ID: 1093633497

View in Genome Browser
Species Human (GRCh38)
Location 12:21437736-21437758
Sequence GGCAGCGCGCCCTCCCCCGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 115}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093633489_1093633497 18 Left 1093633489 12:21437695-21437717 CCGCGATATTCAGTAAACCACTG 0: 2
1: 0
2: 0
3: 8
4: 71
Right 1093633497 12:21437736-21437758 GGCAGCGCGCCCTCCCCCGACGG 0: 1
1: 0
2: 0
3: 12
4: 115
1093633486_1093633497 30 Left 1093633486 12:21437683-21437705 CCCGTTGCTCCGCCGCGATATTC 0: 1
1: 0
2: 0
3: 2
4: 6
Right 1093633497 12:21437736-21437758 GGCAGCGCGCCCTCCCCCGACGG 0: 1
1: 0
2: 0
3: 12
4: 115
1093633487_1093633497 29 Left 1093633487 12:21437684-21437706 CCGTTGCTCCGCCGCGATATTCA 0: 1
1: 0
2: 0
3: 0
4: 15
Right 1093633497 12:21437736-21437758 GGCAGCGCGCCCTCCCCCGACGG 0: 1
1: 0
2: 0
3: 12
4: 115
1093633488_1093633497 21 Left 1093633488 12:21437692-21437714 CCGCCGCGATATTCAGTAAACCA 0: 2
1: 0
2: 0
3: 1
4: 22
Right 1093633497 12:21437736-21437758 GGCAGCGCGCCCTCCCCCGACGG 0: 1
1: 0
2: 0
3: 12
4: 115
1093633493_1093633497 1 Left 1093633493 12:21437712-21437734 CCACTGGGAGTCCGGCAGCATGG 0: 1
1: 1
2: 1
3: 11
4: 138
Right 1093633497 12:21437736-21437758 GGCAGCGCGCCCTCCCCCGACGG 0: 1
1: 0
2: 0
3: 12
4: 115
1093633496_1093633497 -10 Left 1093633496 12:21437723-21437745 CCGGCAGCATGGAGGCAGCGCGC 0: 1
1: 1
2: 0
3: 5
4: 131
Right 1093633497 12:21437736-21437758 GGCAGCGCGCCCTCCCCCGACGG 0: 1
1: 0
2: 0
3: 12
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093633497 Original CRISPR GGCAGCGCGCCCTCCCCCGA CGG Exonic