ID: 1093621664

View in Genome Browser
Species Human (GRCh38)
Location 12:21297708-21297730
Sequence GCTATGACTTCAGCTTTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 175}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093621664_1093621670 21 Left 1093621664 12:21297708-21297730 CCCTTGAAAGCTGAAGTCATAGC 0: 1
1: 0
2: 2
3: 20
4: 175
Right 1093621670 12:21297752-21297774 AGTCAGTGATGTAGCTGACTGGG 0: 1
1: 0
2: 1
3: 7
4: 122
1093621664_1093621667 -10 Left 1093621664 12:21297708-21297730 CCCTTGAAAGCTGAAGTCATAGC 0: 1
1: 0
2: 2
3: 20
4: 175
Right 1093621667 12:21297721-21297743 AAGTCATAGCAATGTTTTGGTGG 0: 1
1: 0
2: 0
3: 22
4: 250
1093621664_1093621672 26 Left 1093621664 12:21297708-21297730 CCCTTGAAAGCTGAAGTCATAGC 0: 1
1: 0
2: 2
3: 20
4: 175
Right 1093621672 12:21297757-21297779 GTGATGTAGCTGACTGGGTAGGG 0: 1
1: 0
2: 0
3: 10
4: 110
1093621664_1093621671 25 Left 1093621664 12:21297708-21297730 CCCTTGAAAGCTGAAGTCATAGC 0: 1
1: 0
2: 2
3: 20
4: 175
Right 1093621671 12:21297756-21297778 AGTGATGTAGCTGACTGGGTAGG 0: 1
1: 0
2: 0
3: 12
4: 116
1093621664_1093621669 20 Left 1093621664 12:21297708-21297730 CCCTTGAAAGCTGAAGTCATAGC 0: 1
1: 0
2: 2
3: 20
4: 175
Right 1093621669 12:21297751-21297773 AAGTCAGTGATGTAGCTGACTGG 0: 1
1: 0
2: 0
3: 13
4: 159
1093621664_1093621668 -3 Left 1093621664 12:21297708-21297730 CCCTTGAAAGCTGAAGTCATAGC 0: 1
1: 0
2: 2
3: 20
4: 175
Right 1093621668 12:21297728-21297750 AGCAATGTTTTGGTGGCTTCTGG 0: 1
1: 0
2: 0
3: 23
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093621664 Original CRISPR GCTATGACTTCAGCTTTCAA GGG (reversed) Intronic
900775215 1:4578535-4578557 CCTAGGAATTCAGCTATCAAGGG - Intergenic
901753100 1:11423972-11423994 GCCATAACTGCAGCTTTCAAAGG + Intergenic
901977964 1:13010429-13010451 GCCATGACTCCAGCTTTGATTGG - Intronic
902004122 1:13218508-13218530 GCCATGACTCCAGCTTTGATTGG + Intergenic
902023346 1:13364249-13364271 GCCATGACTCCAGCTTTGATTGG + Intergenic
902205894 1:14867815-14867837 GCTATGTCCTCAGCTTTCCTGGG + Intronic
908692108 1:66793826-66793848 GATATGACTTCAGATTTACATGG - Intergenic
912619162 1:111138351-111138373 GCAATGCTTTCAGGTTTCAAAGG - Intronic
912734080 1:112134609-112134631 CCTTTGACTTCTGCTCTCAAAGG + Intergenic
913361343 1:117983709-117983731 GCTATGTCATCAGCTATCACTGG + Intronic
916498503 1:165366574-165366596 TCCATGATTTCAGCTTGCAATGG + Intergenic
917723256 1:177806499-177806521 CCTATGAATCCAGCTTACAAGGG + Intergenic
918822734 1:189277396-189277418 GTTATGTTTTCAGCTTTTAAAGG + Intergenic
919467137 1:197935695-197935717 GCTTTAACTTCAACATTCAAGGG + Intergenic
922462212 1:225822647-225822669 GCTAAGCCTTCACCTTTCCAAGG - Intronic
922707820 1:227799056-227799078 GCCATGACTGCAGCGTTCAATGG + Intergenic
923130887 1:231073753-231073775 GCCATAACTACAGCTTTCATTGG + Intergenic
923524836 1:234764474-234764496 GCTTTAACTTCAGCTTTGCATGG + Intergenic
924397118 1:243632640-243632662 GCAATGACTTCTCCTTTCTAAGG + Intronic
1063276993 10:4580270-4580292 GCCATGACTCCAGCTTTGACTGG - Intergenic
1063462478 10:6223343-6223365 GCTAAGACTTAACATTTCAATGG - Intronic
1066384796 10:34933003-34933025 GGTGTGACTTCAACCTTCAATGG - Intergenic
1067989144 10:51190025-51190047 GCTTTGACTTCACATTTCTAAGG - Intronic
1070220583 10:74439102-74439124 GTTATTACTTTAGCTTTCACTGG + Intronic
1071116314 10:82224664-82224686 GGTATCACTTCAGCCTTCTAGGG - Intronic
1074873424 10:117595644-117595666 GCCATGGCTTCAGCTCTCAGTGG - Intergenic
1078392028 11:10943644-10943666 GAAATGAGTCCAGCTTTCAAAGG + Intergenic
1080904515 11:36527790-36527812 GCTAGGAATCCAGCTTACAAAGG - Intronic
1082196896 11:49317066-49317088 GCTATGAATTCATCTTTCAAAGG - Intergenic
1083114561 11:60447800-60447822 GCAATGACTTCTGCTTGTAAGGG + Intronic
1084969131 11:72760308-72760330 GCTCTGCCTTCCGGTTTCAAAGG + Intronic
1086022829 11:82252535-82252557 CCTCTGCCTTCAGGTTTCAAAGG - Intergenic
1086658930 11:89391125-89391147 GCTATGAATTCATCTTTCAAAGG + Intronic
1087652661 11:100886147-100886169 GCTATCTCTTTAGATTTCAAAGG + Intronic
1088085215 11:105969900-105969922 GATGTGACTTCTGCTCTCAAAGG + Intronic
1090153424 11:124409998-124410020 GCTCTGAATTCAGCTTTCTGGGG - Intergenic
1090512437 11:127389955-127389977 GCTGTGGCTTCAGCTTCTAAAGG + Intergenic
1090763938 11:129860792-129860814 GCTGTGACTTCAACTCTGAAAGG - Intergenic
1090877267 11:130801841-130801863 GCAATAACCTCAGCTTTCCACGG + Intergenic
1090947539 11:131445007-131445029 ACTATGACTTCAGGTTGCTATGG - Intronic
1091844513 12:3645547-3645569 GATCTGGCTTCAGTTTTCAAAGG + Intronic
1091900679 12:4141686-4141708 GCTATGGTTGCAGCTTTCAGTGG + Intergenic
1093621664 12:21297708-21297730 GCTATGACTTCAGCTTTCAAGGG - Intronic
1095044160 12:37481361-37481383 GCTATGGCCTCAGCTCTCAAGGG + Intergenic
1098041670 12:66359220-66359242 GCTAAATCTTAAGCTTTCAATGG + Intronic
1098112285 12:67135496-67135518 GCTATCACCTCAGCATTCATGGG - Intergenic
1099709345 12:86201134-86201156 GCTGTGGCTTATGCTTTCAAGGG + Intronic
1100042494 12:90337437-90337459 ACTCTGATTTAAGCTTTCAAAGG - Intergenic
1100269857 12:93014404-93014426 TCTCTGACCTCAGCTTTCACAGG - Intergenic
1101346945 12:103894604-103894626 GTAATGACTTCATCTTTCAGTGG + Intergenic
1101545076 12:105704847-105704869 GCTATGAACACAGCTTTGAACGG - Intergenic
1102908764 12:116696821-116696843 GCTCTCACTTAAGCTTCCAAAGG + Intergenic
1105822733 13:24094304-24094326 GTTTTGACTGCAGCTTTCCACGG + Intronic
1108249071 13:48547021-48547043 GCTATGAACACAGATTTCAATGG + Intergenic
1109088243 13:58005075-58005097 TATATGACTTCAACTTTTAAAGG - Intergenic
1109387482 13:61651172-61651194 GTTATGAGTTCAGTTTTAAATGG + Intergenic
1109580277 13:64322226-64322248 ACTATTACACCAGCTTTCAAAGG + Intergenic
1111337477 13:86841251-86841273 TCTATGAATTCAGCTTTCTTAGG + Intergenic
1112520429 13:100089558-100089580 GCTTTGTCTTAAGCTTTCCAGGG + Intronic
1113492071 13:110700038-110700060 GCTCTGACTTCAGCTATCTCTGG - Intronic
1114152967 14:20065193-20065215 GCAATGACTTCAGCTGTTACAGG - Intergenic
1114797121 14:25728807-25728829 CCTATGAATTCAACTTACAAGGG - Intergenic
1118060479 14:62132449-62132471 GCTATAACTTCCACTTACAATGG - Intergenic
1119916776 14:78409574-78409596 GATATGAATTTAGCATTCAAAGG + Intronic
1120942411 14:89961315-89961337 GCCATGACTGCAGCTGTCATTGG - Intronic
1123006655 14:105327029-105327051 GCTATGGCTTCAGCTGGAAACGG + Intronic
1125299764 15:38242143-38242165 TGTATAACTTCAGCTTTCAAAGG - Intergenic
1126744702 15:51814217-51814239 GCTAAGACTTCAGGTTTGACTGG + Exonic
1127256659 15:57299031-57299053 GCCATGACATCAGCTGGCAAAGG + Intronic
1129891130 15:79072699-79072721 GGTGGGAGTTCAGCTTTCAAAGG - Intronic
1130199191 15:81809411-81809433 GCCATGGCTTCAGCTTCCTATGG - Intergenic
1131201639 15:90402248-90402270 GCTTTGAATTCAGCTTAGAAAGG + Intronic
1133012642 16:2923174-2923196 GCTTTGGCTTCAGCTTTACAAGG + Intronic
1137280797 16:46974715-46974737 GCTATCAGTTCAGGTTCCAAGGG - Intergenic
1144337682 17:14286447-14286469 GCTGTGACTACAGCTTTGATTGG - Intergenic
1144437772 17:15256853-15256875 GCTACGACTTCAGCCTTAAGTGG - Intronic
1145775293 17:27523777-27523799 GCTTTCACATCAGCTTTCCAGGG + Intronic
1148936862 17:51170091-51170113 GCCATGACGTCTGCTTTAAATGG - Intronic
1150452317 17:65279182-65279204 GCTATTTCTTCAGCCTCCAAGGG - Intergenic
1150912771 17:69406031-69406053 GCTACCGCTTCAGCTTTCAAAGG - Intergenic
1152448263 17:80359176-80359198 GCTTCCACTTCAGCTTTCAGGGG + Intronic
1155014728 18:21822154-21822176 GCAATTACTTCAGATTACAATGG + Intronic
1156674878 18:39515399-39515421 ACTATGAATTCTGTTTTCAAAGG + Intergenic
1158159873 18:54468984-54469006 GATATTACTTCTGCTCTCAAAGG - Intergenic
1163963481 19:20720356-20720378 CCTAGGACTCCAGCTTTCAAAGG - Intronic
1166538191 19:43589043-43589065 CCTTTGTCTTCAGCTTTTAAGGG + Exonic
1166772438 19:45291934-45291956 GCTTTGACTTCAGCTCACACAGG - Intronic
925495820 2:4448008-4448030 GCTGTAACTACAGCTTTCACTGG + Intergenic
926376425 2:12232709-12232731 GCTTTGACTTTAACTTTCAGTGG - Intergenic
926667077 2:15537302-15537324 GGTATGACTTCTGGTTTCCAGGG - Intronic
931854350 2:66286024-66286046 CCCATGACTTCAGCCTCCAAGGG + Intergenic
933259364 2:80114779-80114801 GCTGTGACTTCAGCTTGACAAGG + Intronic
933324619 2:80819558-80819580 GCTAGGAATACAGCTTACAAGGG + Intergenic
933553502 2:83804706-83804728 GCTAGGACTTTAGTCTTCAAGGG - Intergenic
933945189 2:87279895-87279917 ACAATGACTTCAGCTTTCCAGGG + Intergenic
934977174 2:98811094-98811116 GTTATGACTGCAGTGTTCAAGGG + Intronic
935507699 2:103926820-103926842 TCATTGACTTCAGCTGTCAATGG + Intergenic
935811294 2:106800088-106800110 GCTCTGACTTCAACTTTCCTTGG + Intergenic
936335017 2:111581696-111581718 ACAATGACTTCGGCTTTCCAGGG - Intergenic
937691934 2:124766338-124766360 GACATGACTTATGCTTTCAAGGG - Intronic
937752123 2:125488780-125488802 TCTATAAGTTCAGATTTCAAGGG + Intergenic
939351833 2:141048074-141048096 GGAATGACTTCTGCCTTCAAGGG - Intronic
940685316 2:156842244-156842266 GCTATGACTTTAGCATAGAAAGG + Intergenic
942568081 2:177286273-177286295 GCCATAACTACAGCTTTCATTGG + Intronic
944335575 2:198529805-198529827 TCTATGAATACAGCTTACAAGGG + Intronic
945481915 2:210355028-210355050 GCTAGGAATCCAGCTTACAAGGG + Intergenic
946436487 2:219659720-219659742 GATATGATTTCTGCTTTTAAAGG - Intergenic
947092732 2:226530857-226530879 GCTAGTATTTCAGCTTTCTATGG + Intergenic
948075384 2:235161771-235161793 ACTATGACGTCACCTTGCAAAGG + Intergenic
1170097298 20:12660456-12660478 GCTATGACTGCAGCTCCCAAGGG - Intergenic
1170363556 20:15574722-15574744 GGTGTGGCTTCAGCCTTCAAGGG + Intronic
1170375051 20:15691081-15691103 GCTCTGACTTCAGAGTTCTAAGG + Intronic
1171169178 20:23000371-23000393 CCTGTGACTTCATCTTCCAAAGG + Intergenic
1172014755 20:31866683-31866705 GCTGTGACTTCACCTCTCTAGGG - Intronic
1173441169 20:43077556-43077578 GCTAAGAGCTCAGCTTTCAGAGG + Intronic
1175942644 20:62545012-62545034 TTTATGACTTCATTTTTCAAGGG + Intergenic
1177265571 21:18778953-18778975 TCTATGATATAAGCTTTCAAAGG - Intergenic
949826361 3:8169630-8169652 GATCTGACTTCTGTTTTCAAAGG - Intergenic
951031119 3:17882561-17882583 GCTCTGACTTCTGTTTTTAAAGG + Intronic
951082275 3:18466592-18466614 TCTATGACTTCAGCATTAAAAGG + Intergenic
951406313 3:22303393-22303415 GCTAGGACTTTTCCTTTCAAAGG - Intronic
953159657 3:40406473-40406495 GATATGACTTCTGTTTTTAACGG + Intronic
953355179 3:42249862-42249884 TCTATTACTTCAGTTCTCAAAGG - Intergenic
953749248 3:45596568-45596590 GCTGTGACTTTGGATTTCAAGGG + Intronic
956972365 3:74541207-74541229 GCTATGCCTTCAGCTTGAAATGG - Intergenic
957650823 3:83000804-83000826 GCTATCACTTCTTTTTTCAATGG + Intergenic
958733080 3:97979240-97979262 GCCATAACTTCAGCTTTGATTGG - Intergenic
958832187 3:99102904-99102926 CCTATGCCTTGAGGTTTCAACGG + Intergenic
962057276 3:131885881-131885903 GCTATTAATTCAGTTTTAAAAGG + Intronic
962607841 3:137047276-137047298 ACTGTGGCCTCAGCTTTCAAAGG - Intergenic
962641967 3:137396939-137396961 CCTAGGAATTCAGCTTACAAGGG + Intergenic
964029246 3:152117417-152117439 CCTATGAATCCAGCTTACAAGGG - Intergenic
964029763 3:152124031-152124053 GCCATGACTTCAACTATAAATGG + Intergenic
964901795 3:161669169-161669191 CCTATGCCTCCAGGTTTCAAGGG + Intergenic
966116684 3:176472074-176472096 GCTACGACTATGGCTTTCAATGG + Intergenic
966464303 3:180212824-180212846 GCTGTGTCTCCAGCTTTCTATGG + Intergenic
969249846 4:5959982-5960004 GACATGACTTCCCCTTTCAAGGG - Intronic
973904787 4:55518115-55518137 GCTATTGTTTCAGCTTTAAAAGG + Intronic
974795718 4:66746550-66746572 ACTAAGAATTCAGCTTTTAATGG - Intergenic
975035152 4:69670211-69670233 ACTCTTACTTCAACTTTCAAAGG - Intergenic
975215494 4:71749085-71749107 GCTATGAGATCAGTTTACAAAGG + Intronic
980423470 4:132594123-132594145 GCCATAACTACAGCTTTCATTGG - Intergenic
983067857 4:163232293-163232315 GCTATGCATTCACCTTCCAAAGG - Intergenic
984209206 4:176825071-176825093 TCTATGACATCAGCTTTGAAAGG - Intergenic
984491949 4:180445133-180445155 GCTGTGACTTGAGCTATTAATGG - Intergenic
984820603 4:183878370-183878392 GCTATTACTTAAGCTTTCATTGG + Intronic
985034581 4:185825121-185825143 GCAGTTACTGCAGCTTTCAAAGG + Intronic
986838427 5:11668482-11668504 CCTAGGAATTCAGCTTACAAGGG - Intronic
990525197 5:56618601-56618623 GCTATGGCTTTTGCTTTCATAGG + Intergenic
990760765 5:59127081-59127103 GTTGTGATTTCAGCTTTCACAGG - Intronic
993509569 5:88754745-88754767 GGCATGACTTAAGCTTTTAAAGG - Intronic
994018214 5:94993462-94993484 GCCATGACTTTACATTTCAAAGG + Intronic
994629892 5:102272301-102272323 GTTATTACTTCAGCTTTCTAAGG + Intronic
997753140 5:136369289-136369311 GCTATAACTGCAGATTTCAATGG + Intronic
997754022 5:136377669-136377691 GCTATGGCTTCAGATCTCATTGG + Intronic
997836466 5:137197343-137197365 ACTATGAATTCTGCTTTGAAAGG + Intronic
997859532 5:137403914-137403936 GCTCTGACTTAAATTTTCAAAGG + Intronic
999253401 5:150195979-150196001 GCAATGACTTCATCCTCCAATGG + Intronic
1000770789 5:165351135-165351157 GCCATGACTGCAGTTTTTAAAGG + Intergenic
1006052021 6:31352610-31352632 GATATGACTTCTGTTTTAAAAGG - Intronic
1006802267 6:36766712-36766734 GTTATTACTTCTCCTTTCAATGG - Intronic
1009312877 6:62178176-62178198 GCTATTACTTCAGATTTGAAGGG + Intronic
1009585787 6:65599875-65599897 GCTATGTCCTCAGATTTCTACGG + Intronic
1015309585 6:131751660-131751682 GCTATAACTACAGCTTTGATTGG + Intergenic
1015449512 6:133348867-133348889 GCTCTGACTTAATCTTTTAATGG - Intronic
1018207525 6:161449546-161449568 GCTTTGACTTAAGATTTCCATGG - Intronic
1018811813 6:167303883-167303905 GCAAAGGCTTCAGCTTTCATGGG - Intronic
1019788081 7:2992242-2992264 GCTATCATTTCAGATTTCAAGGG - Intronic
1023568767 7:41551300-41551322 GCTAGGAATTCAACTTACAAGGG - Intergenic
1024538113 7:50455044-50455066 GCTATGGAGTCAGCTTTCCAGGG + Intronic
1024595683 7:50934546-50934568 GCTATAAGTTCTGCTTTAAATGG + Intergenic
1025290086 7:57710908-57710930 GCTATGGCCTCAGCTCTCAAGGG + Intergenic
1026312738 7:69201802-69201824 GCAATGACTTCAACTATCAGTGG - Intergenic
1026467830 7:70669704-70669726 ACGATGACTTCAACTCTCAAAGG - Intronic
1027158679 7:75786584-75786606 GCTTTGACTCCAGCTTTCTTTGG - Intronic
1028145994 7:87320475-87320497 GCTAGGAATACAACTTTCAAGGG + Intergenic
1028811855 7:95096866-95096888 GCAAAGACTTCAGCCTGCAATGG - Intronic
1043079273 8:75745345-75745367 TCTATGGTTTCAGCTTCCAATGG + Intergenic
1046549678 8:115699044-115699066 GCCTTGTCTTCAACTTTCAAAGG - Intronic
1046777502 8:118179635-118179657 GTAATGACTTCACCTTTAAAAGG - Intergenic
1046938860 8:119911792-119911814 GCTATGAACACAGCTATCAAAGG + Intronic
1047890395 8:129302760-129302782 GCTAGGAATTCAGGTTTCTAAGG + Intergenic
1047910434 8:129522570-129522592 GCTATTACTTCTTCTTTAAATGG - Intergenic
1052549127 9:29925427-29925449 TCAATGACTTGTGCTTTCAAGGG - Intergenic
1054756486 9:68963860-68963882 GCTCTGACAGTAGCTTTCAATGG + Intronic
1055813421 9:80178099-80178121 GCTCTGGCTGCTGCTTTCAAGGG - Intergenic
1060963861 9:127700829-127700851 GCCATAACTACAGCTTTCATTGG + Intronic
1186838355 X:13460002-13460024 ACTAAGACTTCATCCTTCAAAGG + Intergenic
1186882086 X:13876693-13876715 GCTGTGACTTGAGCTTGCACAGG - Intronic
1189105146 X:38228050-38228072 GCTATGACTTCAGCTCCCATGGG - Intronic
1192572059 X:72214121-72214143 GCCATGACTTGGGCTTTAAATGG - Intronic
1195288056 X:103404762-103404784 GTTATGACGTCAGGTTTCTATGG - Intergenic
1195843146 X:109196407-109196429 CCTAGGAATACAGCTTTCAAGGG + Intergenic
1197822857 X:130559225-130559247 GCTATGACTGAAGCAATCAACGG + Intergenic
1198307712 X:135399333-135399355 GCCATAACTACAGCTTTCACTGG - Intergenic
1199824875 X:151488947-151488969 GCTCTGACCTCTCCTTTCAAGGG - Intergenic
1201641477 Y:16182323-16182345 TCTAGGACTTCAGTTTTCAAAGG + Intergenic
1201661338 Y:16402999-16403021 TCTAGGACTTCAGTTTTCAAAGG - Intergenic