ID: 1093612525

View in Genome Browser
Species Human (GRCh38)
Location 12:21179830-21179852
Sequence CTGTATCTACATATAAAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 293}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093612525 Original CRISPR CTGTATCTACATATAAAGAT GGG (reversed) Intronic
901304039 1:8219494-8219516 ATGTATCTATAGATATAGATGGG + Intergenic
902049429 1:13550183-13550205 ATGTATATACATATATAAATGGG - Intergenic
904776304 1:32909289-32909311 CTGTATTTCCATATAAATTTAGG - Intergenic
906941051 1:50255731-50255753 CTGGATCTATAAATAAACATGGG - Intergenic
907645322 1:56236582-56236604 CTGTTTCTCCATATGAAAATGGG + Intergenic
908001590 1:59685526-59685548 ATATATATACATATAAACATGGG + Intronic
908190994 1:61703711-61703733 ATATATATATATATAAAGATTGG - Intronic
908341284 1:63182277-63182299 ATGTATATACATATACATATAGG + Intergenic
908848046 1:68344897-68344919 CTGTTTCTTCATGTAAATATAGG - Intergenic
909040134 1:70639608-70639630 TTGTATATACCTATAAATATAGG + Intergenic
909490892 1:76225282-76225304 CTGCATCTATATATAGAAATGGG - Intronic
910936596 1:92487816-92487838 CTGCATTTATATATAAAGAAGGG - Intergenic
911561353 1:99409919-99409941 CTGTATTTACACATGAACATGGG - Intergenic
912325586 1:108757144-108757166 TTGTATGTATATATGAAGATGGG + Intronic
912433548 1:109642858-109642880 CTGTAGAGACATATACAGATTGG + Intergenic
912780174 1:112539130-112539152 CTATATATACATTTAAAGCTTGG - Intronic
913301711 1:117377291-117377313 TTCTCTCTACATAAAAAGATTGG + Intronic
915223986 1:154398166-154398188 CTGTGTCTACATAAATAGCTCGG + Intergenic
917572088 1:176277936-176277958 CTGTATCTATATATCAAATTAGG + Intergenic
918256176 1:182749964-182749986 CTGTTTCTTCATCTAAAAATGGG + Intergenic
918274127 1:182935245-182935267 CTGGATCTACAGATCAAGTTGGG + Intronic
918782856 1:188725200-188725222 CTTTATCTAGATATAAATATAGG + Intergenic
920680330 1:208067603-208067625 GTGTATCTAAACATAAAAATGGG - Intronic
921658902 1:217775682-217775704 CTATATATATATATATAGATCGG - Intronic
921708472 1:218349901-218349923 CTGTGTCAACATTTAAAGAAGGG + Intronic
922145990 1:222945005-222945027 CTGTATCTACAAAAAAAAAAGGG + Intronic
923128975 1:231058388-231058410 CTGTGTCTACTTTAAAAGATTGG + Intergenic
1064159863 10:12936064-12936086 TTGGATCTACATACAAAAATGGG - Intronic
1066519659 10:36201809-36201831 CTGAATCTACAGATCAAGTTGGG + Intergenic
1068192296 10:53667552-53667574 CAGTCTCTACACAGAAAGATTGG - Intergenic
1071193365 10:83128102-83128124 CTTTATCTACCTTTACAGATGGG + Intergenic
1071214340 10:83381849-83381871 TTGTATCTACAGATCAAGTTGGG - Intergenic
1071216267 10:83405799-83405821 TTGCTTCTACTTATAAAGATTGG - Intergenic
1071321855 10:84468313-84468335 CTGATTTTATATATAAAGATAGG - Intronic
1074075249 10:110117389-110117411 CTGTAGCTTCAGAAAAAGATAGG - Exonic
1074629670 10:115238318-115238340 CTGAATCTGCATATCAAGCTGGG + Intronic
1077733035 11:4755418-4755440 CTGTACCAACATAAAAAGTTGGG + Intronic
1079293486 11:19210238-19210260 CTCCATCTAAACATAAAGATTGG + Intronic
1079818868 11:25098366-25098388 CTCTATATATATATAAAGACAGG - Intergenic
1080929706 11:36796941-36796963 TTGAATCTGCATAGAAAGATTGG + Intergenic
1081189469 11:40085133-40085155 CTGTATCTGCAAATAAAATTGGG + Intergenic
1081814936 11:45933764-45933786 CTGTGTGTACATGCAAAGATTGG - Exonic
1082144687 11:48652663-48652685 ATGTATCTTCAAATAAAAATTGG + Intergenic
1083139052 11:60706531-60706553 CTGAATCTTGATATAAAGATTGG + Intronic
1085061642 11:73452691-73452713 CTCCATCTACCTATGAAGATTGG + Intronic
1085928227 11:81048220-81048242 GTGTATATATATATGAAGATTGG - Intergenic
1085928231 11:81048384-81048406 GTGTATATATATATGAAGATTGG - Intergenic
1085928232 11:81048429-81048451 GTGTATATATATATGAAGATTGG - Intergenic
1086914649 11:92515283-92515305 CTGTTTTTATTTATAAAGATAGG - Intronic
1087165189 11:94996211-94996233 CTGTATGTTCATTTAAAAATAGG - Intronic
1087348793 11:97004873-97004895 CTGCATCTGCTTATTAAGATGGG + Intergenic
1088563527 11:111142103-111142125 ATTTATCTGCATATAAAGAGAGG - Intergenic
1088668422 11:112117825-112117847 ATGTATATATATATAAAGGTCGG - Intronic
1090963007 11:131573742-131573764 CTGTCTCTCCATGGAAAGATCGG + Intronic
1092478813 12:8841793-8841815 CTCTAACTTCATATATAGATAGG - Intronic
1092601991 12:10077307-10077329 CTCTATATACATATAGATATAGG + Intronic
1093612525 12:21179830-21179852 CTGTATCTACATATAAAGATGGG - Intronic
1094036106 12:26073945-26073967 CTCTCTCTATATATATAGATGGG - Intronic
1094272735 12:28635534-28635556 CTATATCTATATCTATAGATAGG + Intergenic
1094522996 12:31212880-31212902 ATGTATATACATATACACATGGG - Intergenic
1095125772 12:38474165-38474187 CTGTATCCACCTTTAAACATGGG + Intergenic
1095228959 12:39712231-39712253 ATGTATGTACATATACATATAGG - Intronic
1095509662 12:42936811-42936833 CAGTATCTACAGATAAACACAGG - Intergenic
1097852052 12:64421724-64421746 CTGTATTCACAAATAAAGACAGG - Intronic
1099248684 12:80225006-80225028 GTGTATATACATATATATATGGG - Intronic
1099724015 12:86400887-86400909 ATTTATCTACATCTAAAGAGTGG + Intronic
1101202705 12:102453572-102453594 CTGTATGTACAAAAAAAGAGAGG + Intronic
1101302295 12:103495277-103495299 GTGTCTCTACATGTAAAGAGAGG + Intronic
1102284933 12:111648311-111648333 CTCTCTCTAAAAATAAAGATGGG + Intronic
1102284980 12:111648625-111648647 CTCTGTCTAAAAATAAAGATGGG + Intronic
1102372199 12:112391259-112391281 TTTTATATGCATATAAAGATGGG - Intergenic
1102822813 12:115922931-115922953 ATGTTTCTACATAACAAGATAGG - Intergenic
1104063373 12:125286398-125286420 CAGTTTCTACATATAGAGAATGG + Intronic
1106819399 13:33446648-33446670 CTGTTTCTAAATATAAATTTTGG + Intergenic
1109162021 13:58987261-58987283 CTCTATCTCTATAGAAAGATAGG + Intergenic
1109684748 13:65803399-65803421 CTGTATTTATTCATAAAGATGGG - Intergenic
1109749229 13:66667635-66667657 CTCTGTCTACACATAAAAATTGG + Intronic
1109918480 13:69023578-69023600 CTCTTTCTACATATAAACACAGG - Intergenic
1110109877 13:71732671-71732693 CTGTATTTACAAATAAAGGTAGG - Intronic
1110230851 13:73165788-73165810 CTGTATCTAAAAATAAGGCTAGG - Intergenic
1111090825 13:83444591-83444613 AAGTGTCTACATGTAAAGATGGG + Intergenic
1111888584 13:94053672-94053694 CTGGAGTTACATATATAGATGGG - Intronic
1111948140 13:94687200-94687222 ATGTATATACATATATATATGGG + Intergenic
1112154165 13:96799059-96799081 CTGTATTTAGATATGGAGATAGG - Intronic
1112681685 13:101774230-101774252 CTGGAACTACATACAAAAATGGG - Intronic
1112907389 13:104441477-104441499 ATGTATCTATATATTTAGATAGG - Intergenic
1113035392 13:106042361-106042383 TGATATCTAAATATAAAGATTGG - Intergenic
1115175476 14:30557762-30557784 CTGTGTCTACAAATAAGGAAGGG - Intergenic
1115785377 14:36819912-36819934 CTGCATATTCATATAAAGATAGG - Intronic
1116522386 14:45865954-45865976 CTGTAGTTACATATAAGCATTGG + Intergenic
1117526184 14:56607676-56607698 CTGTATGTACATATATACATAGG + Intronic
1120835207 14:89032697-89032719 CTGTATCAACACAAAATGATCGG - Intergenic
1124723897 15:32137619-32137641 CTGTATCTATATCTATATATTGG - Intronic
1125196488 15:37053218-37053240 CTGTATCAGCATATTAAGGTTGG - Intronic
1125785653 15:42315160-42315182 CTGTATCTACTTTAAAAGATTGG + Intronic
1127670622 15:61191172-61191194 CTGTTTCCTCATCTAAAGATAGG + Intronic
1128403138 15:67306113-67306135 CTATATCAACATAAAATGATAGG - Intronic
1130821023 15:87495877-87495899 CTGAATCTGCATCTAAAAATGGG - Intergenic
1130860102 15:87878159-87878181 CAGTTTCTGCATTTAAAGATTGG + Intronic
1136099544 16:27983622-27983644 CTTTTTCTAAATATAGAGATGGG + Intronic
1138920329 16:61520405-61520427 CTATATATAGATATATAGATAGG + Intergenic
1139326803 16:66158868-66158890 GTATATATATATATAAAGATAGG - Intergenic
1139826321 16:69760331-69760353 CTGTATCTAAATAAATAAATAGG - Intergenic
1148226458 17:45901125-45901147 CTGTGTGTACATTTAAACATGGG - Intronic
1149669682 17:58395328-58395350 TTGTATATACATTTAAAGCTAGG - Intronic
1153110094 18:1576188-1576210 CTTTATTTACAAATATAGATAGG - Intergenic
1154432394 18:14318299-14318321 CTGTATGTACATAAAAAAAGAGG - Intergenic
1155721993 18:29027080-29027102 ATGTATATGCATATAAATATAGG + Intergenic
1156102684 18:33616915-33616937 GTGTATCTGCATTTGAAGATGGG - Intronic
1156749819 18:40438365-40438387 CAGAATCTACATATAAGAATGGG + Intergenic
1159721179 18:71893122-71893144 ATATATATAAATATAAAGATGGG - Intergenic
1159847919 18:73488566-73488588 CTTTATCTATATATAGAGATAGG + Intergenic
1162579171 19:11517884-11517906 CTGCATCTACTTGTGAAGATGGG - Intronic
1163408620 19:17139442-17139464 CTGTCTCTAAATAGATAGATAGG + Intronic
926713461 2:15903120-15903142 TTGTATCTATATATTAAAATAGG - Intergenic
928347635 2:30516020-30516042 CTGTATCCACCTTTAAATATGGG + Intronic
928628489 2:33166023-33166045 GTGTATCTACTTTTAAAGTTAGG - Intronic
928767693 2:34667342-34667364 CTGTAGCTAAATATAAGGAAAGG - Intergenic
928971905 2:37038446-37038468 CCTTATTTACATTTAAAGATAGG - Intronic
929269206 2:39954665-39954687 CTATTTCTACATAACAAGATGGG - Intergenic
929955252 2:46453194-46453216 CTGTAAATACTTATAAACATTGG - Intronic
930751246 2:54936496-54936518 CTGTATCTTATTATAAAGTTGGG - Intronic
931403759 2:61956014-61956036 CTGTTTTTACATATAAAGCACGG + Intronic
931726754 2:65118835-65118857 TTGTATATACATATATACATAGG - Intronic
931965306 2:67526968-67526990 TTGAATCTACAGATAAAGTTGGG - Intergenic
933784690 2:85829125-85829147 CTCTATGTACATAAAGAGATAGG - Intergenic
936384736 2:112019170-112019192 CTGTAAATACTTTTAAAGATGGG + Intronic
936493828 2:112999847-112999869 CTGCTTTTACATATGAAGATAGG - Intergenic
937783175 2:125863297-125863319 CTGTATCTACATAAAACGTGTGG + Intergenic
938690330 2:133782443-133782465 ATGTATCTATATATAATGAAAGG + Intergenic
939299659 2:140319366-140319388 CTGTATCTACTTAGAAAATTTGG - Intronic
940732600 2:157410654-157410676 CTGAATCTACAGATTAAGTTGGG + Intergenic
941265409 2:163355559-163355581 GTGTCTCTACCTATAAAGACTGG - Intergenic
942637359 2:178022084-178022106 CTGTGGCTACATGTAAAGAATGG + Intronic
943839206 2:192556438-192556460 CTACATCTAAACATAAAGATGGG - Intergenic
943935784 2:193914798-193914820 CTTTATTTTCATATAAAGTTGGG - Intergenic
944186901 2:196959026-196959048 TTGTTTCTACAGGTAAAGATAGG - Intergenic
944700753 2:202243881-202243903 CTGAATCTATATATCAAGTTGGG + Intergenic
947181408 2:227414695-227414717 CTGTATCTGGAGATAGAGATAGG + Intergenic
947510564 2:230749554-230749576 CTGCATGTATAGATAAAGATGGG + Intronic
947829626 2:233129815-233129837 CCTTATCTACTTATAAAGATAGG - Intronic
1169876523 20:10303325-10303347 CAGTATTTACATAGTAAGATAGG - Intronic
1170303224 20:14909056-14909078 CTGTTTCACCATATAGAGATGGG + Intronic
1170357502 20:15508231-15508253 CTGTATCTAGATAAACAGAATGG + Intronic
1170419314 20:16176817-16176839 CTGAATCTATATAGATAGATGGG - Intergenic
1171545855 20:26000701-26000723 ATGTATATACAAATATAGATTGG + Intergenic
1171565969 20:26187932-26187954 TTGTATGGACATATAAGGATGGG - Intergenic
1175196612 20:57248164-57248186 CTGTATGCACATATAAATAGAGG - Intronic
1176185606 20:63776855-63776877 CTGTAACTCAATATAAAAATGGG + Intronic
1178832605 21:36069322-36069344 CTGTTTCTTCATTTTAAGATGGG + Intronic
1179221248 21:39409379-39409401 ATGTAGCTACATATAAAGACAGG + Intronic
1181349751 22:22246520-22246542 CTGTATTTACAGAAACAGATGGG + Intergenic
1182100990 22:27657209-27657231 GTGTAGCTACATTTGAAGATGGG - Intergenic
1182141477 22:27963222-27963244 CTGAATTTACAAATAAAAATAGG + Intergenic
1182824263 22:33250102-33250124 TTGAATCTACAGATAAAGTTAGG + Intronic
1182967273 22:34533859-34533881 CTCAATCTACATACATAGATAGG + Intergenic
949396639 3:3621640-3621662 TTGCATCTTCATATAAAAATTGG + Intergenic
949595767 3:5545786-5545808 CTGTACCTCCATATTAATATAGG + Intergenic
950035876 3:9885362-9885384 CTCTATCTACATATAAATTAAGG + Intergenic
950321764 3:12061944-12061966 CTGCATCTACAGATCAAGTTGGG - Intronic
951400031 3:22221148-22221170 CTGTGTGTACCTATATAGATAGG - Intronic
952191951 3:31032722-31032744 CTGAATCTATATATAAAATTGGG + Intergenic
952649260 3:35705202-35705224 GTGTAACAACATATAAATATTGG + Intronic
955678901 3:61479623-61479645 CTGGAACCACATAAAAAGATAGG + Intergenic
955767048 3:62355845-62355867 CTCTAGCTAAATATAAAGTTGGG + Intergenic
955817279 3:62858501-62858523 CTGTATCTACTTCTAAAGCTGGG + Intronic
956195075 3:66646316-66646338 TTGTATCTACATATTAATTTAGG - Intergenic
957407341 3:79788944-79788966 ATGTATCTACATAAAAATTTTGG - Intergenic
957618119 3:82558854-82558876 CTATATCCACATATTAATATTGG + Intergenic
957670813 3:83300305-83300327 CTAGATATACATATAAACATTGG - Intergenic
957690809 3:83564637-83564659 CTGAATGTCCATATAAACATAGG + Intergenic
957954494 3:87167333-87167355 CTGTATATATACATATAGATAGG - Intergenic
958213924 3:90535061-90535083 CAATATCTACATATAAAAACTGG - Intergenic
958463092 3:94423892-94423914 CTGTATGTACATCCAAAAATGGG - Intergenic
959310630 3:104731339-104731361 CTTGATCTAAATAAAAAGATGGG + Intergenic
959793478 3:110393473-110393495 CTGAATCTATAGATAAAGAAGGG - Intergenic
960114576 3:113880312-113880334 CTGTATGTAAATAAAAAGAAAGG - Intronic
960822966 3:121753734-121753756 TTGAATCTACAGATAAAGTTGGG - Intergenic
961617034 3:128190815-128190837 CTGTATCTAAACATAAAAAAGGG - Intronic
962801228 3:138892332-138892354 CTGTATGTACACTTAAAAATGGG + Intergenic
963382356 3:144547653-144547675 ATGGGTCTACAAATAAAGATAGG - Intergenic
963470027 3:145728771-145728793 ATGTAGCTACATATAGAGATAGG - Intergenic
963561296 3:146869196-146869218 GTGTATGTAGACATAAAGATGGG - Intergenic
964866709 3:161270318-161270340 ATGTATCTACATAGAAGTATGGG - Intergenic
965252245 3:166356746-166356768 ATGTATTTACATATAAGGAAGGG + Intergenic
965579244 3:170249616-170249638 CTGTTTCTACAAAAAAAGAAAGG + Intronic
967490402 3:190084131-190084153 CTGAATCTACACATCAAGTTAGG + Intronic
968040401 3:195584059-195584081 CTGTATCGAAACACAAAGATGGG + Exonic
968257706 3:197292613-197292635 TAGTATCTACAAATAAAGATAGG + Intronic
969287689 4:6215376-6215398 CTGTTTCAACATATAAATTTTGG - Intergenic
970875591 4:20865840-20865862 CTCTTGCTACATATAAAAATGGG + Intronic
971357673 4:25909638-25909660 CTATATATACTTATACAGATGGG + Intronic
971767498 4:30852271-30852293 ATATATCTACATATAAACAAAGG - Intronic
971837391 4:31786161-31786183 CTGTAAATACAGATAAAGCTTGG - Intergenic
972032718 4:34481916-34481938 CTGTATCTAGATATCTAGATAGG + Intergenic
972103495 4:35451974-35451996 CTGGGTCTATACATAAAGATGGG - Intergenic
974505582 4:62766585-62766607 GTGTATCTACACCTAAAGAGGGG + Intergenic
975856575 4:78631065-78631087 CTATATATAGATATATAGATAGG - Intergenic
975981739 4:80168992-80169014 CTGTATCTCCAAATACAGATGGG - Intergenic
975990871 4:80258721-80258743 CTGGATCTATATATATACATAGG + Intergenic
976051798 4:81018640-81018662 CTCTTTCCACATATAGAGATAGG - Intergenic
977697755 4:99985687-99985709 ATGTATGTACACATAAACATTGG + Intergenic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
977915459 4:102587266-102587288 CTGTGTCTACTTTTAAAGAAGGG - Intronic
978968168 4:114768466-114768488 ATGTATCTATATTTAGAGATAGG + Intergenic
979083815 4:116379531-116379553 ATATATCTATATAGAAAGATAGG - Intergenic
980179411 4:129385946-129385968 CTATATATACATATACAAATAGG + Intergenic
980740156 4:136939752-136939774 CTGTATTTATATACAAATATTGG - Intergenic
981520717 4:145659618-145659640 CTCTATCCACATCTTAAGATTGG - Exonic
982249176 4:153387363-153387385 ATATATTTATATATAAAGATGGG - Intronic
983762558 4:171430127-171430149 CTCTATCTATATATAAACAGTGG - Intergenic
985425219 4:189823464-189823486 ATGTATATATATATAAATATAGG - Intergenic
986390474 5:7281278-7281300 TTATATATAAATATAAAGATGGG - Intergenic
987595339 5:19990117-19990139 CTTCATCAACATAGAAAGATTGG - Intronic
987834050 5:23138171-23138193 CTGTATCAACATATAAATCTTGG + Intergenic
987926012 5:24342863-24342885 ATATATCAAGATATAAAGATGGG + Intergenic
988123598 5:26999474-26999496 CTGTACCTACATAGCAAGTTTGG - Intronic
989400456 5:41002535-41002557 CTTAATCTACATAAAAATATTGG + Intronic
989416647 5:41185273-41185295 CTTTATATACATATAAATACAGG - Intronic
989665164 5:43845775-43845797 CCTTATCTACATATGAAGCTGGG + Intergenic
990756975 5:59083573-59083595 ATATATGTATATATAAAGATTGG - Intronic
992589110 5:78275109-78275131 CTTTATGTACATAAACAGATGGG + Intronic
993085116 5:83354452-83354474 ATGTATGTACATATAAAATTTGG - Intergenic
993087200 5:83377914-83377936 TTGGATCCCCATATAAAGATTGG + Intergenic
994309294 5:98248838-98248860 GTGTATTTACATATAAATACAGG + Intergenic
996827003 5:127695151-127695173 CTGAATCTGAATTTAAAGATTGG + Intergenic
998795532 5:145814338-145814360 CTATTTCTACATACAAAGAAAGG + Intronic
998979474 5:147685762-147685784 ATGTTTATATATATAAAGATAGG + Intronic
999022376 5:148181784-148181806 CTGTTTCTATATAAAAAGACTGG + Intergenic
1000810973 5:165860724-165860746 ATGTATCTACTTTTAAAAATGGG - Intergenic
1002244248 5:177870078-177870100 CCGATTCTCCATATAAAGATGGG - Intergenic
1003976519 6:11350182-11350204 CTGGATGTACATGAAAAGATTGG - Intronic
1005197356 6:23303261-23303283 CTGAATCTACAAATAAACTTGGG + Intergenic
1005214041 6:23504142-23504164 CTCTATCTACATATATACACAGG - Intergenic
1005704399 6:28436996-28437018 TTGTATCAACCTAGAAAGATAGG - Intronic
1005848107 6:29798326-29798348 CTGTATCCTCATCTTAAGATTGG - Intergenic
1005868361 6:29954787-29954809 CTGTATCCTCATCTTAAGATTGG - Intergenic
1008980772 6:57481350-57481372 CAGTATGTACATTTTAAGATTGG + Intronic
1009168869 6:60374307-60374329 CAGTATGTACATTTTAAGATTGG + Intergenic
1010065577 6:71679201-71679223 CTGCATCAACATATCAAGAGTGG + Intergenic
1011059351 6:83245885-83245907 CAGGATCTACATATAAATATAGG + Intronic
1011946929 6:92916627-92916649 TTGTATCTGACTATAAAGATGGG - Intergenic
1012507732 6:99968353-99968375 CAATATCAATATATAAAGATGGG - Intronic
1013152703 6:107461121-107461143 CTTGAGCTACAAATAAAGATTGG + Intergenic
1014051119 6:116955630-116955652 CTTTTTCTAAATAGAAAGATGGG + Intergenic
1015132376 6:129827752-129827774 ATATATTTATATATAAAGATGGG - Intergenic
1016904658 6:149136908-149136930 TTGTATCAACATATAAATTTGGG + Intergenic
1018100106 6:160430129-160430151 ATGTATCTATATAGACAGATGGG + Intronic
1018503668 6:164441250-164441272 CTGCTTCCACATATAAAGAATGG - Intergenic
1019685698 7:2380757-2380779 CTCTATCTACATTCAAAGAGAGG - Intergenic
1020728671 7:11850850-11850872 CTGTCACTACATATAAAAAAAGG - Intergenic
1021265096 7:18510475-18510497 TTGTCTCTACATAAAAACATAGG - Intronic
1021290559 7:18838566-18838588 GAGTATATACATATATAGATGGG - Intronic
1021381646 7:19974656-19974678 TTGTATCTATATATCAAGTTAGG + Intergenic
1024583539 7:50821336-50821358 ATGAATCTGCAGATAAAGATAGG - Intergenic
1026486654 7:70827729-70827751 CTGTATTTATATATACACATAGG + Intergenic
1027421042 7:78018948-78018970 CTGTTTCTTGATATAAAGTTTGG + Exonic
1028198766 7:87935987-87936009 CTGTAAGTCCATATTAAGATAGG + Intronic
1030770326 7:113466841-113466863 CTGTTTATACACATAGAGATTGG - Intergenic
1030964569 7:115974585-115974607 CAGTATCTACATAAATAGAGTGG + Intronic
1031295751 7:120001244-120001266 CTGAATCTACACATCAAGCTGGG + Intergenic
1032983022 7:137306602-137306624 CTGTTTCTACAAAAAAAAATTGG - Intronic
1033772820 7:144572468-144572490 CATCATCTACATATAAATATGGG + Intronic
1033952265 7:146799372-146799394 CTGTGTATACAAATAAAAATGGG - Intronic
1037105366 8:15100524-15100546 TTGAATCTACAGATAAAGTTGGG - Intronic
1038343274 8:26707463-26707485 CTGTATCTATAATTAAAGAAAGG - Intergenic
1038347068 8:26742326-26742348 CTGAATCCAAATATAAGGATGGG - Intergenic
1038511112 8:28136430-28136452 CTGAATCTACATTTGAACATGGG - Intronic
1039184492 8:34901400-34901422 CTGTAAATATATATAAATATTGG + Intergenic
1039781129 8:40786926-40786948 CTGTCTCTGAATATAAAGATAGG + Intronic
1040450017 8:47536217-47536239 CTGAATCTACAAATCAAGTTGGG - Intronic
1040940923 8:52832571-52832593 CTGTAATTACATATATAGAGGGG + Intergenic
1041408671 8:57529335-57529357 CTGTTTCCAGATATAAAGAAAGG + Intergenic
1041619298 8:59947232-59947254 CTGTTTCTAGTTATAAAGAATGG - Intergenic
1043251121 8:78074468-78074490 CTGTATTCACATATAAACAGAGG - Intergenic
1043711407 8:83423318-83423340 CTATATCTCCATTTAAATATAGG - Intergenic
1044077700 8:87843401-87843423 CACTATCTCCATCTAAAGATTGG - Intergenic
1044823412 8:96174351-96174373 CTGTTTCTGCTTTTAAAGATTGG - Intergenic
1044919587 8:97154677-97154699 GTGAATCTACATACACAGATTGG - Intergenic
1045216480 8:100154114-100154136 CTGTATTTTCATATAATGCTTGG + Intergenic
1045335223 8:101196195-101196217 CTTTATCCACATTTAAAAATAGG + Intronic
1050698672 9:8310153-8310175 CTTTATTGACATATAAAAATAGG + Intergenic
1051303310 9:15677655-15677677 CTGTATGAACATATAATGAAAGG - Intronic
1051317016 9:15849310-15849332 CTCTATATACATATATATATAGG - Intronic
1052097982 9:24408234-24408256 CTGAATCAACGAATAAAGATAGG - Intergenic
1053638304 9:40038685-40038707 GTGTATATATATATATAGATGGG - Intergenic
1054719171 9:68586423-68586445 CTGTATATACATATATAAAATGG - Intergenic
1056035761 9:82603215-82603237 CTGTATATAAATATACATATAGG - Intergenic
1056202156 9:84287273-84287295 CTTTATCTACATACAAGTATGGG + Intronic
1056274218 9:84976934-84976956 CTATATCTACATATACACACAGG - Intronic
1058118470 9:101111931-101111953 CTGTATCTATTTAAAAACATTGG - Intronic
1060067621 9:120516836-120516858 ATGTATGTACATATATACATAGG + Intronic
1186328233 X:8503036-8503058 CTGAATCTACAAATAAAGGAAGG + Intergenic
1186848946 X:13560883-13560905 CTATATCTACATGTATAGGTTGG - Intergenic
1187653289 X:21436864-21436886 CTGTATCTACATATAAATAAGGG - Intronic
1187955326 X:24511989-24512011 TTGTATCAACATATAAAAGTGGG + Intronic
1188308961 X:28594056-28594078 TTCTATCTACATAGAAAGTTTGG + Intronic
1188622911 X:32247781-32247803 CTGTATTTATATATACAGAAAGG - Intronic
1189009554 X:37033285-37033307 GTGTATATAAATATAAATATAGG + Intergenic
1189076736 X:37923521-37923543 CTTTATATATATATAAAGAATGG + Intronic
1190496902 X:51035074-51035096 ATATATCTACAAATAAACATAGG - Intergenic
1191742476 X:64450458-64450480 GTGTAAGTACATATAAATATGGG + Intergenic
1194179960 X:90698875-90698897 CAGTATCTACTTCTGAAGATGGG + Intergenic
1194440734 X:93930329-93930351 ATCTATCTACATATAAAGGGAGG - Intergenic
1194474752 X:94345184-94345206 CTTTATCTATATTTAGAGATGGG - Intergenic
1195407668 X:104534177-104534199 CTGGATCTATATAAAATGATGGG - Intergenic
1198450247 X:136760108-136760130 CTGTATCTGCATTTCAACATGGG - Intronic
1198960968 X:142182776-142182798 TTGTATTTACATATACACATTGG + Intergenic
1199538849 X:148934965-148934987 CTGAATATACATATATGGATGGG + Intronic
1201474938 Y:14370165-14370187 CTCTCTCTGCATATATAGATTGG + Intergenic
1201476150 Y:14383628-14383650 CTATATCTACTTATAAATATAGG + Intergenic
1202187275 Y:22198572-22198594 ATGTATCTACATATACATGTTGG + Intergenic
1202204085 Y:22387824-22387846 ATGTATCTACATATACATGTTGG - Intronic