ID: 1093609731

View in Genome Browser
Species Human (GRCh38)
Location 12:21138837-21138859
Sequence CTGTGGTTTCATGTGTCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 332}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093609731 Original CRISPR CTGTGGTTTCATGTGTCTGC AGG Intronic
900913506 1:5618649-5618671 CTGTTGTTGGCTGTGTCTGCTGG - Intergenic
901473432 1:9473223-9473245 CTGGGGTGTGATGTGTCAGCAGG + Intergenic
904060000 1:27701480-27701502 GTGTGGTTTCATTAATCTGCTGG - Intergenic
908205603 1:61845077-61845099 CTGTGGTTTCAGGTATCTGCTGG + Intronic
908484385 1:64576275-64576297 CTTTGTTTTCTTCTGTCTGCAGG + Intronic
910415884 1:86997676-86997698 CTGTGGTTTCAGGCATCTACTGG - Intronic
910632731 1:89373045-89373067 GCGTTTTTTCATGTGTCTGCTGG - Intronic
911905633 1:103565110-103565132 CTGTGGTTTCAGGCACCTGCTGG - Intronic
913097519 1:115533693-115533715 CAGAGGTTTCATCTGCCTGCAGG + Intergenic
913418154 1:118635375-118635397 CTGTGATTTTATTTGTCTTCAGG + Intergenic
916475202 1:165162426-165162448 TTGTGGTTTTATGTCACTGCAGG + Intergenic
916652827 1:166846745-166846767 CTGTGTTTTCCTTTGTCTCCTGG + Intronic
916894615 1:169149483-169149505 ATGTGGTTTCAGGTATCCGCTGG - Intronic
916968561 1:169981628-169981650 CTGTAGTTTCAGGCATCTGCTGG + Intronic
917628203 1:176866976-176866998 GTGTAGTTTCATTAGTCTGCAGG - Intronic
920280331 1:204838674-204838696 CTGTGGTGTCAGATGTTTGCAGG + Intronic
920541041 1:206778160-206778182 CTGTGGTTTGCAGTGTCTGCCGG - Intergenic
921561569 1:216665287-216665309 CTGTGGTTTCAGGTATCCTCTGG + Intronic
924248841 1:242110669-242110691 GTGTGGTGGCATGTGCCTGCAGG + Intronic
924689801 1:246335696-246335718 CTGTGCTTTCATTTGTCCCCTGG + Intronic
1063313885 10:4983169-4983191 CTGCGCTCTCATGTGTGTGCAGG - Exonic
1064248002 10:13684539-13684561 CTGTCCTTCCATGTGTCTGCCGG - Intronic
1064769514 10:18709767-18709789 CTGTGGTTTCAGGTATCCACTGG - Intergenic
1065754501 10:28918851-28918873 CTCTGGAGTCATGTGTCTTCTGG + Intergenic
1067369581 10:45671060-45671082 GTGTTTTTTCATGTGTCTGTTGG - Intronic
1068628298 10:59272839-59272861 CTGTGGTTTCAGGTGTCCACTGG - Intronic
1069128125 10:64663756-64663778 GTCTGGTTTCATTTTTCTGCAGG + Intergenic
1070267668 10:74920030-74920052 CTGTAGTTTCTTGTTTCTGCTGG + Intronic
1071500665 10:86201958-86201980 TTGTGGGTTCATGAGTCTTCAGG + Intronic
1072353070 10:94577532-94577554 GTCAGGTTTTATGTGTCTGCTGG + Intronic
1073253548 10:102136706-102136728 CTGTGGTTTCAGGCATCTACTGG + Intronic
1074677486 10:115868516-115868538 CTGTGATATCAGGTGTGTGCTGG - Intronic
1076811997 10:132891392-132891414 CTCTGTTTTCATGTGGATGCTGG - Intronic
1078066613 11:8082942-8082964 GTGTGACTACATGTGTCTGCAGG - Intronic
1079641563 11:22811522-22811544 CTTTGGTTTAATGTGTCTGGAGG - Intronic
1080925556 11:36752542-36752564 CTGTGGTCCTATGTCTCTGCTGG + Intergenic
1081017076 11:37895381-37895403 CTCTGGTTTCTTGTGTTTTCTGG + Intergenic
1081279181 11:41187394-41187416 CTGTGGTCTGCTGGGTCTGCTGG - Intronic
1081399720 11:42628892-42628914 CTGTGCTTATGTGTGTCTGCTGG + Intergenic
1081550864 11:44110719-44110741 ATGCGATTTCATTTGTCTGCAGG + Intronic
1083743148 11:64721786-64721808 CTGTTTTTTCATGTGTTGGCGGG - Intronic
1083745856 11:64736146-64736168 CTGTGGTTTGATCTGTGCGCTGG - Intronic
1084621881 11:70277444-70277466 TTGTTGTTTCATGTTTCTGCCGG + Intronic
1085864497 11:80273486-80273508 CTTTTTTTTCATGTGTCTGTTGG - Intergenic
1086128467 11:83375180-83375202 CTTTGATTGCCTGTGTCTGCAGG + Intergenic
1086895849 11:92311840-92311862 CCCTGGTTTAATGTGTCAGCAGG + Intergenic
1087907462 11:103715289-103715311 CTATGTTTTAAAGTGTCTGCAGG + Intergenic
1090154110 11:124419525-124419547 CTGTGATTTCAGGTATCTACTGG - Intergenic
1090856865 11:130617462-130617484 CTGTGGTTTCAGGCATCTGCTGG + Intergenic
1091756468 12:3055710-3055732 GCGTGCTTTCATGTGTCTCCAGG - Intergenic
1092312753 12:7375726-7375748 CTGTGGATACAAGTGTCTTCCGG + Exonic
1092507859 12:9123206-9123228 CTGTGGTTTCAGGTGTCCACTGG - Intergenic
1093337165 12:17920547-17920569 CTGTGGTTTCAGATGCCTGTGGG - Intergenic
1093609731 12:21138837-21138859 CTGTGGTTTCATGTGTCTGCAGG + Intronic
1094067456 12:26376634-26376656 CTTTGGTTTAATATCTCTGCAGG + Intronic
1094818942 12:34210204-34210226 CTGGGCTTGCATGTGTCTTCAGG + Intergenic
1095628922 12:44351386-44351408 CTTTGGTTTCCTGTGTTTGCAGG + Intronic
1096096204 12:48937350-48937372 CTGTGGGCTCCTGTGTGTGCTGG - Exonic
1097437463 12:59569002-59569024 CTGTTGTTTCAGTTGCCTGCTGG + Intergenic
1098032423 12:66268235-66268257 ATGTAGTGGCATGTGTCTGCTGG - Intergenic
1098182202 12:67859967-67859989 CTGTGTTTTCATGTGGCGGAAGG + Intergenic
1098617654 12:72549258-72549280 ATGTGGTAACATGTGTATGCAGG + Intronic
1099472867 12:83073106-83073128 CTGTGTTTTGATGTGTTTCCAGG + Intronic
1101575151 12:105990444-105990466 CTGAGGTTTGAAGTGTCTGAAGG - Intergenic
1102029938 12:109734460-109734482 CTGGGGTTTCCTGTCTCTCCCGG + Intronic
1102896349 12:116601439-116601461 GGGTGGTTCCATGTGTCTGGTGG + Intergenic
1105586365 13:21748164-21748186 CTCTGTTTTCATGTGTTTCCTGG - Intergenic
1107282122 13:38748903-38748925 CTGTGCATGCATGTGTGTGCAGG + Intronic
1108859105 13:54831309-54831331 CTTTGGTTGCCTGTGTTTGCTGG - Intergenic
1109282990 13:60378782-60378804 CAGTGGTTTCTTGTATCTCCAGG + Intergenic
1110181862 13:72626492-72626514 CTGTGATTTGATCTGTCTTCAGG - Intergenic
1111560190 13:89934585-89934607 CCATGGTTTCATGTATCTCCTGG + Intergenic
1112623911 13:101080261-101080283 ATGTGGTTCCATGTGGCTGCTGG - Intronic
1112843265 13:103606293-103606315 CTGTGGTTTGAGGTCTCTGGCGG - Intergenic
1117110845 14:52452795-52452817 CTGTGGTTGCCTGTGCCTGTGGG - Intronic
1119211255 14:72833830-72833852 CTATGTTTTCATGTGTCTATTGG - Intronic
1119306328 14:73610885-73610907 CTCTGGGGTCATGTGACTGCTGG - Intergenic
1119912754 14:78365445-78365467 CTGTTTTTTCATTTGTCAGCTGG - Intronic
1121952519 14:98183976-98183998 CTTTGGGATCAAGTGTCTGCGGG + Intergenic
1122682380 14:103475591-103475613 CTGTGTTGTCATGTGGCTGAAGG + Intronic
1122887556 14:104717185-104717207 CTGTGCTCTCAGGTGTCTGTGGG - Intronic
1122965577 14:105123489-105123511 CTGTGGTCTTTTGTGTCTGATGG - Intergenic
1124168182 15:27347901-27347923 CTGTGGTTGCAGTTGTCTGATGG + Intronic
1124419694 15:29510129-29510151 GTTTGTTTTCATGTGTTTGCTGG - Intronic
1125092654 15:35812537-35812559 TTGTAGTTTCAGGTGTCTGTAGG - Intergenic
1125256699 15:37772221-37772243 CTGTGGTTGAATGTGTCTCTGGG + Intergenic
1126418598 15:48446471-48446493 CTGTGGTTTCAGGCATCTGCTGG + Intronic
1128433296 15:67620491-67620513 CTGTGGTTTCATTTATCTATTGG - Intronic
1128436726 15:67658823-67658845 TTCTAGTTTCATGTGTTTGCAGG + Intronic
1128592168 15:68909202-68909224 CTGTGGTTCCAATGGTCTGCAGG + Intronic
1128999070 15:72318449-72318471 CTGTGCTTTCAAGTTTTTGCTGG - Intronic
1129683476 15:77671482-77671504 CTGTGTCATCATGTGTCTGAAGG - Intronic
1130264773 15:82390424-82390446 GTGTTTTTTCATGTGTCTGTTGG + Intergenic
1130507211 15:84556449-84556471 GTGTTTTTTCATGTGTCTGTTGG - Intergenic
1131294807 15:91137960-91137982 CTGTTTTTTCATTTGTCAGCTGG - Intronic
1131467338 15:92666342-92666364 CTGGGGTTTCAGGAGTCTCCTGG + Intronic
1131719070 15:95147588-95147610 GAGTGGTTTTATGTGTCTGGAGG - Intergenic
1132528525 16:431143-431165 GTGTGGGAGCATGTGTCTGCAGG + Intronic
1133177931 16:4029864-4029886 GTGTCTTTTCATATGTCTGCTGG - Intronic
1138932026 16:61670717-61670739 CCATGGTTTCATGTATCTCCTGG - Intronic
1139212078 16:65088151-65088173 CTGTGTCTTCATGTGGCTGAAGG - Intronic
1139286588 16:65820509-65820531 CTGTGGTTTCAAGCATCTACTGG - Intergenic
1139365745 16:66432517-66432539 CAGGGGTTTCATGGATCTGCGGG - Intronic
1139902611 16:70340165-70340187 CTATGGCTTTATTTGTCTGCTGG + Intronic
1139975408 16:70806260-70806282 CTGTGGTTTCAGGCATCTACTGG + Intergenic
1140667349 16:77239786-77239808 CTCTGGGTTCATGTGTTGGCTGG - Intergenic
1141063348 16:80895169-80895191 CTGTTGTTTCTTTGGTCTGCAGG - Intergenic
1141951003 16:87339348-87339370 CTGTGGATTCATGCATCAGCTGG - Intronic
1141983421 16:87563910-87563932 GTGTGTGTTCATGTGTGTGCTGG + Intergenic
1142009225 16:87705285-87705307 CTGTGGTCTGCTCTGTCTGCCGG - Intronic
1143429471 17:6870214-6870236 GTGTGTTGTCATGTGTCTGTAGG - Intergenic
1144303513 17:13946020-13946042 GTGTGCGTGCATGTGTCTGCAGG + Intergenic
1144776303 17:17786666-17786688 CAGAGGTGTCAAGTGTCTGCAGG - Intronic
1146674979 17:34767206-34767228 CTGTGGTTTCAGGTATCTCTGGG - Intergenic
1150592969 17:66579294-66579316 CTGTGGTGTGATGTGTAAGCTGG + Intronic
1150870022 17:68897033-68897055 CTGTGGTTTCAGGCATCTGCTGG + Intronic
1151925881 17:77196082-77196104 CTGCGGTTTCATGTGCCTCTAGG + Intronic
1152209709 17:78996553-78996575 CTTTGGTTTCATGTTACTGAAGG - Intronic
1152273235 17:79337905-79337927 CTTCTGTTTCATGTGTTTGCTGG + Intronic
1153181017 18:2433483-2433505 CTGTGGTTTCATTACTCTGCCGG - Intergenic
1154121570 18:11656580-11656602 CTCTGGTCTCATGTGTGTGGGGG + Intergenic
1154408034 18:14114167-14114189 CTTTGGTTGCCTGTGCCTGCAGG + Intronic
1155336720 18:24772510-24772532 CTGTGTTTTCAGTTGTATGCAGG - Intergenic
1155408753 18:25518654-25518676 CTGTGGTTTCAGGTATCCACTGG - Intergenic
1155442219 18:25874311-25874333 CTGTGGTTTCAGGCATCTACTGG + Intergenic
1155547298 18:26928749-26928771 CTGTGGTTAAAGGTTTCTGCAGG + Intronic
1156229153 18:35137232-35137254 CTGTGATGTCATGCATCTGCAGG - Intronic
1156686944 18:39661748-39661770 CTGCAGTTTGAAGTGTCTGCAGG - Intergenic
1157122945 18:44928690-44928712 GCATGTTTTCATGTGTCTGCTGG + Intronic
1158174752 18:54642436-54642458 CTGTGGATTCATGTCTCTAGGGG + Intergenic
1158252626 18:55506678-55506700 CTGAGGTTTCAGGCATCTGCTGG - Intronic
1158778714 18:60619769-60619791 ATGTGGCTTCATGTGTATGCAGG + Intergenic
1159378856 18:67630498-67630520 CAGTGTTTTCATGTATCTGTTGG + Intergenic
1159568949 18:70090246-70090268 CTGTGGTTTCAGGCATCTACTGG - Intronic
1159781736 18:72668024-72668046 CTGTGCTCTCATGGCTCTGCTGG - Intergenic
1160492083 18:79347109-79347131 GTGTGGTTGCCTGTGTCTCCTGG + Intronic
1161614775 19:5263992-5264014 CTGTGGGTCCATCTGTCTGGGGG - Intronic
1162725425 19:12687644-12687666 CTCTGGTGTCATGTGTCACCTGG - Intergenic
1163584304 19:18155734-18155756 CTGTGGTCGCCTGTGACTGCTGG + Exonic
1165731534 19:38148790-38148812 CTATGGTTTCAGATGTCTCCAGG - Intronic
1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG + Exonic
1166787717 19:45379076-45379098 CTATAGTTTGTTGTGTCTGCTGG - Intergenic
1168527006 19:57096820-57096842 CTGAGGTTTCATCTGGCCGCTGG - Intergenic
925282770 2:2696397-2696419 CTGTGGATCCTTGTGTGTGCAGG - Intergenic
925601680 2:5614256-5614278 CTTGGGTTTGAGGTGTCTGCAGG + Intergenic
927128283 2:20033893-20033915 CAGTGGTTTCATGGGTCTTTTGG - Intronic
927574486 2:24190051-24190073 CTGTGCTTTCCTGTGAGTGCTGG + Intronic
928052127 2:28009891-28009913 CTGTGGTATCATATGAATGCTGG - Intronic
929693429 2:44093584-44093606 GTTTGGTTTCATGTTTCTGGAGG - Intergenic
931871934 2:66470036-66470058 TTGTTGTTTCATTTGTCTGTTGG + Intronic
932146099 2:69318731-69318753 CTGTGGTTTCAGGTATCCACTGG + Intergenic
935942684 2:108257780-108257802 CTGTGGTTTCAGGCATCCGCTGG + Intronic
936747133 2:115590928-115590950 GTATTGTTTCATGTGTCTGTTGG + Intronic
937229691 2:120390457-120390479 CTCTAGGTTCATGTCTCTGCAGG + Intergenic
937319415 2:120952094-120952116 ATGTGTTTGCATGTGTCTGTTGG - Intronic
937371220 2:121298798-121298820 CAGAGATTTCATGTGTGTGCAGG + Intergenic
937588684 2:123587922-123587944 TTGTGGTTTCAGGCATCTGCTGG - Intergenic
938254987 2:129850677-129850699 CTGTGTATTCATCTGTCTGATGG + Intergenic
938479159 2:131645609-131645631 CTGTGTGTTCATGTGTGTGATGG - Intergenic
938712275 2:133985468-133985490 CTGTGGTTTCAGGCATCTGCTGG - Intergenic
939108685 2:137980692-137980714 ATTTGTTTTCATGTGTCTTCTGG - Intronic
939395988 2:141630188-141630210 CTGTAGTTTCCTGTGTGTGATGG - Intronic
939619359 2:144399326-144399348 CTATGTTTTCATGAGGCTGCAGG + Exonic
940305128 2:152217251-152217273 CTGTTGTTTATTGTTTCTGCTGG - Intergenic
940839723 2:158566037-158566059 CTGTGGCTTAATGTGTGTGTGGG - Intronic
941661931 2:168204014-168204036 CTGTGTTTTCAAGTGGCTGGAGG - Intronic
943187672 2:184633416-184633438 TTGTGGTTTAATGTGCCTGGTGG - Intronic
943920712 2:193704688-193704710 GTGTGTTTTCATGTGTGTGTAGG - Intergenic
943967600 2:194357098-194357120 CTTTGGTTTCCTGTGCTTGCGGG - Intergenic
944127883 2:196314850-196314872 CTGTGGTGTCTTGTGGCTTCTGG - Intronic
944535477 2:200705445-200705467 CTGTGGCTTGGTGTTTCTGCTGG + Intergenic
944562578 2:200955695-200955717 CTGTGCTTTCATGAGTCTCCAGG - Intronic
945956552 2:216091607-216091629 CTGTGTTTTCACGTGGCTGAAGG - Intronic
946171300 2:217897547-217897569 CTGTGTGTGCATGTGTGTGCTGG - Intronic
947240891 2:227993398-227993420 CTGTGGTTCCATGTCACTGGAGG - Intronic
947553765 2:231069004-231069026 TTGTGGTTTCAGGCATCTGCTGG + Intronic
947968339 2:234301164-234301186 ATGTGTATGCATGTGTCTGCAGG - Intergenic
947999977 2:234559840-234559862 CTGCTGTGTCCTGTGTCTGCAGG - Intergenic
1169100419 20:2943168-2943190 CTGTGGTTTCAGGCATCTACTGG + Intronic
1172883970 20:38219201-38219223 GTGTGGCTTCATCTGACTGCCGG - Intronic
1172942620 20:38664887-38664909 CTGTGGTTGCCTGGGGCTGCAGG + Intergenic
1172950549 20:38720641-38720663 GTGTGATTTCTTGTGTCTGGGGG + Intergenic
1173230868 20:41195800-41195822 CTGTGTTTTCATTTGTCTCAAGG + Intronic
1175040277 20:56043014-56043036 CCATGGTTTCAGGTGTCTACTGG - Intergenic
1175436980 20:58959886-58959908 CTGTGGCTTCTTGTTTGTGCAGG - Intergenic
1178295987 21:31410848-31410870 TGGTGGTTTCCTGTGTCTGACGG + Intronic
1180757637 22:18173739-18173761 CTGTGGGTGCTTGTGTCAGCTGG + Intronic
1180914571 22:19476615-19476637 CTGTGGTTTCAGGCGTCCACTGG - Intronic
1181074137 22:20363706-20363728 CTGTGGGTGCTTGTGTCAGCTGG - Intronic
1181666906 22:24404776-24404798 CTGGGGTTTCATGGGTGGGCGGG - Intronic
1181765541 22:25089188-25089210 CTGTGGATTTATGTATCTGTGGG + Intronic
1184030009 22:41887315-41887337 CTGTACTTTGATCTGTCTGCTGG - Intronic
949789734 3:7779885-7779907 CTGTGGGTTCAGGTGACAGCTGG + Intergenic
949957384 3:9280054-9280076 CTATGGTTTCCTTTGCCTGCTGG - Intronic
950907069 3:16548702-16548724 GTGTGTTTTCATGTGTTTGTGGG - Intergenic
950969078 3:17168530-17168552 CCCTGCTTTCATGTGCCTGCAGG + Intronic
951431086 3:22607801-22607823 CTGAGGTCTCATTTGTCTGGTGG - Intergenic
952212266 3:31240097-31240119 CTGTGGTTTTCTGTGTCTCCTGG - Intergenic
952369209 3:32703357-32703379 CTGTGGTTTCAAGTATCCACCGG - Intronic
952475013 3:33699604-33699626 CTGTGGTTTCAGGTATCCACTGG - Intronic
953322679 3:41986325-41986347 CTGTGGTTTCAAGTATCCACTGG + Intergenic
953674431 3:44989528-44989550 CTCTTCTTGCATGTGTCTGCAGG + Exonic
953739846 3:45528196-45528218 ATGTGGTGGCATGTGTCTGTAGG + Intronic
955760097 3:62271013-62271035 CTTTGCTTTCATGTCTCTGTGGG - Intronic
956900105 3:73706834-73706856 CTCTGGTTTCTTGTGTCAGCTGG + Intergenic
956929211 3:74023640-74023662 CTGTGGAGTCATGTGGCTACTGG + Intergenic
957277083 3:78104453-78104475 GTGTGGTTTCATGTTTCAGTAGG + Intergenic
959045770 3:101471882-101471904 GTGTTTTTTCATGTGTCTGTTGG - Intronic
959623168 3:108421024-108421046 TTGTGCCTTCATGAGTCTGCTGG + Intronic
960566454 3:119137674-119137696 CTTTGGTTTCCTGTGCCTGTGGG - Intronic
960775896 3:121252852-121252874 CTGAGGTTTCATGAGACTGAAGG + Intronic
963235334 3:142950406-142950428 CTGTGACTTCATGTCTCTGATGG + Intronic
963854164 3:150237095-150237117 CTGTGGTTTCAGTTACCTGCAGG + Intergenic
964778150 3:160303434-160303456 CTTTGGTTTCATGGGCCTACTGG - Intronic
964867425 3:161276614-161276636 CTGTGATGTCATCTGTCTTCAGG - Intergenic
965326899 3:167317533-167317555 CAGTGGTTTCATGTGGATGTGGG + Exonic
965974214 3:174601674-174601696 CTTTGGTTTCCTGTGCCTGTGGG + Intronic
967312130 3:188116256-188116278 CTGGGTTTCCATGTGTCTGAAGG + Intergenic
968150311 3:196332671-196332693 CTGTGGTTTCAGGTATCCGCTGG - Intronic
968433585 4:573768-573790 GTGTGTTTCCATCTGTCTGCTGG - Intergenic
969130591 4:4988174-4988196 CTGAGGTTTCAGGCATCTGCAGG - Intergenic
969574260 4:8027422-8027444 CTCTGATTTCATGTGTCAGCCGG - Intronic
969836979 4:9850253-9850275 CTGTCGTCTCAAGTGTCTGTGGG - Intronic
970033501 4:11704633-11704655 CTTTGGTTTCATATGCCTTCTGG + Intergenic
970148683 4:13066405-13066427 CAGTAGTTTCCTGTGTTTGCAGG + Intergenic
971027760 4:22605474-22605496 CTGTGGTTGAAGGTTTCTGCAGG + Intergenic
971083817 4:23246823-23246845 CTGTGTCTTCATGTGTCAGAAGG - Intergenic
971196419 4:24474713-24474735 CTATTGTTTCCTGTGTCTCCTGG + Intergenic
971666493 4:29493488-29493510 CTGTGGTTCAGTGTGACTGCTGG + Intergenic
971862687 4:32128350-32128372 CTGTGGTCTCATGTATCTTTGGG + Intergenic
974576335 4:63728611-63728633 TTCTTGTTTCCTGTGTCTGCTGG + Intergenic
974761721 4:66285303-66285325 CTGTGGTTGCTGGTGTCTCCAGG - Intergenic
974900106 4:67986446-67986468 CTATGATTTCATGTTTCTCCAGG + Intergenic
975035800 4:69678936-69678958 CTTTTTTTTCATGTGTCTGTTGG + Intergenic
976897989 4:90135452-90135474 TTGTGTTTTCTGGTGTCTGCTGG - Intronic
976904541 4:90220244-90220266 CTGTGGCTTCAGGCATCTGCTGG + Intronic
977653886 4:99499625-99499647 CTCTGATTTCATGTCTTTGCAGG + Intergenic
978557475 4:109996708-109996730 CTGTGGTTTCTTGTGGCTGAGGG - Intronic
978637574 4:110828038-110828060 GCATGGTTTCATGTGTCTGTTGG + Intergenic
979067516 4:116157005-116157027 CTGTGGTAACGTTTGTCTGCAGG - Intergenic
979097554 4:116570174-116570196 CTGCGGTTTCATGTATCCACTGG - Intergenic
979815596 4:125099708-125099730 TTGTGATTGCATGTGTCTGGAGG + Intergenic
979868701 4:125789251-125789273 CAGTGGTTTCATGTTTCTTTTGG + Intergenic
980811966 4:137894713-137894735 TTTTTGTTTCATGTGTCTGTTGG - Intergenic
980885589 4:138758962-138758984 CTGGGTTTTCAAGTGTCTGATGG + Intergenic
981258419 4:142690855-142690877 CTGTGGTTTCTAGTTTCTGGAGG - Intronic
982705811 4:158708015-158708037 CTGAGGTTTCAGGCGTCTACTGG + Intronic
983087633 4:163466935-163466957 CTGTGTGGTCATGTGTCTTCAGG + Intergenic
983677601 4:170314181-170314203 GTGTGGTGTGATATGTCTGCTGG + Intergenic
983885322 4:172974924-172974946 CTGTGGTTCCTGGTGTCTCCAGG - Intronic
985485008 5:143528-143550 CTGGGGTCCCATGGGTCTGCAGG - Intronic
985690035 5:1303130-1303152 CTTTGGTTGCCTGTGCCTGCAGG + Intergenic
985691672 5:1316407-1316429 CTGTGGTTTTATTTGTCTTTGGG - Intergenic
987552739 5:19405114-19405136 CTGTGGTTTCAGGCATCTACTGG + Intergenic
987795160 5:22618205-22618227 CAGTGGATTCATGTGTGTCCTGG - Intronic
988008957 5:25458363-25458385 CTGTGGTTTCAGGTATCCACTGG - Intergenic
991228427 5:64300557-64300579 CTGTGGTTTCAGGCATCTACTGG + Intronic
991914741 5:71594579-71594601 CTGTGGCATCAGGTGCCTGCTGG + Intronic
992225690 5:74618144-74618166 CTGTGGTTTCCTGTGTGGGCAGG - Intergenic
995541008 5:113186264-113186286 CTGTGTTTTCAAGTTCCTGCTGG - Intronic
995751623 5:115458341-115458363 CTGTGATTTCATGTGAGAGCTGG + Intergenic
997754578 5:136384155-136384177 CTTTTTTTTCATGTGTTTGCAGG + Intronic
997798276 5:136833733-136833755 CTGTGGTGTGATTTGTCTTCAGG + Intergenic
999087873 5:148909486-148909508 CAGTGGTTGCCTGTGGCTGCAGG + Intergenic
999934597 5:156473236-156473258 CTGTGGTTTCAGGCATCTACTGG - Intronic
1000582689 5:163053336-163053358 CTTTGGTTGCCTGTGTCTGTGGG - Intergenic
1001815062 5:174661619-174661641 CTTTGGTTTGATGTGTCTCCTGG - Intergenic
1001857105 5:175022551-175022573 CAGTGGTTTCCTGGGGCTGCAGG + Intergenic
1002790251 6:432237-432259 GTGTGGTTTGAGGTGGCTGCTGG - Intergenic
1004455974 6:15791829-15791851 ATGTGTTGTCATTTGTCTGCCGG + Intergenic
1006093811 6:31643754-31643776 CTGTAGTGTCTTGTGTCTTCAGG - Intronic
1006202191 6:32304090-32304112 ATGTGGTTTCTTGTTTCTGTGGG + Intronic
1007663910 6:43503306-43503328 CTGTGGCCTCTTGTGTCTCCAGG + Intronic
1010688824 6:78883950-78883972 CTATGGTTTCAGGTATCTGCTGG + Intronic
1010756607 6:79672651-79672673 CTGTCATTTCAGGTGTCTTCTGG + Intronic
1011141976 6:84168308-84168330 CTTTGGTTGCATGTGTATGTAGG - Intronic
1011444247 6:87420710-87420732 CTGTGATTTCATTTGTCTAGTGG + Intronic
1012558585 6:100548840-100548862 CCGGAGTTTCATGTGTCCGCTGG - Intronic
1013291792 6:108726275-108726297 CTGTGGTTTCAGGCATCCGCTGG - Intergenic
1014061795 6:117080454-117080476 CTATTTTTTCATGTGTCTGTTGG + Intergenic
1016941233 6:149484208-149484230 CTGAGGTTTCTTATGGCTGCAGG + Intronic
1017291855 6:152746263-152746285 CAGTGGTTTCAGGCGTCTGCCGG - Intergenic
1017320814 6:153090869-153090891 CTGTGGTTTCAGGTGTCCACAGG + Intronic
1017580179 6:155856100-155856122 CTTTGTTTATATGTGTCTGCAGG + Intergenic
1018312669 6:162526766-162526788 CTGTGTTTTCCTCTGTCTCCAGG - Intronic
1018797751 6:167200413-167200435 CTGTGGTTTCAGGCATCTACTGG + Intergenic
1022152221 7:27619270-27619292 CTGTGGTTTCATGATTGAGCAGG - Intronic
1022757568 7:33310043-33310065 CTGTACTTTCCAGTGTCTGCTGG + Intronic
1023775331 7:43600262-43600284 CTGTGTTTTCAGTTGTATGCAGG - Intronic
1024022803 7:45387017-45387039 GTGGGGCTTCATGTGGCTGCAGG + Intergenic
1024122100 7:46253799-46253821 CTGTGTTTTCATGTTAATGCTGG - Intergenic
1026421797 7:70245708-70245730 CTGTTCTTTTATGTGTCTCCTGG + Intronic
1027150199 7:75728272-75728294 CCGTGATTTAAGGTGTCTGCTGG - Intronic
1027504466 7:78998350-78998372 CTGTGGTTTTCTGATTCTGCTGG - Intronic
1027776332 7:82470036-82470058 CTGTGGATTTTGGTGTCTGCGGG - Intergenic
1028544219 7:91979537-91979559 CTGTGGTTTCAGGTCTCCACTGG - Intronic
1029111618 7:98215654-98215676 CTGTGGCCTGCTGTGTCTGCAGG - Exonic
1030675403 7:112380092-112380114 CTTTGGTATCATGTGTCTAAAGG + Intergenic
1031921773 7:127607492-127607514 CTGTGGTTTCAGGTATCTGCTGG - Intergenic
1032643709 7:133797621-133797643 CGGTGGCTGCATGTGTCTGGTGG + Intronic
1032780685 7:135163293-135163315 CAGTGGTTTTATGTGTATGATGG + Intronic
1033321975 7:140347919-140347941 CTGTGGTTTCAGGTATCCACGGG - Intronic
1034056233 7:148037960-148037982 CTGTGGTTTCAGGCATCTACTGG + Intronic
1034361313 7:150501476-150501498 CATTGTTTTCATGTGTCTGTTGG - Intergenic
1035257901 7:157643697-157643719 CTGTGGGTGCGGGTGTCTGCAGG - Intronic
1035533502 8:373920-373942 CTGTGGTTTCAGACATCTGCTGG - Intergenic
1035584985 8:765836-765858 GTGTGGTTGCATGTGTGTGGGGG - Intergenic
1035788808 8:2284987-2285009 CTGTTGTTTCATGTAAATGCTGG - Intergenic
1035797412 8:2371085-2371107 CTCTGGCTTCATGTGTTTGGAGG - Intergenic
1035803997 8:2436718-2436740 CTGTTGTTTCATGTAAATGCTGG + Intergenic
1036533656 8:9622872-9622894 CTGTGGTTTCAGGTATCCACTGG - Intronic
1036636664 8:10555287-10555309 CTCTGTTTTCATGTGAATGCTGG - Intergenic
1037605771 8:20435895-20435917 CTGTGGTTTCATTTGATTTCAGG + Intergenic
1039003435 8:33007403-33007425 CTGTGGTTGCCAGTGTCAGCCGG + Intergenic
1039041757 8:33415121-33415143 CTGTGGTGGCATGTGCCTGTAGG + Intronic
1039987537 8:42460223-42460245 CAGGGCTTTAATGTGTCTGCTGG - Intronic
1040974030 8:53170170-53170192 CTGTAGTTTCATCAGTATGCAGG - Intergenic
1041246531 8:55894032-55894054 CTGTGGGTTCATCTTTCTGTGGG + Intronic
1041366963 8:57116721-57116743 CTCTGTTTTCATGTATATGCTGG + Intergenic
1041416465 8:57615338-57615360 CTTTGGTTGCCTGTGTCTGTAGG - Intergenic
1041426773 8:57729918-57729940 CATTTTTTTCATGTGTCTGCTGG + Intergenic
1041569544 8:59321860-59321882 CTATTGTTACATGTTTCTGCTGG + Intergenic
1041603474 8:59751536-59751558 CCATGTTTTCATGTGTCTGTTGG - Intergenic
1041856004 8:62455890-62455912 CTGTGGTTTCATGTATCCACTGG - Intronic
1041951249 8:63505511-63505533 CTATTTTTTCATGTGTCTGTTGG + Intergenic
1041973077 8:63765809-63765831 GTGTTTTTTCATGTGTCTGTTGG + Intergenic
1042481900 8:69313752-69313774 CTGTGGTTTCAGGCATCTCCTGG + Intergenic
1042711110 8:71718634-71718656 CTGTGGTGGCATGTGCCTGTAGG + Intergenic
1043038459 8:75228807-75228829 CTGTGGTTTCAGGCGTCCGCTGG + Intergenic
1043564302 8:81531345-81531367 CAGTAGTTTCATGTGTATGCTGG + Exonic
1045070687 8:98501170-98501192 GTATTTTTTCATGTGTCTGCTGG + Intronic
1045396967 8:101770800-101770822 ATGTGGTTTCATCTTTATGCGGG + Intronic
1045722100 8:105124596-105124618 CTGTGGTTTCAGGCATCTACTGG - Intronic
1047109785 8:121776834-121776856 CTGTGGTTTCAGGTATCTTCTGG + Intergenic
1049496263 8:142935249-142935271 CTCTGGTTCCATGGGTCTGCTGG - Intergenic
1049765933 8:144355203-144355225 CTGTGGTTGCATGTGGGTGGGGG - Intronic
1050887453 9:10783645-10783667 CCGTTTTTTCATGTGTCTGTTGG - Intergenic
1051106792 9:13589435-13589457 GTGTGATTTCATTTGTCTTCAGG - Intergenic
1051830478 9:21270324-21270346 CTTTTTTTTCATGTGTCTGTTGG + Intergenic
1052805570 9:33010292-33010314 CTTTGGTTTCATCTGACTGGAGG - Intronic
1055156377 9:73067394-73067416 CTGTGATGTGATGTGTCTTCAGG - Intronic
1056545213 9:87607179-87607201 CTGTGGCTTTATGTGGCTCCTGG + Intronic
1057108153 9:92440802-92440824 CTGTGGTTTCAGGCATCTACAGG + Intronic
1057856245 9:98603002-98603024 CTGTGTTTTCCTGTGTCTGCCGG - Intronic
1061405108 9:130389409-130389431 TTGTGGTTTCCTGGGTCTGGGGG - Intronic
1061729631 9:132603814-132603836 CTGTGGTTCCCGCTGTCTGCAGG + Intronic
1185772957 X:2779559-2779581 CTGTGGATTTTGGTGTCTGCGGG - Intronic
1187411607 X:19055508-19055530 CTGTGGTCACATGTGGCTGGTGG + Intronic
1189227353 X:39424001-39424023 CTTTGGTTTTATCTATCTGCAGG - Intergenic
1191832915 X:65434199-65434221 CTGTGGTTTCTTTTCTCTGCAGG - Intronic
1192070368 X:67933489-67933511 CTTTGGTTGCCTGTGTTTGCAGG - Intergenic
1192447724 X:71223272-71223294 CTATGGTCTCATGTCTGTGCAGG - Intronic
1192635856 X:72816528-72816550 CTTTGGTTGCCTGTGTGTGCGGG + Intronic
1192645858 X:72904275-72904297 CTTTGGTTGCCTGTGTGTGCGGG - Intronic
1194611784 X:96053530-96053552 CTTTGGTTTCCTGTGTCGGTAGG + Intergenic
1196595204 X:117537907-117537929 CTGTTGTTTTATGTATTTGCAGG - Intergenic
1196685593 X:118507725-118507747 CTGTGGCCTCATATGTCTACAGG + Intronic
1196707627 X:118729232-118729254 CTGTTGTTTCAGGTGTGTGTGGG - Intronic
1198995645 X:142571144-142571166 CTCTGGTTTCATGTCGCTCCTGG - Intergenic
1199330327 X:146551145-146551167 CTGAGGTTACATGTGGCAGCAGG + Intergenic
1200697103 Y:6370709-6370731 CTGTGGCTGCATGATTCTGCAGG + Intergenic
1200919394 Y:8599714-8599736 CTGAGGTTGCATGGTTCTGCAGG - Intergenic
1201037010 Y:9793990-9794012 CTGTGGCTGCATGATTCTGCAGG - Intergenic
1201518503 Y:14845669-14845691 CTGTGGTTTCAGGTATCCACTGG + Intergenic
1201542738 Y:15125840-15125862 CTGTGGTCTCAGGCATCTGCTGG + Intergenic
1201716727 Y:17052663-17052685 CTGGAGTTTCATGTCTTTGCAGG + Intergenic
1201921222 Y:19234837-19234859 CAGTGTCTTCTTGTGTCTGCTGG - Intergenic
1202129143 Y:21594398-21594420 CTGAGGCTGCATGTTTCTGCAGG - Intergenic