ACTCAAAGAAGACTATCTCAAGG - Intronic
1188974466 X:36656796-36656818 ACTCAAGGAAGACTATCACAAGG - Intergenic
1189657792 X:43265350-43265372 ACTCAAAGAAGACTACCTCGAGG - Intergenic
1189870207 X:45373246-45373268 ACCCAAAGAAGACTACCTCAAGG + Intergenic
1189881314 X:45496512-45496534 ACTCAAAGAAAACCACCTCATGG - Intergenic
1189885049 X:45534162-45534184 ACCCAAAGAAAACTACCTCAAGG + Intergenic
1190015320 X:46821487-46821509 ACCCAAAGAAGACTACCCCAAGG + Intergenic
1190374147 X:49773131-49773153 ACCCAAAGAACACTACCTCAAGG - Intergenic
1190599929 X:52080514-52080536 ACTCAAGTAAAACTACCCAAGGG + Intergenic
1190899228 X:54652643-54652665 ACCCAAAGAAGACTACCTCAAGG + Intergenic
1190907717 X:54744842-54744864 ACCCAAAGAAGACTACCTCAAGG - Intergenic
1191052566 X:56210506-56210528 ACTCAAAGAAGACTACCTCAAGG - Intergenic
1191800092 X:65069094-65069116 ACCCAAAGAAGACTACCTCAAGG - Intergenic
1191801109 X:65080402-65080424 ACTGAAAGAAGACTACCTCAAGG + Intergenic
1191827091 X:65377441-65377463 ACCCAAAGAAGCCTACCCCAAGG + Intronic
1191923359 X:66280729-66280751 ACTGAATGAACAGTGTCCCAGGG + Intergenic
1191973981 X:66849944-66849966 ACCCAAAGAAGACTACCTCAAGG - Intergenic
1192073349 X:67963935-67963957 ACCCAAAGAAGACTACCTCAAGG + Intergenic
1192135229 X:68590798-68590820 ACCCAAAGAAGACTACCTCAAGG + Intergenic
1192299763 X:69887607-69887629 ACTCAAAGAAGAATACTCCAAGG + Intronic
1192839007 X:74834772-74834794 ACCCAAAGAAGACTACCTCAAGG - Intronic
1192927303 X:75768697-75768719 ACCCAAAGAAGACTACCTCAAGG + Intergenic
1193153272 X:78146938-78146960 ACCCAAAGAAGACTACCTCAAGG - Intergenic
1193178311 X:78421775-78421797 ACTCAAGTAAGACCACCCCAAGG + Intergenic
1193192991 X:78595313-78595335 ACTCAAAGAAGACCACCTCAAGG - Intergenic
1193194672 X:78618133-78618155 ACCCAAAGAAGACTACCTCAAGG - Intergenic
1193232790 X:79067797-79067819 ATTCAAATAAGACTACCCCAAGG - Intergenic
1193243129 X:79196277-79196299 ACTCAAGGAAGACTACCTCAAGG + Intergenic
1193488160 X:82113875-82113897 ACTCAAAGAAGACTACCTAAAGG - Intergenic
1193596257 X:83450038-83450060 ACCCAAAGAAAACTACCTCAAGG - Intergenic
1193670457 X:84377928-84377950 ACCCAAAGAAGACTACCTCAAGG + Intronic
1194157713 X:90414041-90414063 ACCCAAAGAATACTACCTCAAGG - Intergenic
1194371045 X:93072052-93072074 ACCCAAAGAAGACTACCTCAAGG + Intergenic
1194389325 X:93296361-93296383 ACACAAAGAAGACTACCTCAAGG + Intergenic
1194415642 X:93607923-93607945 ACTCAAAGAAGACTACCTCAAGG + Intergenic
1194553359 X:95329008-95329030 ACTCAAAGAACACTACCTCAAGG - Intergenic
1194780635 X:98021741-98021763 ACCCAAAGAAGACTACCTCAAGG - Intergenic
1194783675 X:98056406-98056428 ACCCAAAGAAGACTACCTCAAGG - Intergenic
1194929237 X:99866506-99866528 ACCCAAAGAAGACTACTCCAAGG + Intergenic
1194954638 X:100164897-100164919 ACCCAAAGAAGACTACCTCAAGG - Intergenic
1195122766 X:101773508-101773530 ACCCAAAGAAGACTACCTCAAGG - Intergenic
1195132291 X:101865106-101865128 ACTCAAAGAAGACTACCCCAAGG + Intergenic
1195136383 X:101910952-101910974 ATTCAAAGACGACTACCCCAAGG + Intronic
1195584544 X:106550594-106550616 ACCCAAAGAAGACTACCTCAAGG + Intergenic
1195797965 X:108673435-108673457 AGTCAATTAACACTAACCAAGGG + Intronic
1196399280 X:115297722-115297744 ACCCAAAGAAGACTACCTCAAGG - Intronic
1196486900 X:116222325-116222347 ACTCAAAGAAGACTACCTCAAGG - Intergenic
1196508738 X:116479771-116479793 ACTCAAAGAAGATTACCTCAAGG + Intergenic
1196537195 X:116861234-116861256 ACCCAAAGAAGACTACCTCATGG - Intergenic
1196922302 X:120596431-120596453 ACCCAAAGAAGACTACCTCAAGG + Intronic
1197360933 X:125503205-125503227 ACCCAAAGAAGACTACCTCACGG - Intergenic
1197544638 X:127809946-127809968 ATTCAAAGAAAACTACCTCAAGG + Intergenic
1197623368 X:128777550-128777572 ACCCAAGGAAGACTACCACAAGG - Intergenic
1197953331 X:131920728-131920750 ACCCAAAGAAGACTACCTCAAGG + Intergenic
1198430618 X:136563168-136563190 ACACAAAGAAAACTACCTCAAGG - Intergenic
1198785288 X:140281821-140281843 ACTCAAAGAAGTCTACCTCAAGG - Intergenic
1198841199 X:140860097-140860119 ACCCAAAGAAGACTACCTCAAGG + Intergenic
1199135504 X:144245184-144245206 ACCCAAAGAAGACTACCTCAAGG + Intergenic
1199316238 X:146381027-146381049 ACCCAAAGAAGACTACCTCAAGG + Intergenic
1199341771 X:146687374-146687396 ACCCAAAGAAGACTACCTCAAGG - Intergenic
1199843817 X:151676238-151676260 ACCCACTAAACCCTACCCCAAGG - Exonic
1200295679 X:154917413-154917435 ACCCAAATAAGACTACCCCAAGG - Intronic
1200416145 Y:2912392-2912414 ATTCAAAGAAGTCTACCCCAAGG + Intronic
1200504045 Y:3991016-3991038 ACCCAAAGAATACTACCTCAAGG - Intergenic
1200678843 Y:6183941-6183963 ACCCAAAGAAGACTACCTCAAGG + Intergenic
1202595617 Y:26536210-26536232 ACTCAAAGAAGACTACCTCAAGG + Intergenic