ID: 1093636670

View in Genome Browser
Species Human (GRCh38)
Location 12:21479246-21479268
Sequence GACACTGTTATGTACAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 114}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093636663_1093636670 30 Left 1093636663 12:21479193-21479215 CCGTTATCCCATAACATTCATCG 0: 1
1: 0
2: 0
3: 14
4: 81
Right 1093636670 12:21479246-21479268 GACACTGTTATGTACAAGGCAGG 0: 1
1: 0
2: 1
3: 4
4: 114
1093636666_1093636670 -9 Left 1093636666 12:21479232-21479254 CCTGAACCCTGACTGACACTGTT 0: 1
1: 1
2: 0
3: 14
4: 159
Right 1093636670 12:21479246-21479268 GACACTGTTATGTACAAGGCAGG 0: 1
1: 0
2: 1
3: 4
4: 114
1093636664_1093636670 23 Left 1093636664 12:21479200-21479222 CCCATAACATTCATCGTGACTCT 0: 1
1: 0
2: 0
3: 9
4: 73
Right 1093636670 12:21479246-21479268 GACACTGTTATGTACAAGGCAGG 0: 1
1: 0
2: 1
3: 4
4: 114
1093636665_1093636670 22 Left 1093636665 12:21479201-21479223 CCATAACATTCATCGTGACTCTG 0: 1
1: 0
2: 0
3: 6
4: 63
Right 1093636670 12:21479246-21479268 GACACTGTTATGTACAAGGCAGG 0: 1
1: 0
2: 1
3: 4
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093636670 Original CRISPR GACACTGTTATGTACAAGGC AGG Intronic
901029800 1:6300500-6300522 GATCCTGTGATGCACAAGGCCGG + Intronic
901431839 1:9220713-9220735 GTCAGTGTTATGTTCCAGGCAGG + Intergenic
905671857 1:39796292-39796314 GATAGTGTCATTTACAAGGCGGG - Intergenic
906439563 1:45829460-45829482 CACACTGCTATGTACACTGCTGG - Exonic
908045137 1:60160801-60160823 GACACTATTATCTACAATGGGGG + Intergenic
914214151 1:145609016-145609038 GATACAGCTATGAACAAGGCAGG - Intronic
914466096 1:147929419-147929441 GATACAGCTATGAACAAGGCAGG - Intronic
915357313 1:155263017-155263039 AATAGTATTATGTACAAGGCAGG + Exonic
917494014 1:175523898-175523920 GACGCTGCTATGTACATGGCAGG - Intronic
1062993669 10:1845224-1845246 GAGACTGTGGTATACAAGGCAGG + Intergenic
1065369077 10:24964756-24964778 GACAGTTTTATGTCAAAGGCAGG - Intergenic
1065802995 10:29369605-29369627 GGCACTGTTAAGTACATTGCAGG - Intergenic
1065820863 10:29523975-29523997 GACACTGATGTGTTCACGGCAGG + Exonic
1068075950 10:52254135-52254157 GACAATGTTATGTACAATTATGG - Intronic
1070717265 10:78731810-78731832 GACACTGCAATGCCCAAGGCAGG - Intergenic
1071288602 10:84172020-84172042 GACACTGAGTTGTAGAAGGCAGG + Intergenic
1072090956 10:92126632-92126654 AATGCTGTTATTTACAAGGCTGG - Intronic
1074844932 10:117389360-117389382 GCCACTCTTATCTGCAAGGCTGG - Intergenic
1075405736 10:122194515-122194537 GATACTGTGATAAACAAGGCCGG + Intronic
1077702371 11:4454258-4454280 GAGACTGTTATTAACTAGGCAGG - Intergenic
1080773453 11:35363884-35363906 GACACGGAGGTGTACAAGGCAGG + Intronic
1081611980 11:44568361-44568383 GACCCTGCTATGTACCAGACAGG - Intronic
1084791254 11:71476594-71476616 GACACTGTCATGTGGAAAGCAGG - Intronic
1084945970 11:72638631-72638653 AACACTGCTGTGTACCAGGCAGG - Intronic
1085040282 11:73322802-73322824 GATACTGTGATGTGCAAAGCTGG - Intronic
1085537712 11:77234089-77234111 GAAACTGCTCTGTACAAGCCTGG + Intronic
1085957542 11:81418059-81418081 GACACTGTTATATACATAGGAGG + Intergenic
1086090713 11:83002131-83002153 GACAATGTCAATTACAAGGCAGG - Intronic
1088288855 11:108214193-108214215 GACACTGTTATGAAAAATGCAGG - Intronic
1088789153 11:113208919-113208941 GACACTGTTTTGCACAGGTCAGG - Intronic
1089844268 11:121446171-121446193 GTCTCTGTTAAGTACAAGACAGG + Intergenic
1093636670 12:21479246-21479268 GACACTGTTATGTACAAGGCAGG + Intronic
1097206809 12:57329189-57329211 GATAGTGTTAGGTACAAGGGTGG - Intronic
1098512300 12:71331055-71331077 GATAGTGTGATCTACAAGGCAGG + Intronic
1099702253 12:86101310-86101332 GACACTGTTATTTACACAGAGGG + Intronic
1100100615 12:91099652-91099674 GACACTGTAGTGAACAAGACCGG - Intergenic
1102050115 12:109856042-109856064 GACACAGAAATGGACAAGGCAGG - Intronic
1104874432 12:132024017-132024039 GACACTTAAATGCACAAGGCAGG - Intronic
1108852491 13:54750369-54750391 TACCCTGTTATTTACAAAGCTGG + Intergenic
1110640443 13:77818021-77818043 GACACTATTTTGTACATGGTGGG + Intergenic
1111270349 13:85874104-85874126 GGCACTATATTGTACAAGGCAGG + Intergenic
1114365566 14:22024031-22024053 GACATTGTAATGCACAGGGCAGG - Intergenic
1114403040 14:22427541-22427563 GACACAGTGGTGCACAAGGCTGG + Intergenic
1115510768 14:34135992-34136014 GATACTTTTATGAACAAGGCCGG - Intronic
1115843489 14:37499440-37499462 GAAAATGCTATGTAGAAGGCTGG + Intronic
1116999246 14:51355413-51355435 GATAATCTTATGTACAAGTCAGG - Intergenic
1121031597 14:90663135-90663157 GACCCTGCAAAGTACAAGGCAGG + Intronic
1122418691 14:101562295-101562317 GGCACTATTATGTACCAGGGCGG + Exonic
1130536158 15:84786476-84786498 GACATTGTTATGCATGAGGCTGG + Intronic
1137056098 16:35747324-35747346 GACCCTGATATCTACCAGGCTGG - Intergenic
1141113458 16:81288940-81288962 GTCACTGTCATCTCCAAGGCGGG + Intronic
1144015909 17:11196004-11196026 GATGCTGTACTGTACAAGGCGGG - Intergenic
1149796785 17:59528312-59528334 GAGACTGATAAGAACAAGGCAGG - Intergenic
1156715078 18:39998301-39998323 GACACATTTATTTTCAAGGCGGG - Intergenic
1166396964 19:42448501-42448523 TTCACTGTTATTTACAGGGCTGG + Intergenic
1166519934 19:43473591-43473613 GGGACTGTCATGAACAAGGCAGG - Intergenic
1168551813 19:57302500-57302522 GACACTGTTACCTGGAAGGCAGG + Intergenic
926000570 2:9328785-9328807 GACACAGTGATGTACAGTGCTGG + Intronic
927118938 2:19935570-19935592 TACAATATTATGTACAAGGACGG - Exonic
928133544 2:28671010-28671032 GAAAATGTCATGTACAAGACTGG + Intergenic
932498863 2:72162658-72162680 GAAACAGTTATGTACGTGGCTGG + Intergenic
934790459 2:97055520-97055542 GACACTGTTATTTCCATGACTGG - Intergenic
934905785 2:98201119-98201141 GATTCTGAAATGTACAAGGCAGG - Intronic
938844613 2:135195876-135195898 GAAAGTATTATGTAGAAGGCAGG + Intronic
941213520 2:162674106-162674128 GACACATTTATATACAAGGAAGG + Intronic
1168739712 20:177266-177288 TTCACTGTTATTTACAGGGCTGG - Intergenic
1168839508 20:900235-900257 TTCACTGTTATTTACAGGGCTGG - Intronic
1169069223 20:2712232-2712254 GACAATGACCTGTACAAGGCAGG + Intronic
1169856955 20:10113384-10113406 GACACTATAATTTCCAAGGCTGG + Intergenic
1173681284 20:44884333-44884355 GACACAGCAATGAACAAGGCAGG - Intergenic
1175005577 20:55678805-55678827 GACACAGTAAGGTATAAGGCAGG + Intergenic
1175208176 20:57327957-57327979 GACACAGCTGTGAACAAGGCAGG - Intergenic
1182490201 22:30666681-30666703 GATACTGAAATGTACAAGACAGG + Intronic
950656865 3:14441900-14441922 GACACAGTTGTGAGCAAGGCAGG + Intronic
951051871 3:18102721-18102743 GATACAGTTGTGAACAAGGCAGG + Intronic
951169356 3:19521536-19521558 GGCACTGTTAGGTAGAAGGAGGG - Intronic
953628870 3:44594166-44594188 GACACTGGTATGTTCCAAGCAGG + Exonic
954284380 3:49608355-49608377 GACACGGTAATGTCAAAGGCTGG + Intronic
954401469 3:50321783-50321805 GACAGTGTGAGGGACAAGGCAGG + Exonic
954771018 3:52968887-52968909 GAAACTGTTATGAACAAGGCCGG - Intronic
959999804 3:112718917-112718939 GACACTGTGCTATGCAAGGCAGG - Intergenic
960829712 3:121834041-121834063 CACACTGTTAAGTATAAAGCAGG + Intronic
962825152 3:139094575-139094597 GACACTGTGGGCTACAAGGCAGG - Intronic
962859520 3:139386668-139386690 GAGTCTATTATGTACCAGGCAGG + Intronic
966632532 3:182094585-182094607 GAATCTGTTATGTGCAAGCCCGG - Intergenic
967234276 3:187368978-187369000 GGCACTGTTCAGTACAAGCCTGG + Intronic
967770647 3:193330346-193330368 GCCACTGCTGTGTACAATGCTGG - Intronic
971378801 4:26077931-26077953 GACTCAGTTATGTGCATGGCTGG - Intergenic
979226578 4:118292739-118292761 GCCACTGTTATGTAAAATACAGG + Intronic
982225027 4:153157133-153157155 AACACTGTTTTGAACAAAGCTGG - Intronic
984164961 4:176295733-176295755 TTCACTGTTATTTACAGGGCTGG + Intergenic
998993562 5:147845953-147845975 GACCCAGTCATTTACAAGGCTGG + Intergenic
1001207241 5:169775732-169775754 GACAGTTTTATGGAGAAGGCAGG + Intronic
1002385689 5:178864970-178864992 GAAAATGTTAAGTACAAAGCAGG - Intronic
1006255341 6:32828347-32828369 GACACTGGTAGGAACAAGGAAGG + Intronic
1006886295 6:37384902-37384924 AACACTGTCTTATACAAGGCAGG - Intronic
1007216530 6:40244257-40244279 CACACTGTTATCTTCAGGGCTGG + Intergenic
1007666789 6:43518711-43518733 GGCACTCTTATGTCCCAGGCTGG + Intronic
1007707941 6:43802679-43802701 AACACTGATATGTTCAAGGAAGG - Intergenic
1012885485 6:104841193-104841215 GAGACTGTTTTCTACAAGCCAGG + Intronic
1017552747 6:155526803-155526825 GACAGTGTTATGAACAGGACTGG + Intergenic
1018796834 6:167192594-167192616 GGCATTGATATGTACCAGGCAGG + Intronic
1020080695 7:5284269-5284291 AACACTGCTATGGGCAAGGCAGG - Intronic
1025198230 7:56947905-56947927 AACACTGCTATGGGCAAGGCAGG + Intergenic
1030111493 7:106030626-106030648 GACACAGTGATGAACAAGGCAGG - Intronic
1032483130 7:132262596-132262618 CACAGTGTTATGTACATGTCAGG + Intronic
1036584721 8:10112975-10112997 GACACTGTTATGGACCAGCAGGG - Intronic
1038106618 8:24442291-24442313 GACACTGATATTTACAAATCAGG - Intronic
1039991480 8:42491716-42491738 GAGACTGTGTTGGACAAGGCAGG - Intronic
1041024934 8:53674334-53674356 AACACTGCTTTGCACAAGGCCGG - Intergenic
1044056647 8:87579009-87579031 GAAAATCTTATGTAGAAGGCAGG + Intronic
1045831960 8:106472741-106472763 GACACTGATATTTACATGGAGGG - Intronic
1050306636 9:4311711-4311733 GACAGTGTTTTATAGAAGGCAGG - Intronic
1055135151 9:72821026-72821048 GACACGATCATGTACAAGACAGG - Exonic
1056505824 9:87257443-87257465 GAAAATATTTTGTACAAGGCTGG + Intergenic
1187342573 X:18434327-18434349 GACCCTTATATGTACCAGGCAGG + Intronic
1187356620 X:18579513-18579535 GACACTGTAATGTATAAAGGGGG - Intronic
1189678361 X:43487252-43487274 AGCACTGGTATGTGCAAGGCTGG - Intergenic
1195311948 X:103640154-103640176 GAGACTTTTGTGGACAAGGCTGG + Intergenic
1195647374 X:107247476-107247498 GACACTGACATGTTCCAGGCAGG + Intergenic