ID: 1093636126

View in Genome Browser
Species Human (GRCh38)
Location 12:21470968-21470990
Sequence GTCCACGCAGAACTCTTTCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 1, 2: 0, 3: 7, 4: 83}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093636126 Original CRISPR GTCCACGCAGAACTCTTTCA GGG (reversed) Exonic
904149636 1:28426849-28426871 GCCCACTCAGAATTCTTCCACGG - Intronic
908462959 1:64363994-64364016 GTCCCTGCAGATCTCTTTGAAGG - Intergenic
910079762 1:83327720-83327742 GTCCACCAATAACTCTTTCATGG - Intergenic
910608509 1:89114048-89114070 CTTCATGAAGAACTCTTTCAAGG - Exonic
911563356 1:99433244-99433266 GGCCAAGCAGAGCTCTTTCCTGG - Intergenic
913045149 1:115067985-115068007 GTCCACGCTAGTCTCTTTCAGGG - Intronic
913655908 1:120959373-120959395 CTCCACTCAGAATTCCTTCATGG + Intergenic
914520461 1:148410605-148410627 CTCCACTCAGAATTCCTTCATGG + Intergenic
918305559 1:183242966-183242988 GCCCTCTCAGAACTCTTTCTAGG + Intronic
921914628 1:220593748-220593770 GTCCCCTCAGAACACATTCAGGG - Intronic
923301923 1:232649268-232649290 GTCTACAGAGAACTATTTCACGG + Intergenic
923766323 1:236895375-236895397 GTTCTCGGCGAACTCTTTCATGG - Exonic
1067763698 10:49069645-49069667 GTCCAGGCAGGACTCATTCCTGG - Intronic
1076238308 10:128882975-128882997 GTCCATGCAGAATTCCATCATGG + Intergenic
1079535056 11:21504103-21504125 GCTCTCGCAGACCTCTTTCATGG - Intronic
1087157647 11:94920609-94920631 GGACAAGCAGAACTCTTGCAAGG + Intergenic
1088157387 11:106824162-106824184 GTCCACACAGAACTCTTTCAGGG + Intronic
1093624765 12:21332009-21332031 CTCCACTCAGAATCCTTTCATGG + Intronic
1093636126 12:21470968-21470990 GTCCACGCAGAACTCTTTCAGGG - Exonic
1096514331 12:52147895-52147917 TTCCTCTCAGAACTGTTTCAAGG - Intergenic
1103629094 12:122245031-122245053 TTCCACTCAGAAAACTTTCAAGG + Intronic
1107052791 13:36069969-36069991 GTCAACAAAGAACTCTTTGAGGG + Intronic
1109023991 13:57137834-57137856 GACCATGCAGACCTCTTTGATGG + Intergenic
1116183386 14:41564916-41564938 GTACACACAGACCTCCTTCAAGG - Intergenic
1116951979 14:50886916-50886938 GGCCAAGGAGGACTCTTTCAAGG - Intronic
1118922984 14:70167022-70167044 GCCCACGGAGAACTCCTTCTGGG + Exonic
1119603549 14:75994842-75994864 GCCCTCACAGAACTCTTTTAAGG + Intronic
1139578191 16:67855672-67855694 CTCCACACAGAGCTCTTTCCTGG - Intronic
1144425124 17:15134254-15134276 GTCCACACAAAACACTTTCATGG + Intergenic
1145418830 17:22749721-22749743 GGACATGCAGAACTCTTTGAAGG + Intergenic
1145420772 17:22826899-22826921 GGACATGCAGAACTCTTTGAAGG + Intergenic
1145431833 17:22979164-22979186 GGACATGCAGAACTCTTTGAAGG + Intergenic
1147561162 17:41510099-41510121 CACCACCCAGAAGTCTTTCAAGG + Intergenic
1148237117 17:45976339-45976361 GTCCCAGCACAACTGTTTCAAGG - Intronic
1151407148 17:73895818-73895840 GTTCACGCAGATGACTTTCAGGG - Intergenic
1152532668 17:80929041-80929063 CTCCGGGCAGAACCCTTTCATGG - Intronic
1157223825 18:45845498-45845520 CTCCACCCAGACCTCTTACAGGG - Intergenic
1159128029 18:64247534-64247556 GTCCATGCAGAGCTATTGCAGGG - Intergenic
1159584533 18:70271250-70271272 GTTCAGTCAGATCTCTTTCATGG - Intergenic
1159798885 18:72872565-72872587 GTCCACGCACTGCTATTTCAGGG + Intergenic
926294044 2:11554422-11554444 GGGAAAGCAGAACTCTTTCAGGG + Intronic
926930830 2:18039098-18039120 GTCCTCTCAGAACTCTTCCAGGG + Intronic
929241011 2:39653404-39653426 GTATACGCAAAACTCTTTCAAGG - Intergenic
938628130 2:133134271-133134293 TTCCACAAAAAACTCTTTCAAGG + Intronic
938755048 2:134371793-134371815 GTCCAGGCAGGACTCTGACATGG + Intronic
943765202 2:191653632-191653654 GTCTACACAATACTCTTTCAAGG - Intergenic
946956004 2:224930682-224930704 GTCCATGCAAACCTCTATCAGGG - Intronic
947391450 2:229643510-229643532 GACCAGGCAGACCTGTTTCAGGG - Intronic
948665886 2:239534748-239534770 CTCCACGCAGAAGTTCTTCACGG - Intergenic
1169625667 20:7565616-7565638 GGCCATGAAGAACTGTTTCAAGG - Intergenic
1169651422 20:7872332-7872354 GGCCACACTGAACGCTTTCAGGG - Intergenic
1177415150 21:20783303-20783325 GTGTAAGCAGAACTCCTTCAGGG + Intergenic
1177429279 21:20969591-20969613 ATCCAGGCAGCACTGTTTCATGG + Intergenic
1178265392 21:31138090-31138112 CTCCCAGCAGAACTCTTTCTTGG - Intronic
1182232176 22:28846644-28846666 GTCCACACCGAACTCCTTGAGGG - Intergenic
1182426288 22:30274684-30274706 GTCCACGCTGCACCTTTTCAGGG + Intergenic
1184066569 22:42124926-42124948 GTCCAGCCAGAGCTCTGTCATGG - Intergenic
1184069037 22:42137078-42137100 GTCCAGCCAGAGCTCTGTCATGG - Intergenic
1184292000 22:43502383-43502405 GCCCATGCTGAGCTCTTTCAAGG + Intronic
951780434 3:26356957-26356979 GTCCAAGCAGCACACTTCCATGG + Intergenic
959089773 3:101889574-101889596 GTTCACGGAGAACTTTTACAGGG - Intergenic
961675378 3:128561886-128561908 TTCCATCCTGAACTCTTTCAAGG - Intergenic
962341687 3:134591004-134591026 TTCCAAGCAGACCTCTTTCTTGG + Intergenic
962704253 3:138027967-138027989 GTTCTCCCAGAACTTTTTCAAGG + Intronic
963311533 3:143715284-143715306 GTCCACACAGCTCTCTTTCCAGG + Intronic
963753452 3:149207497-149207519 GTGCACGCAGCTTTCTTTCACGG - Exonic
965864312 3:173185837-173185859 GTCCAGGCAGAATTCAATCAGGG - Intergenic
983299446 4:165906680-165906702 GTCTACTCACAATTCTTTCATGG - Intronic
990302154 5:54459937-54459959 GTCCAAGGAGACCTCTTACAGGG + Intergenic
992878421 5:81081064-81081086 TTCCACACAGACCTCTTTCATGG + Intronic
993662591 5:90656672-90656694 CTCCACCCAGATGTCTTTCAGGG - Intronic
998577096 5:143328045-143328067 GTCCAGGCAGAAGTCTGCCATGG - Intronic
1000938601 5:167333036-167333058 GTCCACGCACTACTGTTTCTGGG - Intronic
1001542508 5:172549505-172549527 CTCCACGCAGAACTCAGTGAAGG - Intergenic
1004181157 6:13381541-13381563 GTCCATGCAGAACCCTTTCCTGG - Intronic
1008061182 6:46998528-46998550 CTCAACACAGAACTCATTCAGGG + Exonic
1011581859 6:88877146-88877168 GTTCACTCAGAATTCTTTTAGGG - Intronic
1013774745 6:113666971-113666993 ATCCACCCAGCAATCTTTCAGGG - Intergenic
1016769200 6:147829676-147829698 GTCCACCAAGAGCTCTTTCCAGG + Intergenic
1017709596 6:157155412-157155434 GTCCACGAAGGGCTCTCTCAGGG - Intronic
1023033475 7:36110346-36110368 TGCCACCCAGAACTCTTCCAGGG - Intergenic
1027297525 7:76792997-76793019 GTCCACCAATAACTCTTTCATGG - Intergenic
1037324213 8:17672559-17672581 GTCCAGGAAGAACACTCTCAAGG - Intronic
1043155388 8:76772278-76772300 ATCCACTCAGAAATCTCTCAAGG - Intronic
1044665364 8:94629098-94629120 GGCCACCCAGAACTCTCTCCTGG - Intergenic
1058300521 9:103366217-103366239 AGCCATGCAGAACTCTCTCAAGG + Intergenic
1060375080 9:123110180-123110202 CTCCAAGCAGAACTCTGTCTGGG - Intronic
1060767701 9:126307419-126307441 GTCCACACAGAACCCTGTCGAGG - Intergenic
1062516682 9:136940461-136940483 GTCCACGCACCACCCGTTCAGGG - Exonic
1186317332 X:8385217-8385239 GTTCACACAGATCTCTTTCCTGG - Intergenic
1186487639 X:9945986-9946008 GGCCACGCAGAACGCTGTCCTGG + Intronic
1188445245 X:30248111-30248133 CTCCACTCAGCACTCTTTCTGGG - Intronic