ID: 1093638973

View in Genome Browser
Species Human (GRCh38)
Location 12:21503059-21503081
Sequence TGGACTGGGGCTGCCTCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 256}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093638954_1093638973 28 Left 1093638954 12:21503008-21503030 CCTCCTACACACACTGCCACCCC 0: 1
1: 0
2: 4
3: 58
4: 602
Right 1093638973 12:21503059-21503081 TGGACTGGGGCTGCCTCTTGGGG 0: 1
1: 0
2: 1
3: 23
4: 256
1093638959_1093638973 8 Left 1093638959 12:21503028-21503050 CCCCCAATCAGGCTGTCTTCCCT 0: 1
1: 0
2: 4
3: 25
4: 255
Right 1093638973 12:21503059-21503081 TGGACTGGGGCTGCCTCTTGGGG 0: 1
1: 0
2: 1
3: 23
4: 256
1093638955_1093638973 25 Left 1093638955 12:21503011-21503033 CCTACACACACTGCCACCCCCCA 0: 1
1: 0
2: 10
3: 78
4: 649
Right 1093638973 12:21503059-21503081 TGGACTGGGGCTGCCTCTTGGGG 0: 1
1: 0
2: 1
3: 23
4: 256
1093638961_1093638973 6 Left 1093638961 12:21503030-21503052 CCCAATCAGGCTGTCTTCCCTCC 0: 1
1: 0
2: 0
3: 23
4: 250
Right 1093638973 12:21503059-21503081 TGGACTGGGGCTGCCTCTTGGGG 0: 1
1: 0
2: 1
3: 23
4: 256
1093638958_1093638973 9 Left 1093638958 12:21503027-21503049 CCCCCCAATCAGGCTGTCTTCCC 0: 1
1: 0
2: 1
3: 15
4: 201
Right 1093638973 12:21503059-21503081 TGGACTGGGGCTGCCTCTTGGGG 0: 1
1: 0
2: 1
3: 23
4: 256
1093638962_1093638973 5 Left 1093638962 12:21503031-21503053 CCAATCAGGCTGTCTTCCCTCCT 0: 1
1: 0
2: 1
3: 35
4: 306
Right 1093638973 12:21503059-21503081 TGGACTGGGGCTGCCTCTTGGGG 0: 1
1: 0
2: 1
3: 23
4: 256
1093638957_1093638973 12 Left 1093638957 12:21503024-21503046 CCACCCCCCAATCAGGCTGTCTT 0: 1
1: 0
2: 0
3: 24
4: 191
Right 1093638973 12:21503059-21503081 TGGACTGGGGCTGCCTCTTGGGG 0: 1
1: 0
2: 1
3: 23
4: 256
1093638960_1093638973 7 Left 1093638960 12:21503029-21503051 CCCCAATCAGGCTGTCTTCCCTC 0: 1
1: 0
2: 4
3: 36
4: 284
Right 1093638973 12:21503059-21503081 TGGACTGGGGCTGCCTCTTGGGG 0: 1
1: 0
2: 1
3: 23
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093638973 Original CRISPR TGGACTGGGGCTGCCTCTTG GGG Intronic
902286647 1:15411665-15411687 TGGCCTGAGGCTGAGTCTTGGGG + Intronic
902619401 1:17642214-17642236 TGGGCTGGGGCTGCCATCTGGGG + Intronic
904379461 1:30101306-30101328 TGGTCTGGGGCTGCCTCAAGAGG - Intergenic
905226069 1:36480133-36480155 TGGTCAAGGGATGCCTCTTGGGG + Intronic
905303021 1:36998415-36998437 TAGACATGGGCTGTCTCTTGTGG - Intronic
905867230 1:41382775-41382797 TGGGCTGGGGCCGCCTCCTGGGG - Exonic
905874489 1:41423487-41423509 TGAACTGGAGCTGAATCTTGCGG - Intergenic
906296716 1:44653167-44653189 TGGATGGGAGCTGACTCTTGGGG - Intronic
909506775 1:76400497-76400519 TGAAGTGGGCCTGCCTCTTCAGG + Intronic
910271775 1:85403066-85403088 TGGACTGGGACTGTCCCTTAGGG + Intronic
911348311 1:96722289-96722311 TGGATTGGGGGAGCCTCTAGGGG + Intronic
911428023 1:97746037-97746059 TGGACTTGAGAAGCCTCTTGAGG - Intronic
913003643 1:114606947-114606969 TGGGCTGGTGGTGCCACTTGTGG - Intronic
913181803 1:116329708-116329730 TGCCCTGGGGCTGCCTGGTGTGG - Intergenic
914397204 1:147281253-147281275 TGGAATGGGACTGTCTTTTGTGG + Intronic
915557485 1:156668634-156668656 TGGGGAGGGGCTGCCTCCTGAGG - Intergenic
916651831 1:166840156-166840178 TGGAGTGCGGATGCATCTTGAGG - Exonic
917891382 1:179441658-179441680 TGTACTGGGACTCCCTCTTCAGG + Intronic
918181389 1:182088104-182088126 TGGGCTGGGACTGCCACCTGGGG - Intergenic
920216806 1:204366945-204366967 TAGACTGGGGCTCCCTCTGGTGG + Intronic
920284361 1:204868914-204868936 TGGAAAAGGGCTGCCTCTTCCGG + Intronic
920646198 1:207806174-207806196 TGGCCTGGGACTGTCTCTTGAGG - Intergenic
921238726 1:213154623-213154645 TGGACTGGGACTCACCCTTGAGG + Intronic
922853099 1:228751080-228751102 CGCACTGGAGCTGCCTCTCGTGG - Intergenic
923475123 1:234324894-234324916 TGGACTGGGGCTGCCGCTCTAGG - Intergenic
924282797 1:242454953-242454975 TGTGCTGGGGCTCCCTCCTGTGG - Intronic
1062808562 10:444146-444168 TGAACAGTGGCTGTCTCTTGAGG - Intronic
1062808576 10:444257-444279 TGAACGGTGGCTGTCTCTTGAGG - Intronic
1064008056 10:11713852-11713874 TGGACTGAGGTTTCCTCCTGGGG - Intergenic
1064642734 10:17430902-17430924 TGATCTGGGGCTCCCTCTTGTGG + Intronic
1065881433 10:30040746-30040768 TGGACTGGGGGTGTCACTGGTGG - Intronic
1065898040 10:30181883-30181905 TGGACTGGGGTCTCATCTTGGGG - Intergenic
1067092522 10:43275723-43275745 TGGTTTGGGGTTTCCTCTTGGGG - Intergenic
1067214692 10:44292837-44292859 CGGCCTGGGACTGCCTGTTGGGG - Exonic
1067252817 10:44602046-44602068 TGGACTGGTTCTGCCTCGTCAGG + Intergenic
1067839746 10:49666217-49666239 GGGGCTGGGGCTGACTCTGGAGG - Intergenic
1069117943 10:64531658-64531680 TGGACTTTGACTGCCTCTTTAGG + Intergenic
1069140485 10:64816812-64816834 TGGACTCAGAGTGCCTCTTGAGG + Intergenic
1070322269 10:75363167-75363189 TGGACTGGAGCCTCCTCTTCTGG - Intergenic
1070777375 10:79117769-79117791 TGGGCTGGAGGTGCATCTTGTGG + Intronic
1071603208 10:86968964-86968986 AGGTCTGGGGCAGCCTCTGGTGG - Intronic
1075215605 10:120530297-120530319 TGAACAGTGGCTGCCTCATGGGG - Intronic
1075815314 10:125260486-125260508 TGGGGTGGGGCAGCCTCCTGAGG + Intergenic
1076838391 10:133032631-133032653 GGGAGTGGGGCTGCCTCTGCTGG + Intergenic
1079102996 11:17553004-17553026 GGGGCTGGGGCTGCCTGTTATGG + Intronic
1080856418 11:36115648-36115670 GGGACTGGGGCGTCCTTTTGCGG - Intronic
1082785152 11:57312746-57312768 TGGACAGGCACTGCCTGTTGAGG - Exonic
1083860731 11:65418632-65418654 TGGACTGGGACTGCCTGGGGTGG - Intergenic
1084328554 11:68416174-68416196 GGGACCAGGGCTGTCTCTTGGGG - Intronic
1084991131 11:72926230-72926252 GGGACTGGTGGTGCCTCTTCTGG + Intronic
1085147349 11:74213108-74213130 AGGCCTGGGACTGCCTCTTCAGG - Intronic
1087911224 11:103755803-103755825 TGGGCTGGGGCTCTATCTTGAGG + Intergenic
1089409393 11:118226855-118226877 AGGAATGGAGCTGCCTCTTCTGG + Exonic
1089654476 11:119936611-119936633 TGGACTGGGGTTGCCACACGGGG - Intergenic
1091693140 12:2610591-2610613 TGTACTGGTGCTGGTTCTTGGGG - Exonic
1092010837 12:5111164-5111186 TGAAGAGCGGCTGCCTCTTGGGG + Intergenic
1092123872 12:6062697-6062719 TAGACTGGGGTGGGCTCTTGTGG - Intronic
1093062327 12:14620151-14620173 TGGCCTGAGGCTGCCTCTTAGGG + Intronic
1093638973 12:21503059-21503081 TGGACTGGGGCTGCCTCTTGGGG + Intronic
1096215861 12:49797074-49797096 TGCACTGGGAGCGCCTCTTGGGG - Exonic
1096666820 12:53171646-53171668 CGGACGGGGGCTGTCTCTTGGGG - Intronic
1096975292 12:55696327-55696349 TGGCCAGGGGCTGCCTCCAGTGG - Exonic
1097021411 12:56023159-56023181 TCGGCTGAGGCTGCCTCTTGAGG - Intronic
1097228000 12:57490319-57490341 TGGGCTGGGGCTGCTTTTGGAGG - Exonic
1098381164 12:69871191-69871213 TGGAAAGTGGCTGCCTCTGGGGG - Intronic
1100453976 12:94733864-94733886 TGGAGTGGGGATGCCTGTGGTGG - Intergenic
1101547648 12:105731703-105731725 TGGACTGGGGCTAATTTTTGAGG - Intergenic
1102301884 12:111777304-111777326 TGGTGTGGGGCTGGTTCTTGAGG + Intronic
1102982583 12:117253785-117253807 TGGCCTGGAGCTCCCTCCTGAGG + Intronic
1103873829 12:124111825-124111847 TGGACTGGGGTTGCATTTTCTGG - Intronic
1104677040 12:130718168-130718190 TGGAGTGGGGTTTCCTTTTGGGG + Intergenic
1106062027 13:26302725-26302747 TGGATTAGGGATGTCTCTTGGGG - Intronic
1107397656 13:40034344-40034366 TGGCCCAGGGCTGTCTCTTGGGG - Intergenic
1108386451 13:49903749-49903771 TTGACTAGAGCTGCCTTTTGTGG + Intergenic
1111423832 13:88052867-88052889 AGGAATGTGGCTGCCTCCTGCGG + Intergenic
1113556341 13:111238716-111238738 TGGTCTGGAGTTGCCTCTCGGGG + Intronic
1113605762 13:111604240-111604262 TGGACTGATGCTGCCTCTTCTGG + Intronic
1115000170 14:28412308-28412330 TGTACTGGGACTCCCTCTTCTGG - Intergenic
1118879356 14:69813000-69813022 TGTACTGGGACTCCCTCTTCAGG - Intergenic
1119444153 14:74649478-74649500 TGGTCAGGGGCTGCCTGTAGGGG - Intergenic
1119746900 14:77051221-77051243 TCGGGTGGGGCTGCCTCTGGGGG + Intergenic
1121652747 14:95571781-95571803 GAGACAGGGGCTGTCTCTTGAGG - Intergenic
1123112616 14:105880311-105880333 TGGACCCGGGCTGCCTGGTGTGG + Intergenic
1125507583 15:40275975-40275997 TGGGCTGTGGCTCTCTCTTGGGG - Exonic
1125680084 15:41525012-41525034 TGGGCTGTGGCTGCCTCCTATGG - Exonic
1127260342 15:57322786-57322808 TGGGCTGGGCTGGCCTCTTGAGG + Intergenic
1129193245 15:73949776-73949798 TGATCTGGGGCTGCATCCTGTGG + Intronic
1129237771 15:74234133-74234155 GGATCTGGGGCTGGCTCTTGGGG - Intergenic
1129266395 15:74395737-74395759 TGGCCTGGGGCTGGCTCTCCTGG - Intergenic
1129608634 15:77036911-77036933 TGGGCAGGGGCAGCCCCTTGGGG - Intronic
1129975166 15:79815763-79815785 TGGACACTGCCTGCCTCTTGTGG - Intergenic
1132558778 16:584188-584210 GGGACTTGGGCTGCCTCACGTGG + Intergenic
1134078344 16:11308047-11308069 AGGACTGGGACTCCCTCTTTGGG - Intronic
1137673302 16:50291685-50291707 CGGCCTGGGGCAGCATCTTGGGG + Intronic
1137737091 16:50732754-50732776 TGAAATGGAACTGCCTCTTGTGG - Exonic
1138343714 16:56307262-56307284 GGGACTGGGGCTGCCCCTCCCGG - Intronic
1138585234 16:57964813-57964835 TGAAGTGGGGCAGCCTCCTGGGG - Intronic
1141618544 16:85224007-85224029 GGGGCTGGGGCTTCCTTTTGGGG - Intergenic
1142154669 16:88527616-88527638 TGGGCTGAGGCTGCCCCCTGCGG + Intronic
1143301923 17:5916803-5916825 TGGAACGGGGCTGCCTGCTGGGG + Intronic
1143396789 17:6605693-6605715 AGGACAGTGGCTGCCTCTCGGGG + Intronic
1143815154 17:9506862-9506884 TGGAGTGTGCCTTCCTCTTGGGG + Intronic
1144406272 17:14955484-14955506 TGGGCAGGGGCTGCCTGCTGAGG + Intergenic
1145006683 17:19342507-19342529 GGGCCTGGGGCTGCCTCGTGAGG + Intronic
1145878864 17:28339731-28339753 GGCACTGGGGCTGCCGCTCGGGG + Intronic
1146278505 17:31530273-31530295 TGGGCTGTGGATGCCTCTTGGGG + Intronic
1146282905 17:31557137-31557159 AGGACTGGGCCTGCCTCCAGGGG - Intergenic
1146593217 17:34146678-34146700 TTGACAGGTGCTGCCTCTTCTGG - Intronic
1147020418 17:37527443-37527465 TGGACTAAGACTCCCTCTTGTGG - Intronic
1148204191 17:45769286-45769308 TGGGCTGGGGCCACGTCTTGTGG - Intergenic
1148848139 17:50541011-50541033 AGCACTGGGGCTGACCCTTGGGG + Exonic
1149092073 17:52795502-52795524 AGGCCTGGGGCTGCCTTTTCAGG - Intergenic
1149660039 17:58329495-58329517 TGGAGAGGGGCTGCCTCTCGGGG - Intergenic
1152687549 17:81701977-81701999 TGGCCTGGGGCTCCCTCTGCAGG + Exonic
1154163112 18:11994717-11994739 TGCATGGGGGCTGCCTCATGGGG - Intronic
1154324332 18:13379291-13379313 TGGCCTGGGGGTGCCCCATGGGG - Intronic
1154372081 18:13773499-13773521 AGGACTGAAGCAGCCTCTTGAGG + Intergenic
1156480844 18:37435427-37435449 TGGGGTGGGGCTGCCCCTTTTGG + Intronic
1156516636 18:37685881-37685903 TAGAGTGGGCTTGCCTCTTGAGG + Intergenic
1157378598 18:47190247-47190269 TGGACTTGAGCTGTATCTTGAGG + Intergenic
1160737064 19:667736-667758 TGGACTGTGGCTGCCTCCTGAGG + Intergenic
1161046415 19:2137168-2137190 TGGGCTGGCGCTGCCTGGTGTGG - Intronic
1161314980 19:3613474-3613496 GGGACTGGGGCTCCTGCTTGAGG + Exonic
1162006201 19:7781297-7781319 TGTACTGGGACTCCCTCTTCAGG - Intergenic
1163761366 19:19138324-19138346 TGGATTGGGGTTTCTTCTTGGGG - Intronic
1164906729 19:31974058-31974080 TGGGCTGGGGCTGACACTGGGGG + Intergenic
1164931426 19:32178999-32179021 TGGCCTGGGGCTGCCAGGTGAGG - Intergenic
1165420801 19:35721067-35721089 GGGACTGGTGCTGGCTCCTGGGG - Exonic
1166230713 19:41424644-41424666 TAGAGTGGGGCTACCTCTCGGGG - Exonic
1167289557 19:48616878-48616900 TGGCCTGGGGATGCCTCAAGCGG - Intronic
1167598527 19:50440095-50440117 AGGGCTGGGGCTTCCTCCTGAGG + Intronic
1167621326 19:50562630-50562652 TGGGCTGGGGCAGCATCTGGGGG + Intronic
1167808809 19:51810443-51810465 TGTACTGGGACTCCCTCTTCAGG + Intronic
925144477 2:1571687-1571709 TGGACTGGGGCTGCCAAGTGTGG - Intergenic
926229837 2:10994029-10994051 GGGACTGGGCATGCCTCCTGGGG - Intergenic
926294141 2:11555750-11555772 AGGTCTGGGGTTTCCTCTTGGGG + Intronic
926314624 2:11700239-11700261 TGTACTTGGGCAGACTCTTGAGG - Intronic
926808785 2:16738028-16738050 TGGACTGGGAATGCTTGTTGGGG + Intergenic
927217280 2:20675107-20675129 TGTCCTGAGGCTGCCTCTGGGGG + Intergenic
927220028 2:20698338-20698360 AGGACTGGGAAGGCCTCTTGGGG + Intronic
928280882 2:29945273-29945295 TGAACTGGAGCTGCTTCTGGTGG - Intergenic
932441970 2:71743286-71743308 TGGCCAGGGGATGCCTCTGGTGG - Intergenic
934041264 2:88129389-88129411 TAGACTGGAGTTGCCTTTTGAGG - Intergenic
937350039 2:121154899-121154921 TGGACTAGGGCTGCCACTTAAGG + Intergenic
939895391 2:147785215-147785237 GGGACTGGGATTGTCTCTTGTGG - Intergenic
947529350 2:230898954-230898976 TGGACTGAGGCTGCCACAGGAGG - Intergenic
947971482 2:234328800-234328822 GGGACTTGGCCTGCCTCGTGAGG + Intergenic
947987417 2:234460888-234460910 TGTACTGAGGCTGGCACTTGTGG - Intergenic
948868401 2:240786554-240786576 GGGAGTGGGGCTGCCACTGGGGG + Intronic
1171226657 20:23447144-23447166 TGGACAGAGGCTGCCTTTGGAGG - Intergenic
1172130741 20:32653086-32653108 TGGTCTGGGGCGCCCTCTGGTGG + Intergenic
1172479162 20:35260820-35260842 TGGCCTGGGTCTGCCCCATGGGG + Intronic
1172859445 20:38035725-38035747 TGGACTTTAACTGCCTCTTGAGG - Intronic
1173280198 20:41620241-41620263 TCGCCTGCTGCTGCCTCTTGGGG + Intergenic
1175403673 20:58714192-58714214 TGCACTGTGGCTGCTTCTGGGGG - Intronic
1175520456 20:59599447-59599469 TGGCCTGAGGCTACTTCTTGCGG - Intronic
1175894404 20:62329684-62329706 TGGGCTGGGTCTGTCTCTTCTGG - Intronic
1176021687 20:62965416-62965438 TGGAGCGGGGCTGATTCTTGCGG + Intronic
1179260961 21:39757895-39757917 TGGACAGGGGCAGCCTCATCTGG - Intronic
1179802033 21:43815553-43815575 TGCAGTGGGGCTGGCTCCTGAGG + Intergenic
1179975375 21:44862555-44862577 TGGACTTGGGCTGGCGCATGAGG - Intronic
1181611024 22:24011865-24011887 TGGCCAGGGCCCGCCTCTTGCGG - Intronic
1181616495 22:24058512-24058534 GGGACTGGGGATGCCTCTCCTGG - Intronic
1181770293 22:25120219-25120241 TGGTCTCGGGCTGCACCTTGGGG + Intronic
1182523960 22:30903953-30903975 AGGTCTGAGGCTGCATCTTGGGG + Intronic
1182712690 22:32332481-32332503 TGGCCTGGCCCTGCCTCTCGGGG - Intergenic
1183103935 22:35602509-35602531 TGTCCTGGGGGTGACTCTTGTGG + Intergenic
1183375568 22:37462932-37462954 GGGACCGGGGCTGCGTCATGTGG + Intergenic
1185169682 22:49285562-49285584 TGGATTCGGGCTGCCTCTCTGGG + Intergenic
1185200812 22:49503491-49503513 TTGGCTGGGTCTGTCTCTTGAGG + Intronic
1185227769 22:49662883-49662905 TGAGCTGTGTCTGCCTCTTGCGG - Intergenic
1185270706 22:49928309-49928331 TGGGCTGTGGCTGCCTCTGCGGG - Intergenic
1185277479 22:49956058-49956080 TGGAGGGGGGCTGCCTCTGTTGG - Intergenic
949490090 3:4580793-4580815 CTGAATGGGGCCGCCTCTTGGGG + Intronic
953180279 3:40588548-40588570 TGGCCTGGGGCTGCCTTGCGGGG + Intergenic
957348764 3:78995969-78995991 TGGATTGGAGCTGCCCCTTTAGG - Intronic
959991085 3:112632902-112632924 TAGACTGGGTCTGGCTCTAGGGG - Intronic
962014048 3:131422336-131422358 TTTACTGGGGCTCACTCTTGTGG - Intergenic
962440887 3:135415212-135415234 TGGACTGACACTGCCTCCTGAGG + Intergenic
963035268 3:141020271-141020293 TGGACTGGGTGAGCCTGTTGAGG - Intergenic
968899227 4:3423127-3423149 TGTAGGGGGGCTGCCTCGTGTGG - Intronic
968912085 4:3481467-3481489 TGGACTGGGGCTGCTTCAGGAGG + Intronic
969461454 4:7331264-7331286 TGGGCTGGGGCAGGTTCTTGGGG + Intronic
969606125 4:8203103-8203125 TACACAGGAGCTGCCTCTTGGGG + Intronic
969684958 4:8666249-8666271 TGGACTGGGGAGCCCTCTTGGGG + Intergenic
972344053 4:38177835-38177857 TGGCCTGGGTGTGGCTCTTGAGG + Intergenic
973673585 4:53241384-53241406 TGGACTGGCCCTGTCTCATGGGG - Intronic
974068521 4:57102861-57102883 TGGACTGGAGCAGACTCTTAGGG + Intronic
975178878 4:71320374-71320396 TGCACTGTGGCCTCCTCTTGTGG + Intronic
978575357 4:110184459-110184481 TGGACAAGGGCTGCTTCTAGAGG + Intronic
979536210 4:121823504-121823526 TGGACGGGCGCTGCCTTTTCCGG + Exonic
983536694 4:168865112-168865134 AGGACTGGTGCTGCCCCCTGAGG + Intronic
984698687 4:182804505-182804527 TGGAATGGGGATGCATTTTGTGG - Intergenic
985514792 5:335969-335991 TGGACTTGGACTGCTGCTTGCGG - Intronic
986345054 5:6827007-6827029 CCGGCTGAGGCTGCCTCTTGAGG + Intergenic
986568653 5:9142382-9142404 TGGACTTGGGCTGAAGCTTGAGG + Intronic
988538362 5:32088256-32088278 TGGATTGGGGCAGCCACGTGTGG - Exonic
990472612 5:56130123-56130145 AAGCCTGGGGCTGCCTCTTCTGG + Intronic
991912278 5:71573833-71573855 TGTACTGGGACTCCCTCTTCAGG - Intergenic
993434393 5:87873401-87873423 TGGTCTGGGGCTCCATCCTGGGG + Intergenic
995964004 5:117882148-117882170 TGGACTGGAGCTGCCTGTACTGG - Intergenic
997747318 5:136310551-136310573 AGGAGTGGAGCTGGCTCTTGAGG + Intronic
998266998 5:140673747-140673769 TGTACGGGGGCTGCCTCCCGAGG + Exonic
999279085 5:150352981-150353003 TGAACTGCGAGTGCCTCTTGGGG - Intergenic
1000023313 5:157337686-157337708 TGGCATGAGGCTGCCTCCTGTGG + Intronic
1000949296 5:167461381-167461403 TGGAATGGAGCTGTCTCTTGAGG - Intronic
1002191884 5:177482654-177482676 AGAGCTGGGGCTGTCTCTTGAGG - Intergenic
1002259598 5:177984314-177984336 TGGACTGGGAAGGACTCTTGTGG + Intergenic
1002541484 5:179908828-179908850 TGGACTGGCGCTGCCCCTGCAGG - Intergenic
1002943593 6:1739615-1739637 AGGACTGTGGCTGGCCCTTGTGG - Intronic
1003682675 6:8271521-8271543 TGGCCTGGAGTTGGCTCTTGAGG - Intergenic
1005135957 6:22570053-22570075 TGGTCGGGGGCTGCCTCCTTGGG - Exonic
1006219682 6:32477978-32478000 TGCACTGGGACTCCCTCTTCTGG + Intergenic
1007273794 6:40658691-40658713 TGCAGTGGGGCTGCATCCTGGGG - Intergenic
1007952678 6:45886234-45886256 AGGACTGGGGCTGCACCCTGGGG - Intergenic
1011483334 6:87816806-87816828 AGGAGTAGGGCTGCCTCTTCGGG + Intergenic
1012860820 6:104556843-104556865 TGGATTGGGGGTCCATCTTGGGG + Intergenic
1012967665 6:105692309-105692331 TGCACTGGATCTGCCTATTGAGG - Intergenic
1013366888 6:109443626-109443648 TGGCCTGGGGCTGCTTCTCCTGG + Exonic
1014177841 6:118349518-118349540 GGGAGGGCGGCTGCCTCTTGGGG + Intergenic
1016977572 6:149824139-149824161 CGGACTGGGGCTGGGTGTTGCGG - Intronic
1018010369 6:159664713-159664735 TGGTCAGGGGAGGCCTCTTGGGG + Intergenic
1018518240 6:164612244-164612266 GGGAATGGGCCTGCCTCTTAGGG - Intergenic
1021594824 7:22303858-22303880 AGGACTGGGGCTTCCCCTTGAGG + Intronic
1023123444 7:36932504-36932526 TTGACTGTGGCTTACTCTTGTGG + Intronic
1024640801 7:51327144-51327166 TGGAATCGGCCTGCCTCTGGGGG - Intergenic
1028037100 7:85998779-85998801 TGGTCTTGGGGTGCCCCTTGTGG - Intergenic
1029339266 7:99929664-99929686 TGGACTGGAGCTCCCTCTGAAGG - Intergenic
1030128937 7:106180317-106180339 TGGACTGGGGAAGCCCCGTGGGG + Intergenic
1031451010 7:121918339-121918361 TGCACTGGGTCTGCATTTTGTGG - Intronic
1032400619 7:131621952-131621974 TGGACTGGGGCTGCTGGCTGGGG - Intergenic
1032519079 7:132529128-132529150 TGGACTGGGGCTGGCTTTGCTGG - Intronic
1032988476 7:137364293-137364315 TGTACTGGTACTGCTTCTTGTGG + Intergenic
1034991842 7:155552611-155552633 TGGGCTGGTGATGCCTCTGGAGG - Intergenic
1037579479 8:20236161-20236183 AGGACTTGGGCTGCCTGGTGAGG - Intergenic
1037635365 8:20697057-20697079 TGGACTGGGGAAGCATCTTAAGG + Intergenic
1037721759 8:21450331-21450353 TGGAGTGGTGCTTCCTCTGGTGG - Intergenic
1040345602 8:46489753-46489775 TGAACTGGGACTCCCTCTTCAGG + Intergenic
1040663827 8:49606490-49606512 TGGACTGGGGCTGGAGCTGGTGG + Intergenic
1041411515 8:57561369-57561391 TGGCCTGGGGCTGGTTCTGGAGG - Intergenic
1041487517 8:58395374-58395396 TGGGCTGGTGCTCCCTCTGGTGG + Intergenic
1046026110 8:108726078-108726100 TTGATTGGGCCTGCTTCTTGTGG + Intronic
1047181654 8:122594387-122594409 GAGCCTGGGGCTGCCTCTTCAGG + Intergenic
1047504103 8:125465260-125465282 GGGAATGGGGCTTCCTTTTGGGG - Intergenic
1047931116 8:129728857-129728879 TCGCCTGGGGCGGGCTCTTGTGG + Intergenic
1048859272 8:138711837-138711859 TGCCCTGGGGCTGCCTCAGGAGG - Intronic
1049021748 8:139961749-139961771 GGGACTTGTGCTGCCTCTTCTGG + Intronic
1049448242 8:142641492-142641514 TGGAAAGGGGCTGCCTCACGAGG - Intergenic
1049497156 8:142941426-142941448 TGAACAGGCGCTGCCTCCTGGGG + Intergenic
1049560317 8:143306996-143307018 TACACAGGGGCTGCCTCATGGGG + Intronic
1049713937 8:144080709-144080731 TGGTCTGGTGCTGGCTCCTGGGG + Intergenic
1049757725 8:144318224-144318246 GGGGCTGGGGCTGCCTGCTGGGG - Intronic
1051367271 9:16329976-16329998 GGGGCTGGGGATGCCTCTGGGGG - Intergenic
1052708012 9:32016406-32016428 TGGAAAGGAGCTGCCCCTTGTGG - Intergenic
1053278559 9:36801502-36801524 GAGACAGTGGCTGCCTCTTGGGG - Intergenic
1053280693 9:36818330-36818352 TGGCCTTGGGCCGCCTCTTCCGG + Intergenic
1056957776 9:91096190-91096212 TGGACTGGGGTTGCCATTAGAGG + Intergenic
1057557639 9:96100411-96100433 TGGCCTGGGGCAGCCTCTAGGGG - Intergenic
1057972660 9:99572471-99572493 TGGATAGGTGCTGCCTCCTGTGG + Intergenic
1060540934 9:124429594-124429616 TGGAGTGGGGCTGGCACTGGAGG + Intergenic
1060665116 9:125428172-125428194 TGCCCTGGGGCTCCCTCTTGTGG - Intergenic
1061015345 9:127978094-127978116 TGGACAAGGGCTGCCCCTTGTGG - Intronic
1061396549 9:130346835-130346857 GGGGCTGGGGGTGCCTGTTGGGG + Intronic
1061486224 9:130921821-130921843 TGTACTGGAGCTGCGTCTGGGGG - Intronic
1062577334 9:137214808-137214830 AGGGCTGGGGCAGCCTCGTGGGG - Exonic
1062586689 9:137252796-137252818 GGGACTGGGGCTGCACCCTGAGG - Exonic
1062658139 9:137614648-137614670 AGGCCTGGGGCTGCCTCCTGGGG + Exonic
1185842470 X:3405142-3405164 GGGACTGGGGATACCTCTGGTGG + Intergenic
1187281031 X:17858954-17858976 TGCCCTGGGGATGCCTCTAGTGG + Intronic
1187341617 X:18425923-18425945 GGGGCTGGGGCTGTCTTTTGGGG + Intronic
1187380150 X:18794493-18794515 TGGAATGGGGCTGTCACTGGAGG - Intronic
1190010455 X:46780273-46780295 TCTTCTGGGGCTGCCTCTGGTGG + Intergenic
1190015148 X:46820135-46820157 TGGACTGGGACTCACTCTTCAGG - Intergenic
1191139762 X:57104579-57104601 TGTACTGGGACTCCCTCTTCAGG - Intergenic
1191207403 X:57849440-57849462 TGGCCTGGGGCTCACCCTTGAGG + Intergenic
1191864433 X:65692268-65692290 TGGCCTGGGGCCTCCTATTGTGG + Intronic
1192822536 X:74659566-74659588 TAGACTGGGGCTGCGGGTTGGGG - Intergenic
1197326593 X:125102101-125102123 TGGGCTGGAGTTGGCTCTTGAGG + Intergenic
1197677637 X:129347308-129347330 TGGACTGGGACTCACACTTGAGG - Intergenic
1197809667 X:130430017-130430039 TCCACTGGGGCTGGCTCCTGGGG - Intergenic
1202075075 Y:21029341-21029363 TGTACTGGGACTCCCTCTTCAGG + Intergenic