ID: 1093619166

View in Genome Browser
Species Human (GRCh38)
Location 12:21266367-21266389
Sequence CCTTTTAATCAGTCTCTGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 156}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093619166_1093619170 6 Left 1093619166 12:21266367-21266389 CCTTCCAGAGACTGATTAAAAGG 0: 1
1: 0
2: 1
3: 15
4: 156
Right 1093619170 12:21266396-21266418 TAATATACCAGAAAGACTAAGGG 0: 1
1: 0
2: 3
3: 23
4: 304
1093619166_1093619169 5 Left 1093619166 12:21266367-21266389 CCTTCCAGAGACTGATTAAAAGG 0: 1
1: 0
2: 1
3: 15
4: 156
Right 1093619169 12:21266395-21266417 CTAATATACCAGAAAGACTAAGG 0: 1
1: 0
2: 2
3: 10
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093619166 Original CRISPR CCTTTTAATCAGTCTCTGGA AGG (reversed) Exonic
901552665 1:10007380-10007402 CTTTTTAATCAGGCTGTGGTTGG + Intronic
909052683 1:70785684-70785706 TCTTCTGGTCAGTCTCTGGAAGG + Intergenic
915212868 1:154323418-154323440 CCTATTGTTCAGTCTCTGGGTGG + Intronic
915409490 1:155689083-155689105 CCTTTTTTGCAGTCTCAGGACGG + Exonic
917670315 1:177267730-177267752 CCTCTTAAGCAGTCTGTGGGTGG + Intronic
919106958 1:193165473-193165495 CGTTTTACACAGTCTCAGGATGG + Intronic
919369128 1:196702809-196702831 CATTTTGATCAGCCTCTGCAAGG + Intronic
920884430 1:209912853-209912875 TCTTTTACTCAGTCTCTGCAAGG - Intergenic
1064401853 10:15028110-15028132 CCTTTTAAGCAGTCAGTGGCTGG - Intergenic
1065205050 10:23349020-23349042 CCATTTAATCAGACCCTAGAAGG + Intergenic
1065550150 10:26861400-26861422 CTTTTTAATCCTTCTCTGAATGG - Intergenic
1067004122 10:42645428-42645450 CCTTTTAAGCAGTCAGTGGCCGG - Intergenic
1067146734 10:43699836-43699858 CCTTTTAATCATCCTCCAGATGG + Intergenic
1071548532 10:86547559-86547581 CCTTTTAATAAATCTCTTGCTGG + Intergenic
1072403609 10:95129304-95129326 CCATTCAACAAGTCTCTGGAAGG - Intergenic
1077759336 11:5074575-5074597 GCTTTTAATCAGTGTGTGGTGGG - Intergenic
1080266695 11:30408649-30408671 CCTTTTAATCATTCTTTGTCTGG - Intronic
1081230009 11:40574631-40574653 CCTTTATATAAGTCTCTAGAAGG + Intronic
1082678491 11:56139789-56139811 CTATTTAATCAGTCACAGGAAGG + Intergenic
1085767738 11:79298099-79298121 CCTTTTCATCAGTTTCTCCAAGG + Intronic
1087481780 11:98710769-98710791 CCTTCTATTTAGTCTCTGGTGGG - Intergenic
1088716042 11:112550868-112550890 CCTTTAAATCATTCCTTGGAGGG - Intergenic
1089913569 11:122128412-122128434 ACTTTTATTCAGCCCCTGGAGGG - Intergenic
1090057640 11:123437386-123437408 TCTTGTCATCACTCTCTGGAGGG + Intergenic
1090212262 11:124929636-124929658 CCTTTTCTTCAGCCTCTGGTGGG - Intronic
1093619166 12:21266367-21266389 CCTTTTAATCAGTCTCTGGAAGG - Exonic
1094032561 12:26029381-26029403 CTTTTTAATCTGTCTGGGGAAGG + Intronic
1098348190 12:69528171-69528193 CCTTTTAAACATTCTATGGCTGG - Intronic
1099859189 12:88206951-88206973 CCATTTAACCAGTCTCTAGGAGG + Intergenic
1099905690 12:88766979-88767001 ACTTTTAATAAGTATCTGGGAGG + Intergenic
1102261970 12:111448388-111448410 CCCTTAAATCTTTCTCTGGAAGG - Exonic
1102613120 12:114130030-114130052 CCTGTTGATTAGTCTCTGGCTGG - Intergenic
1107490278 13:40874888-40874910 CCTTTTAAGCAGTCAGTGGCTGG - Intergenic
1108467667 13:50733513-50733535 CCCTTGCATCAGTCTCTGGGTGG - Intronic
1111973971 13:94946291-94946313 CCTTTCAATAAGTCTCTTGCTGG - Intergenic
1115096842 14:29647870-29647892 CCTTTTAAGCAGTTTATGGTGGG + Intronic
1115097191 14:29650653-29650675 CCTTTTAAGCAGTTTTTGGCAGG + Intronic
1115433719 14:33349855-33349877 CCTTTTGTACAGTCTCTGGGCGG + Intronic
1120922922 14:89771572-89771594 CCTTTCTGTCAGTCTCTGGAAGG + Intergenic
1121756734 14:96408989-96409011 CCTTGTAATCTGTGTGTGGAGGG + Intronic
1124614170 15:31229569-31229591 CTTCTTAATCAGGCTCAGGAGGG - Intergenic
1126962402 15:54011814-54011836 CATTTCAATCAGGCTCTGCAGGG - Intergenic
1127209233 15:56755500-56755522 CCTTTTAATCAATGTCTGTTTGG - Intronic
1127616010 15:60686455-60686477 CCTTTTATTGAGTGTCTGTATGG + Intronic
1128556673 15:68636448-68636470 CCTTCTCAACAGTCTCTAGAGGG - Intronic
1130153595 15:81331182-81331204 CCTTTTAAGCAGTCGGTGGCCGG + Intergenic
1130886200 15:88094551-88094573 CCTTCTCAGCTGTCTCTGGAGGG - Intronic
1131534290 15:93221690-93221712 CCTTTTAAGCAGTCGGTGGCTGG + Intergenic
1133163675 16:3930897-3930919 CCTTTTAATCATTCTCTTTAGGG - Intergenic
1140881614 16:79203420-79203442 CCTCTTAATTTGTTTCTGGAAGG + Intronic
1141074511 16:80991297-80991319 CCTTTTCATAACTCTTTGGAAGG - Intronic
1142973346 17:3628038-3628060 CCGTTTAATCACTCCCAGGATGG - Intronic
1143905250 17:10203229-10203251 CCTTTCTATCAGCCTATGGATGG + Intergenic
1144344512 17:14338013-14338035 CCATTGAATCAGGCCCTGGATGG - Intronic
1147014502 17:37480528-37480550 CTTTTTAATCAGACACTGGCTGG + Intergenic
1147940229 17:44041635-44041657 TCTTTTGATCAGTTTGTGGATGG - Intronic
1148195084 17:45707451-45707473 CCCTTGAATCAGCCTATGGATGG + Intergenic
1148676714 17:49449859-49449881 CCTTTGAAGAAGTTTCTGGAAGG - Intronic
1151635299 17:75343181-75343203 CCTATTAATCCCTCTCAGGATGG + Intronic
1156941319 18:42770075-42770097 CCTATGAAGCAGTCTCTGGGTGG - Intronic
1158069321 18:53452094-53452116 GCTGTTAATAAGGCTCTGGAGGG + Intronic
1159979932 18:74766144-74766166 CTTTTTAACTAGTCTCTGTAAGG + Intronic
1163408228 19:17136776-17136798 ACTTTGAAACAGTCTCTGGAGGG - Intronic
1165229145 19:34375808-34375830 CCCTTTTTGCAGTCTCTGGATGG + Intronic
1167808027 19:51802720-51802742 CTTTTTAATCAGACTGTTGAAGG + Intronic
926226958 2:10973583-10973605 CCTTTTAAGGAGTTTCTGGGAGG - Intergenic
926395722 2:12440480-12440502 CCTTTTAATCATTTTGTTGATGG - Intergenic
927640989 2:24845311-24845333 CCATTTAACAAGTCTCTGGGAGG - Intronic
930587365 2:53283562-53283584 CTTTTTCCTCAGTCTATGGATGG + Intergenic
934970088 2:98756190-98756212 CCTTTTGATGAGACTCTGAAAGG + Intergenic
935387853 2:102519993-102520015 CCTTGAAAACAGTCTCTGAAGGG + Intronic
935837465 2:107070703-107070725 CTTTTAAATCATTCTCTGGAGGG - Intergenic
939621595 2:144426313-144426335 TATTTTTATCAGTCTCTGCAAGG + Intronic
940153793 2:150631430-150631452 CCTTTCAATCACTGTCTGGCAGG + Intergenic
944051648 2:195476700-195476722 CCTTTCCAGCAGTTTCTGGAGGG + Intergenic
946805817 2:223470511-223470533 GTTTTTCATGAGTCTCTGGAAGG + Intergenic
948890227 2:240903775-240903797 CCTTTTCCTCAGTCACTGCAGGG - Intergenic
948904911 2:240974979-240975001 TCTTTTGATCAGTGTCTGGGTGG + Intronic
1172605081 20:36208556-36208578 CCATTTAGCCAGTTTCTGGAAGG - Intronic
1177333285 21:19689655-19689677 AGTTTGATTCAGTCTCTGGATGG - Intergenic
1179294911 21:40053164-40053186 CCAATTACTCAGTCTCTGGCAGG + Intronic
1179959168 21:44758698-44758720 CTTTGTAATCATTGTCTGGAGGG + Intergenic
1182710536 22:32320197-32320219 CCTTTTGATCAGTGTCAGGGTGG - Intergenic
1184464830 22:44662746-44662768 CATTTTAAGCACTCTATGGAAGG + Intergenic
949255575 3:2041754-2041776 TTTTTTAATAAGTCTCTGGATGG - Intergenic
949938840 3:9137895-9137917 GCTTTAACTCAGTCTCTGGTAGG - Intronic
950565840 3:13769026-13769048 CCTTGGACTCTGTCTCTGGAGGG + Intergenic
953035628 3:39208162-39208184 CCTGTTAATCTGTCTGTGGTTGG + Intergenic
957307948 3:78481935-78481957 CCTTTTCCTCAGGCTCTGTAAGG + Intergenic
958168888 3:89914437-89914459 CCTTTTCACAAGTCTCTTGAAGG - Intergenic
960678581 3:120222893-120222915 CTCTTTAAGCAGTCTCTGTAAGG + Intronic
960853328 3:122078135-122078157 CCTTTTACTCATTCTCTGGCCGG - Intronic
961250982 3:125505268-125505290 CCTTTTAAACTACCTCTGGAAGG - Intronic
963334191 3:143953632-143953654 CCTATCACTCAGTCTCTAGATGG - Intergenic
963481554 3:145880581-145880603 CATTTTAATCAGTTTCTCAATGG + Intergenic
963882904 3:150547858-150547880 CCTTTTAAACAGTCTTTGCCTGG - Intronic
964884887 3:161470655-161470677 CTTCTTCATCAATCTCTGGAAGG + Intergenic
966090915 3:176134960-176134982 CCTTTTCATCAGTGTCTGTAGGG - Intergenic
966222636 3:177565896-177565918 ACTTTTCCTAAGTCTCTGGAAGG + Intergenic
967185524 3:186941376-186941398 TCATTTTATCACTCTCTGGAGGG - Intronic
972063234 4:34907764-34907786 ATTTTTATTCAGTCCCTGGAAGG - Intergenic
972915065 4:43866763-43866785 CCTTTTAATCTGTGGCTTGATGG + Intergenic
973061172 4:45727217-45727239 CCTTCTAATCACTCTCTTCAAGG - Intergenic
975393717 4:73851233-73851255 ACTATGAATCAGCCTCTGGAAGG - Intergenic
982065381 4:151650102-151650124 CCTCTGAATCTGTCTCTGGCTGG - Exonic
982320352 4:154070809-154070831 CCCTTTGAGCAGACTCTGGAAGG - Intergenic
982948991 4:161664578-161664600 CCATTTAATAAGTCTCTAGGAGG + Intronic
983007573 4:162503596-162503618 CCTTTTAATCTTTTTCTTGAAGG - Intergenic
989576086 5:42990139-42990161 CCTTGATATCAGTCTCTGTAGGG + Intergenic
992478991 5:77131448-77131470 CCTTATAATCCATCTCTAGATGG - Intergenic
994277947 5:97862265-97862287 CTTTTTAACCAGTCTCTGCATGG + Intergenic
994736011 5:103557396-103557418 ATATTTAAGCAGTCTCTGGAAGG + Intronic
994956969 5:106545073-106545095 GCTTTTTATGAGTCTCTGGAAGG + Intergenic
995333632 5:110974440-110974462 ACTTTTAAACTGTCTCTTGAGGG + Intergenic
996640331 5:125743982-125744004 CCCTGTAATCAGTCTCTGCCTGG - Intergenic
997218815 5:132139851-132139873 CCTTCTAGTCAGTGTCTAGAAGG - Intergenic
997433054 5:133854617-133854639 CCTTCTAATCAGTCTCAGCTGGG + Intergenic
997664171 5:135615262-135615284 CCATTTAACAAGTCTCTGGGAGG - Intergenic
1005445059 6:25914445-25914467 CCTCTAAATCAGACTCTGGTAGG - Intronic
1007543919 6:42676202-42676224 CCTTTTTGTCAGTTTCTTGAAGG + Intronic
1009932224 6:70189923-70189945 ACTTTTAACCAATCCCTGGATGG - Intronic
1012077096 6:94703147-94703169 ACTTTTAAACAGTCTCAGGCAGG - Intergenic
1012967880 6:105695240-105695262 CCTTTTAATGAATCCCTGGAAGG + Intergenic
1013049169 6:106515289-106515311 CCTTTTAATCAGTCTGAAGTAGG + Intronic
1013741004 6:113285007-113285029 TCTTTTAATCAGTGTTTGCATGG + Intergenic
1015525169 6:134168789-134168811 CTTCTTCATCAGGCTCTGGAAGG + Intergenic
1016040190 6:139424691-139424713 CCTTTTAATCAGTTGCTAGGTGG + Intergenic
1016902773 6:149118404-149118426 CCTTGTGTTCTGTCTCTGGAAGG + Intergenic
1016972705 6:149779339-149779361 CCTTTTAAGCAGTTTGTGGCAGG - Intronic
1017172318 6:151468934-151468956 CCATTTCATCAGGCTCTGAATGG + Exonic
1017503067 6:155043325-155043347 CCAGTTAATCAATCTCTAGAGGG + Intronic
1018503029 6:164433232-164433254 CTTTTTACTCAGTCTTTGCATGG + Intergenic
1019023677 6:168940534-168940556 CTTTTTAATCAGTTTCATGATGG + Intergenic
1020882704 7:13782314-13782336 CCTTTTAATAAGTCTCAAGGAGG - Intergenic
1021274792 7:18636965-18636987 GGTTCTAATCAGTCCCTGGATGG + Intronic
1023314027 7:38916811-38916833 CCCTTTACTCAGTCTCTCAAAGG + Intronic
1023323054 7:39020978-39021000 TCTTTTAAACAGTCTCTGGCTGG + Intronic
1024061571 7:45702676-45702698 CAGCTTAATCAGTCTCTGCAGGG + Intronic
1024412065 7:49055033-49055055 TCTTTTCATCAGTCTCTAAAAGG + Intergenic
1024641125 7:51329503-51329525 CCATTTAATCTGCCTCAGGATGG + Intergenic
1027822489 7:83064684-83064706 CCTATTAATGTGTCTCTGAAAGG + Intronic
1028532081 7:91849311-91849333 CCTTTTAATAAGTCTTTGGATGG - Intronic
1029574613 7:101395288-101395310 TCTTTTAATCAGTCTGTGGTGGG - Intronic
1030349237 7:108464651-108464673 CCTTTTATTCTGTGCCTGGAAGG + Intergenic
1032888277 7:136165551-136165573 CATTTTAATTAGTCTGTGCATGG - Intergenic
1034025989 7:147704616-147704638 CCTCTTCTTCAGTCTTTGGACGG + Intronic
1036508713 8:9380704-9380726 ACATTTTATCTGTCTCTGGATGG + Intergenic
1037145190 8:15563316-15563338 CCTGTTAAGTAGTCTCTGAAAGG + Intronic
1037537674 8:19840966-19840988 CCACCTAATCAGTTTCTGGAAGG - Intronic
1037960823 8:23096758-23096780 CCTTTTAAGCAGTTTGTGGCAGG + Intronic
1039784088 8:40817287-40817309 GCCTTAAATCAGTCTCAGGAAGG + Intronic
1039990530 8:42483846-42483868 CATTTTAAACTGTCTCTGAAGGG - Intronic
1040483988 8:47853265-47853287 CCTTTTAGACAGTCACTGGCTGG - Intronic
1043498197 8:80825916-80825938 CATTTAAAGCAGTGTCTGGAGGG + Intronic
1051208545 9:14715872-14715894 GATTGTAATCAGTGTCTGGAAGG - Intergenic
1051986418 9:23094320-23094342 TCTTTTGATCATTCTCTGTATGG + Intergenic
1052223430 9:26055162-26055184 CTTTTTTTTCAGTATCTGGAAGG + Intergenic
1058054316 9:100434225-100434247 CCTTTGAAACAGTCTTTGGCTGG + Intronic
1058970799 9:110081068-110081090 TCTTTCATTCAGTCTCCGGAAGG - Intronic
1059422981 9:114204512-114204534 CCTTCTCATCAGTATCTGGATGG + Intronic
1060502312 9:124169859-124169881 TCTTTTAATTAGTGTTTGGAAGG + Intergenic
1185874459 X:3691135-3691157 CCTTTTAAGCAGTTTGTGGCGGG + Intronic
1186304287 X:8238304-8238326 GATTTTAATAAGTTTCTGGAAGG - Intergenic
1187201827 X:17141491-17141513 TTTTTTAATAAGTCTCTGTATGG + Intronic
1188012918 X:25076399-25076421 CAATTAAATGAGTCTCTGGAGGG - Intergenic
1190971758 X:55356709-55356731 CCTCTTAGGCAGTCTCTAGAGGG - Intergenic
1191699286 X:64022109-64022131 ACTTTTATTCCATCTCTGGATGG - Intergenic
1192035576 X:67559372-67559394 CCTTTTGTCCAGTCTCTGGAAGG - Intronic
1192751651 X:73998369-73998391 CCTTGTAATCTCTCCCTGGAAGG + Intergenic
1194452342 X:94060066-94060088 CCTGTTATTCAGGCTCTTGAGGG + Intergenic
1195296026 X:103478410-103478432 CCTTTTAATCAGACTTAGCAAGG - Intergenic
1196101802 X:111854473-111854495 TCATTTAGTCAGTCTGTGGAAGG - Intronic
1201574436 Y:15446901-15446923 CCTTTTCAGCAGTGTCTGGCAGG - Intergenic