ID: 1093616465

View in Genome Browser
Species Human (GRCh38)
Location 12:21231454-21231476
Sequence GAGGAGTCCTTGGGAAAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 246}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093616465_1093616473 25 Left 1093616465 12:21231454-21231476 CCTATTTTTCCCAAGGACTCCTC 0: 1
1: 0
2: 1
3: 28
4: 246
Right 1093616473 12:21231502-21231524 TTTCATGTGGTCATCAAGAGGGG 0: 1
1: 0
2: 16
3: 27
4: 214
1093616465_1093616472 24 Left 1093616465 12:21231454-21231476 CCTATTTTTCCCAAGGACTCCTC 0: 1
1: 0
2: 1
3: 28
4: 246
Right 1093616472 12:21231501-21231523 CTTTCATGTGGTCATCAAGAGGG 0: 1
1: 0
2: 1
3: 16
4: 182
1093616465_1093616469 12 Left 1093616465 12:21231454-21231476 CCTATTTTTCCCAAGGACTCCTC 0: 1
1: 0
2: 1
3: 28
4: 246
Right 1093616469 12:21231489-21231511 TGAACTTAGTTCCTTTCATGTGG 0: 1
1: 0
2: 0
3: 14
4: 199
1093616465_1093616471 23 Left 1093616465 12:21231454-21231476 CCTATTTTTCCCAAGGACTCCTC 0: 1
1: 0
2: 1
3: 28
4: 246
Right 1093616471 12:21231500-21231522 CCTTTCATGTGGTCATCAAGAGG 0: 1
1: 0
2: 1
3: 4
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093616465 Original CRISPR GAGGAGTCCTTGGGAAAAAT AGG (reversed) Intronic
901904259 1:12394072-12394094 GAGGTCTCCTTGGGAAGGATGGG + Intronic
904680240 1:32223959-32223981 GAGGGTTCCTGGGGCAAAATAGG + Intronic
905317899 1:37095301-37095323 GATGATTCCTTGGGAAAATACGG - Intergenic
905898138 1:41562373-41562395 GAAGAGTTCTTTGGAAGAATGGG + Intronic
906236900 1:44217455-44217477 GAGGAGTCAAGGGGAAAGATAGG + Intronic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
907597149 1:55730688-55730710 GAGGTCTCCTTGGGAAGGATGGG - Intergenic
908323731 1:63003085-63003107 GTGGAATCCTTGGGAGAACTAGG + Intergenic
910400851 1:86836625-86836647 GAGGATTGTTTGGGAAATATTGG - Intergenic
910520306 1:88113713-88113735 TAGTTGTCATTGGGAAAAATTGG + Intergenic
911583019 1:99657236-99657258 GAGATGTCCTTGGGCCAAATAGG - Intronic
912894185 1:113568722-113568744 GAGTAGTCATTTGGAAAAAAAGG + Intronic
914879431 1:151536151-151536173 GAGGAGTCCTTGGGGACAGTAGG + Intronic
917293692 1:173496302-173496324 CTGGACTCCTTGGGAAAAATAGG + Intergenic
917730947 1:177874321-177874343 GAGGAGAGCTTGGGGCAAATGGG - Intergenic
919412079 1:197258201-197258223 GAGGAGTAGGTGAGAAAAATGGG - Intergenic
920382191 1:205541638-205541660 GAGGTGCCCTTGGGGAAAATGGG - Intergenic
921535697 1:216346286-216346308 TGGGACTCCTTGGGAAAAAAAGG + Intronic
923868253 1:237963293-237963315 GAGGGGTCCCAGAGAAAAATGGG - Intergenic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
1063351050 10:5355376-5355398 GGTGAGTGCTTGGGAAAATTTGG - Intergenic
1064925723 10:20566679-20566701 AAGGAGTCCCTGGGAAATCTTGG + Intergenic
1065564571 10:26995861-26995883 ACTGAGTCCTGGGGAAAAATTGG + Intronic
1067149111 10:43715021-43715043 AAGGAATCCTTTGGAAAAATGGG + Intergenic
1067332955 10:45338818-45338840 GAGGTCTCCTTGGGAAAAAATGG - Intergenic
1067957250 10:50805991-50806013 TAGGAGTTCTAGGGAAAAATAGG + Exonic
1069626554 10:69871468-69871490 GGGGAGTCCTTGGGGAATGTGGG - Intronic
1070182299 10:74025915-74025937 GAGGGATCCTGGAGAAAAATGGG + Intronic
1071665679 10:87554793-87554815 GAAGTGACCTTGGGAAACATGGG + Intergenic
1073242681 10:102068458-102068480 GAGGAGTCCTGGGGAAAGGAAGG - Intergenic
1073704394 10:105966563-105966585 GAGAGATCCTTGGGAAAACTGGG - Intergenic
1074838229 10:117321476-117321498 GAGGAGTACTAGAGGAAAATGGG + Intronic
1074972230 10:118548494-118548516 GAGCAGACCATGGGATAAATGGG - Intergenic
1075506900 10:123031900-123031922 GTTGTGTCCGTGGGAAAAATAGG + Intronic
1075759705 10:124846632-124846654 GAGGTGTGCTTGGGGAAAAGGGG - Intergenic
1076264359 10:129098298-129098320 GTGAAGTCTTTGGGACAAATAGG - Intergenic
1076542705 10:131224192-131224214 GAGGAGCCCCAGGGAATAATGGG - Intronic
1078042427 11:7880389-7880411 AATGTGTCCGTGGGAAAAATTGG + Intergenic
1079887654 11:26007701-26007723 AAGAAGCCCTTGGGAAAACTGGG - Intergenic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1081193822 11:40136753-40136775 GAGGAATCCTGGGGAAAAGTGGG + Intronic
1081342941 11:41949941-41949963 GAGCAGCCCCTGGCAAAAATAGG - Intergenic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1084607953 11:70183515-70183537 GGGGGGTCCTAGGGAAAACTGGG + Intronic
1086208504 11:84289669-84289691 GAGGATTCCTAGGCAAACATGGG + Intronic
1087398036 11:97627397-97627419 GAGTAGTTCTTGGGAAAAGATGG + Intergenic
1088208895 11:107430114-107430136 GATGAGTCCTTCTGAGAAATCGG - Intronic
1088750894 11:112841427-112841449 GAGGAAGCCTGGGGAAATATGGG - Intergenic
1088981577 11:114868869-114868891 GAATAGTCCTTAGGAATAATTGG - Intergenic
1089528272 11:119110790-119110812 TAGGAGTCCTTGGGTAAATGGGG + Intronic
1092645096 12:10561944-10561966 AAGGAGTCATTGTTAAAAATTGG + Intergenic
1093206783 12:16260427-16260449 AAGAAGTACTTGGGAGAAATAGG + Intronic
1093566997 12:20618648-20618670 AAGGAGTCATTAGGAAAAAGGGG + Intronic
1093616465 12:21231454-21231476 GAGGAGTCCTTGGGAAAAATAGG - Intronic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1094335351 12:29344387-29344409 GAGAAGACTTTGGGGAAAATAGG - Intronic
1094431335 12:30373116-30373138 GGGGACTCCTTGGGAAAAACAGG - Intergenic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1097807468 12:63981764-63981786 GGGGAGTCCTGGGGGAAAACAGG - Intronic
1098281055 12:68863283-68863305 GAGGAGTCCAGGGGAAAGACAGG + Intronic
1099044304 12:77696671-77696693 GACTAGCCCTTGGGAAAATTGGG + Intergenic
1099383042 12:81979094-81979116 GAAGAATCCTTGGAAATAATAGG - Intergenic
1100816363 12:98390850-98390872 GAAGAGTCCATGGGAGAAATGGG + Intergenic
1101188549 12:102307063-102307085 CTGGATTCCTTGGGAAAAACAGG + Intergenic
1101318257 12:103649701-103649723 TGGGATGCCTTGGGAAAAATGGG - Intronic
1103635583 12:122302472-122302494 GGGGACCCATTGGGAAAAATTGG - Intronic
1105972741 13:25445738-25445760 GAGGAGACTTTGGGCAGAATAGG + Intronic
1108309001 13:49166852-49166874 GCAGAGTCCTTGTAAAAAATTGG + Intronic
1109585691 13:64399901-64399923 GGGGAGTACTTGGGAAGAAATGG - Intergenic
1109712870 13:66182315-66182337 GAGGTCTCCTTGGGAAGGATTGG + Intergenic
1112873839 13:104010909-104010931 GAAGAGTGCTTGGGACACATGGG - Intergenic
1115095488 14:29630768-29630790 GAGGAGCCCTTGGGAATGACGGG + Exonic
1117755662 14:58971756-58971778 GAGGAGGACTTGGGGAAATTAGG - Intergenic
1118070397 14:62240715-62240737 GATGAGTCCTGGGGAAAGAAAGG - Intergenic
1118994871 14:70826691-70826713 GAGCAGTTCTTGGGAAAAAGGGG - Intergenic
1119076433 14:71644579-71644601 CAGCAGTCATTTGGAAAAATTGG + Intronic
1119219998 14:72898853-72898875 GAGGAATCCTTTGGAAGAAAAGG + Intergenic
1120269881 14:82297856-82297878 TAGGTGTCCTTGGAAAAAAAGGG - Intergenic
1120424484 14:84329767-84329789 GAGAAGCCCCTGGGAAAAAAAGG + Intergenic
1120865763 14:89294081-89294103 CAGGAGCCCTTGGGAAGAACGGG - Intronic
1121162243 14:91754492-91754514 GAGGTGTTCTCAGGAAAAATTGG - Intronic
1121358358 14:93233171-93233193 GAGGAGTCCTTAAGAACAAATGG + Intergenic
1121454808 14:94031388-94031410 GAGGAGTCCTTAGGTAATGTGGG + Intronic
1121705376 14:95989345-95989367 GAGGAGTCCTTGGGAATTGAAGG + Intergenic
1124114084 15:26823745-26823767 GAGGAGTCCTTGTGTAATCTGGG - Intronic
1129427399 15:75473656-75473678 GTGGAGACCTTTGGAAAAAAGGG + Intronic
1131997727 15:98147942-98147964 GAGATGTCCCTGGGAAAAAAAGG + Intergenic
1132223479 15:100123075-100123097 GTGGGGTCCTTGGGAAAGTTGGG - Intronic
1134008320 16:10833197-10833219 GAGGAGCCCCTGGGAGAAACAGG + Intergenic
1138743477 16:59336663-59336685 GAGCAGTGTTTGGGAAAAATAGG + Intergenic
1138801378 16:60034182-60034204 GAGGAGACCAAGGTAAAAATGGG + Intergenic
1141441131 16:84030337-84030359 GAGGAGGCCCTGGTAAAAACAGG - Intronic
1143703527 17:8680262-8680284 GAGGTGTACCTGGTAAAAATTGG + Intergenic
1143988836 17:10939240-10939262 GGGGGCTCCTTGGAAAAAATTGG + Intergenic
1146320144 17:31840560-31840582 GAGGAGAGCATGGGAAAAACAGG + Intergenic
1147760505 17:42794954-42794976 GAGGAGACCTGGGAAGAAATGGG - Exonic
1148913872 17:50958128-50958150 GAGGGGTCTTTGGGAAGAAACGG + Intergenic
1151472186 17:74325449-74325471 CAGGAGGCCCTGGGAAAACTTGG - Intergenic
1156954723 18:42948602-42948624 TAGGACTCCTTGGGCAAACTGGG - Intronic
1157144159 18:45144186-45144208 GAGTAGTCTATGGGAAAAAAGGG + Intergenic
1157315318 18:46582772-46582794 GAGGAGTTCTTGGGAGAGCTTGG + Intronic
1157410730 18:47460760-47460782 CAGGACTCCTTGGCAAAAATTGG + Intergenic
1159707124 18:71705562-71705584 GAAGAGTCTTGGGGAAAAGTGGG - Intergenic
1162959038 19:14115494-14115516 GAGGGCTCCTTTGGAAAATTTGG + Intronic
1164610961 19:29631416-29631438 GAGGGGTCCTTGGGGAGGATTGG + Intergenic
1166303537 19:41925220-41925242 GAGGATTCCCTGGGATAAACAGG + Intronic
1166332404 19:42086631-42086653 GAGGAGTCTTTGGGAAGAGCAGG - Intronic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1166691270 19:44822453-44822475 GAGGAGTCCCTGGGGAAAGCGGG + Intergenic
1167222237 19:48207595-48207617 GAAAACTCCTTGTGAAAAATGGG - Intronic
1167482172 19:49739834-49739856 GAGGGGTCCACGGGAACAATGGG - Exonic
1167663995 19:50812596-50812618 GAGGGGTCCCTGGGATAAAGTGG + Intergenic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
929133902 2:38604063-38604085 GAGTAGTCCTTGGGAAATAAAGG + Intergenic
929631136 2:43463334-43463356 GTGGAGTCCTTTGGAAATCTTGG + Intronic
930111120 2:47679535-47679557 GAGGAATCAATGAGAAAAATGGG + Intergenic
931937966 2:67219148-67219170 GAGGAGTTCTTGGGGACAAGTGG - Intergenic
932725312 2:74174814-74174836 AAGGAATCCTTTAGAAAAATAGG + Intronic
933806071 2:85998690-85998712 TAGGAGCCCTTGGGGAAACTGGG + Intergenic
935948092 2:108304131-108304153 GAGGAGGCCAGGAGAAAAATAGG + Intronic
936117037 2:109710775-109710797 GAGGAGACCTGGGGAAGGATGGG + Intergenic
936136942 2:109903469-109903491 GAGGAGTCCTCAGGAAAGAAGGG - Intergenic
936207755 2:110468016-110468038 GAGGAGTCCTCAGGAAAGAAGGG + Intronic
940368468 2:152875230-152875252 GTGGAGTCTTTGGGAGCAATAGG - Intergenic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
942810791 2:179998107-179998129 GAGGAGACTTGGGGAAAAGTTGG - Intronic
943187472 2:184630411-184630433 GAGGTGTTCTTGTAAAAAATCGG - Intronic
943650937 2:190456936-190456958 GACGAGTCATTGGGAAGACTGGG - Intronic
943728874 2:191280863-191280885 GATGTGTCCATGGGAAGAATTGG + Intronic
945912096 2:215661158-215661180 GTAGAGCCCTTGGGAAAAACAGG + Intergenic
947141264 2:227021310-227021332 GAGGAGGGATGGGGAAAAATAGG - Intronic
947516407 2:230808670-230808692 AAGGAGGATTTGGGAAAAATTGG + Intronic
947817650 2:233048796-233048818 GAGGAGCCCCTGGGGACAATGGG + Intergenic
948046380 2:234948729-234948751 GAGAAGTCCTTGGAATGAATTGG + Intergenic
948682796 2:239647900-239647922 AAGGAGTATCTGGGAAAAATGGG - Intergenic
1168896710 20:1328715-1328737 GTGGATTCCTTGGGAGAAATGGG + Intronic
1169663574 20:8007618-8007640 GTGGAGTACTTGAGATAAATGGG - Intronic
1170355968 20:15491762-15491784 AAGGAGCCCTTGGGTAAAAGGGG + Intronic
1170727965 20:18946874-18946896 GAGGGGTCCTTGGTAAAAGATGG + Intergenic
1171405347 20:24909207-24909229 GAGGAGGCCGTGGAGAAAATGGG - Intergenic
1171405953 20:24912698-24912720 GAGGGGTCCTTGAGGAACATTGG + Intergenic
1173054471 20:39597745-39597767 AAGTAGCCCTTGGGAAGAATGGG - Intergenic
1173056024 20:39613641-39613663 GAAGGATCCTTGGGAAAACTGGG - Intergenic
1173607721 20:44343496-44343518 GAGGAGTACCTGGGTATAATGGG - Exonic
1173773473 20:45683926-45683948 GAAGAGGGCTTGGGAAAGATAGG + Intergenic
1173924846 20:46773162-46773184 GAGAAGTTCTTAGGAAGAATGGG + Intergenic
1179498814 21:41793495-41793517 GAAGAGTCCTTGGAAGAAAAGGG - Intergenic
1182995903 22:34812339-34812361 GAGGAGTCCTCAAGAAATATGGG - Intergenic
1183087700 22:35496861-35496883 GATGAGTAATTCGGAAAAATGGG - Intergenic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
951796111 3:26540356-26540378 AAGGAATACTTGAGAAAAATTGG - Intergenic
953043002 3:39271624-39271646 CAGGAGTCATTGGGCAACATAGG + Intronic
957726247 3:84071137-84071159 GGGGATTCCTTGGGAAAAATAGG - Intergenic
959010047 3:101064736-101064758 GATGTGCCCTTGGAAAAAATTGG - Intergenic
960064050 3:113351889-113351911 CAGGAGTCCTTGGTAGAAGTTGG - Intronic
960742524 3:120850787-120850809 GAGGACTGCTTAGGAAAAATGGG + Intergenic
960816297 3:121676679-121676701 GGTGAGTCCTTGGGAATGATTGG - Intronic
961040391 3:123674182-123674204 GAGGGGGCCTTGGGAGAAATGGG - Intronic
961118259 3:124350201-124350223 GAGGAACAGTTGGGAAAAATGGG - Intronic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
962413336 3:135160806-135160828 GAAGAGGCCTTGGGAAACATAGG + Intronic
962834857 3:139181135-139181157 CTGGAGTCCTTGGGAAGTATGGG + Intronic
963073903 3:141328868-141328890 GAGTAGGACATGGGAAAAATTGG - Intronic
964753069 3:160069871-160069893 TAAGAATCCTTGGGAAAAATAGG - Intergenic
964763950 3:160160298-160160320 GAGGACTCCTTGGGAAAATCAGG - Intergenic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
967072368 3:185973044-185973066 CAGGAGTCCTTGTTAAAACTAGG - Intergenic
970113155 4:12661452-12661474 GAGGAATCCTTGTAAAATATGGG - Intergenic
970615329 4:17763491-17763513 TAGGCTTCCTTGGGACAAATAGG + Intronic
972818986 4:42677212-42677234 CTGGACTCCTTGGGAAAAATGGG + Intergenic
973100253 4:46258788-46258810 GGGGATTCCTTGAGAAAAATAGG + Intronic
973798842 4:54456360-54456382 GAAGAGCACTTGGGGAAAATTGG + Intergenic
974634078 4:64536220-64536242 GAAGAGTCCATAAGAAAAATAGG + Intergenic
976847583 4:89507814-89507836 GAGGAGTCCTTGGAAAAGCGGGG - Intergenic
977349084 4:95857552-95857574 GAGGAGCCCATGGAAAGAATAGG + Intergenic
977879036 4:102183406-102183428 GAGGAATACCTGGGCAAAATTGG + Intergenic
977922092 4:102656917-102656939 GAGGAGGGATAGGGAAAAATAGG + Intronic
981204248 4:142019976-142019998 GAAGATTGCTTGGGAAAAAGAGG + Intergenic
981992395 4:150938308-150938330 AAGGATTCCTGGAGAAAAATTGG - Intronic
983592534 4:169429812-169429834 CAGAAGTCCAAGGGAAAAATGGG - Intronic
984133128 4:175902726-175902748 GAGGGGTCCCGGAGAAAAATGGG - Intronic
984348790 4:178565537-178565559 GAGGAGTCCCAGGGAAAATGTGG + Intergenic
986405450 5:7420447-7420469 GAGGAGTCACTGGGAAAATAAGG + Intronic
987057991 5:14213502-14213524 AAGGTGTCCTTGGCATAAATGGG - Intronic
987916859 5:24226602-24226624 GAGGTGTCCATGGGTAAAAATGG + Intergenic
989419807 5:41224397-41224419 GAGGAGGGATAGGGAAAAATAGG - Intronic
990084650 5:51959507-51959529 GAGGAATTCTTATGAAAAATAGG + Intergenic
990523461 5:56602269-56602291 GAGGAGTTCATCGGAAAATTTGG - Intronic
991749418 5:69784301-69784323 GAAGAGACCATGGGAAAAAAAGG + Intergenic
991800998 5:70364110-70364132 GAAGAGACCATGGGAAAAAAAGG + Intergenic
991827602 5:70645931-70645953 GAAGAGACCATGGGAAAAAAAGG - Intergenic
992453177 5:76891661-76891683 GAGGAGTCGTTTGGAAACACTGG + Intronic
994049350 5:95344914-95344936 GATGAGACCTTGGGGAATATGGG + Intergenic
994609068 5:102012790-102012812 GAGGAATTCTTGGGAAAGGTAGG - Intergenic
994751187 5:103738628-103738650 GAAGGGTCCTTGGGAAGAAATGG + Intergenic
995037050 5:107546024-107546046 GAGTGGACCTTTGGAAAAATGGG + Intronic
995518211 5:112975035-112975057 GAGGTGATCTTGGGAAACATTGG - Intergenic
996374534 5:122790519-122790541 GACCACTCATTGGGAAAAATGGG - Intronic
996400918 5:123061522-123061544 CAGGAATCCTTGGGATAATTGGG + Intergenic
998249393 5:140541319-140541341 GAGGAATCCCTAGGAAAATTGGG + Intronic
998263614 5:140650058-140650080 GATGAGTCCTGCTGAAAAATGGG - Intronic
998738147 5:145166940-145166962 GAGGAGTGAGTGGGAGAAATGGG + Intergenic
999526525 5:152412008-152412030 GAGAAGTCCCTTGGAAAGATAGG - Intronic
999873425 5:155775761-155775783 GAGGATGCCTTGGGAAACAGTGG + Intergenic
1001539929 5:172530654-172530676 GAGGAGTACGTGGGAAGCATTGG - Intergenic
1001712730 5:173791180-173791202 GAGGAGTCTTGGGGAACAAAGGG - Intergenic
1002723439 5:181280152-181280174 GAGAAGGCTTTGGGAAAAGTTGG - Intergenic
1003160976 6:3633937-3633959 CAGGAGGCCTTGGGAAACGTGGG - Intergenic
1003866261 6:10365715-10365737 GAGGAGTACCTGGGGAAATTTGG - Intergenic
1004176467 6:13344326-13344348 GATGACTCCATAGGAAAAATGGG + Intergenic
1009765222 6:68065030-68065052 GGGAAGTGGTTGGGAAAAATAGG + Intergenic
1011516821 6:88164580-88164602 GAGGAGTACCAGGGAAAAAAAGG + Intronic
1012103486 6:95122746-95122768 AATGATTCTTTGGGAAAAATGGG + Intergenic
1012204888 6:96449348-96449370 AATGAGTACTTGGGAAAATTTGG - Intergenic
1014821846 6:125997860-125997882 GAGAAGACATTGGGAATAATTGG + Intronic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1016690191 6:146929127-146929149 AAGGTGCCCTTGGGAAAAAAGGG + Intergenic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017338794 6:153295261-153295283 GAGCAGGGCTTGTGAAAAATAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1017544110 6:155432855-155432877 GAAGCGTCCCTGGGAAAGATGGG + Intronic
1018081918 6:160266495-160266517 GAGGAGTCTTTAGTAAAAATGGG + Intronic
1018107527 6:160503223-160503245 GAGGTGTCCTTGGGAAGGATGGG + Intergenic
1019376734 7:696842-696864 CAGGAGGCCTTGGGAGAAAGGGG + Intronic
1019602924 7:1894286-1894308 GAGGAGGACTTGGGAAGAGTCGG + Intronic
1022520020 7:31000295-31000317 GAGGAGCCCTTGGGAACATCTGG + Intergenic
1023654858 7:42409270-42409292 AAGGAGTCCTTGAGAAAGAAAGG + Intergenic
1024827170 7:53404194-53404216 TGGGCGTCCTTGGAAAAAATAGG + Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1029747400 7:102523984-102524006 AAGGGGTCCCTGGGAAAACTGGG - Intergenic
1029765353 7:102623074-102623096 AAGGGGTCCCTGGGAAAACTGGG - Intronic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1033462027 7:141555329-141555351 GAGGAGTGAGTGGGAAAAAAAGG + Intronic
1035552806 8:543352-543374 CAGGATTCATTAGGAAAAATGGG + Intronic
1037358805 8:18052023-18052045 GAGGAATCCTTAGAGAAAATTGG + Intergenic
1037759189 8:21730563-21730585 GAGGAGCCACTGGGAAAATTAGG - Intronic
1039074323 8:33676077-33676099 GAGGAACCCTTGAGAAGAATTGG - Intergenic
1039749257 8:40462037-40462059 GAGCAGTCCTGGGGAAAATGGGG - Intergenic
1042085865 8:65108192-65108214 GAGAAGTCATGGTGAAAAATTGG + Intergenic
1042427764 8:68668872-68668894 GAGGAGTCCTTAGGAGGAACTGG + Intronic
1043446406 8:80323682-80323704 GAGGAGATCTTATGAAAAATTGG - Intergenic
1043833966 8:85024455-85024477 ATGGAGTACTTGAGAAAAATAGG + Intergenic
1046793160 8:118343178-118343200 GAGGAGAACTGGGGAAAGATTGG - Intronic
1047419992 8:124699751-124699773 GTGGAGTACTTGGAAAAAAGTGG - Intronic
1049087926 8:140492589-140492611 GAGGAGTTCTTTGCTAAAATTGG - Intergenic
1049298157 8:141854851-141854873 GAGGTGTCCTGGGGAAAGAACGG + Intergenic
1051929986 9:22373574-22373596 CAGGAGTCCCTGGGACAATTGGG + Intergenic
1051961218 9:22765088-22765110 GAAGAATCCATGGGAAAAACAGG + Intergenic
1052635162 9:31093748-31093770 GAGGAGGCCTAGAGAAAAGTAGG + Intergenic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1053426249 9:38012066-38012088 GAGGAGCCCCTGGGAGAAACAGG + Intronic
1054902612 9:70385857-70385879 GAGCAGTCCATGGGATAAAAAGG - Exonic
1054967939 9:71051058-71051080 GAGGAGTTCTAGGGGAAAAGAGG + Intronic
1055114352 9:72590979-72591001 GAGGATTCCTAGGCAAAAAGAGG + Intronic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1058657449 9:107236424-107236446 GAGGTGTCCTTGACAAAAAGAGG - Intergenic
1058895511 9:109397457-109397479 GTGGGCTCTTTGGGAAAAATGGG - Intronic
1059100487 9:111466832-111466854 GAGGATTGCTTGGGCAAAATAGG - Intronic
1060661103 9:125405677-125405699 GAGGAGGCCTGGGGACAAAGGGG + Intergenic
1061640368 9:131949576-131949598 GAGGATTCCTTGGAAAAAGCAGG + Intronic
1187258759 X:17666012-17666034 GGGGAGTCCTGGGGAAAGAATGG + Intronic
1188461087 X:30428111-30428133 GAGGTCTCCTTTGGAAAAATGGG - Intergenic
1189044630 X:37577189-37577211 AAGGAGTCCTTGGCACAAAAGGG - Intronic
1189208015 X:39258390-39258412 GAGGAGTCCTTGGGCCAAAGGGG + Intergenic
1190962784 X:55268819-55268841 CAAGACTCCTTGGGAAAAACAGG + Intronic
1191017351 X:55823851-55823873 GAGGAGTCTGTGGGAAAAGTGGG - Intergenic
1191134145 X:57045379-57045401 GAGGACTCCTTGGGGAAGAATGG + Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1192568565 X:72183571-72183593 GAGGTGGCCTTGGGTAAAAGTGG + Intronic
1194379907 X:93178943-93178965 TGGGACTCCTTGGGAAAAATAGG + Intergenic
1194513607 X:94823670-94823692 GAGGTCTCCTTGGGAAAGAAGGG + Intergenic
1198142183 X:133815335-133815357 CAGGACTCCTGGGGAAAGATAGG - Intronic
1198142400 X:133817616-133817638 CAGGACTCCTGGGGAAAGATAGG + Intronic