ID: 1093639711

View in Genome Browser
Species Human (GRCh38)
Location 12:21512037-21512059
Sequence TTCTCCAACTATGAGTTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 150}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093639711_1093639712 25 Left 1093639711 12:21512037-21512059 CCACACAACTCATAGTTGGAGAA 0: 1
1: 0
2: 0
3: 7
4: 150
Right 1093639712 12:21512085-21512107 AATCTGAGTTATATATAGCTAGG 0: 1
1: 0
2: 0
3: 22
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093639711 Original CRISPR TTCTCCAACTATGAGTTGTG TGG (reversed) Intronic
900102814 1:969984-970006 TTCTTCACGTATGTGTTGTGTGG + Intronic
900102822 1:970039-970061 TTCTTCACGTATGTGTTGTGTGG + Intronic
900102830 1:970094-970116 TTCTTCACGTATGTGTTGTGTGG + Intronic
900102838 1:970149-970171 TTCTTCACATATGTGTTGTGTGG + Intronic
906676418 1:47696868-47696890 TTTTCCAACCATGAGTAATGAGG - Intergenic
908063420 1:60375715-60375737 TTCTCCAACAGTGAGTTATCTGG - Intergenic
910365651 1:86462200-86462222 TTCTTCACATATGAGTTATGTGG - Intergenic
912837347 1:113008257-113008279 TTCTCCAAGTCTGAGTTATTTGG + Intergenic
914616732 1:149366008-149366030 TTCTCTAACTATTAGTGATGTGG - Intergenic
915966067 1:160309329-160309351 TTCTACATCTATGAGTTATAGGG + Intronic
916119523 1:161515531-161515553 TTCTCCAAGAAGGAGTTTTGGGG - Intronic
916129288 1:161597188-161597210 TTCTCCAAGAAGGAGTTTTGGGG - Intronic
917497645 1:175555854-175555876 CCTTCCAACCATGAGTTGTGTGG + Intronic
1064218529 10:13420085-13420107 TTCTCAAACTATCAGTGGTAAGG + Intergenic
1065630159 10:27671635-27671657 TACTCCAACGATCTGTTGTGGGG - Intergenic
1069835343 10:71304508-71304530 TTCTCCATCTGTGAAATGTGGGG + Intergenic
1070190732 10:74109519-74109541 AGCTCCAAATATGAATTGTGTGG + Intronic
1071062999 10:81596086-81596108 GTCTCCCACTATTATTTGTGGGG - Intergenic
1073894158 10:108134970-108134992 TACTCCAACTCTGAGATGTCTGG - Intergenic
1074352138 10:112748033-112748055 TTCTCCACCTATGAGATGAGGGG - Intronic
1074963232 10:118466506-118466528 TTAGCCAACTTTGAGTTGTTGGG - Intergenic
1075963891 10:126593680-126593702 TCCTGCAACTTTGAGTTCTGGGG - Intronic
1079632579 11:22695803-22695825 TTCACCAATAATGAGCTGTGAGG + Intronic
1079777295 11:24547954-24547976 TTCTCCAATGATTAGTGGTGTGG - Intronic
1080695380 11:34599281-34599303 TTCTTCTACTATGGGTTCTGAGG + Intergenic
1080704368 11:34676278-34676300 TTCTCCAAATATGAAGTCTGGGG + Intergenic
1081205588 11:40271383-40271405 TTCTCCACCTTTGTGTTCTGTGG - Intronic
1083691345 11:64410710-64410732 TTCCCCAAGTCTGAGTTGTGTGG + Intergenic
1084478976 11:69406515-69406537 TTTTCTAACTAAGAGTTGTATGG + Intergenic
1086609176 11:88733430-88733452 TTCTCAGACTATGCATTGTGAGG + Intronic
1087904052 11:103675156-103675178 TTGTCCCAGTATGAGTGGTGTGG - Intergenic
1088647467 11:111928209-111928231 TTCTCCACCAATTAGTGGTGGGG - Intronic
1089127042 11:116183846-116183868 TTCTCCAACACTGGGGTGTGTGG + Intergenic
1090446879 11:126772185-126772207 TTCTCCAAGTGTTAGTTGGGAGG + Intronic
1090543729 11:127738204-127738226 TTCTCCAAAGCTGAGCTGTGTGG - Intergenic
1091288759 11:134424880-134424902 CTCTCCAAGTCTGTGTTGTGTGG - Intergenic
1093639711 12:21512037-21512059 TTCTCCAACTATGAGTTGTGTGG - Intronic
1097968819 12:65610433-65610455 TTCTTCAACTATGAATTCTTTGG + Intergenic
1099682199 12:85843826-85843848 GTCTGCAACTGTGAGTTGGGTGG - Intergenic
1100629236 12:96370542-96370564 TTCTCCAAGTATGTGTGGTCTGG + Intronic
1102094681 12:110227987-110228009 TTCTCCCACTTTGAGTTCTGTGG - Intergenic
1103159445 12:118716181-118716203 TCTTCCAACTGTGTGTTGTGAGG - Intergenic
1103636670 12:122312914-122312936 TTCTCCAGCTTTGAGCTCTGAGG + Intronic
1105333210 13:19437523-19437545 TTATCTACCTAAGAGTTGTGAGG + Intronic
1105878499 13:24582269-24582291 TTATCTACCTAAGAGTTGTGAGG - Intergenic
1105921353 13:24966824-24966846 TTATCTACCTAAGAGTTGTGAGG + Intergenic
1106026735 13:25962310-25962332 TATTCCTACTATGAGTTGTTTGG - Intronic
1110608526 13:77462032-77462054 TCCTCTAAATATGAATTGTGTGG + Intergenic
1110760396 13:79224720-79224742 TTCTACAAATATTAATTGTGTGG - Intergenic
1112073714 13:95884041-95884063 TTCTCTGGCTATGAGCTGTGAGG + Intronic
1115376331 14:32680830-32680852 GTATACAACTATGAATTGTGTGG + Intronic
1118137382 14:63045134-63045156 TTCTCCAAAAATGTGTTCTGCGG + Exonic
1122334626 14:100963305-100963327 TTGTCCAATTATGAAATGTGAGG + Intergenic
1124365425 15:29067807-29067829 TTTTCAAATTATGAGTTGTAGGG + Intronic
1124659861 15:31538339-31538361 TTTTCAGACTCTGAGTTGTGTGG + Intronic
1124937614 15:34187097-34187119 TTCTCCAACTATCAGCAGAGAGG - Intronic
1124943616 15:34242288-34242310 TTCTCAAACTATCTGTGGTGAGG + Intronic
1127401970 15:58597432-58597454 TTCTTCAACTGTTACTTGTGAGG + Exonic
1127682940 15:61315223-61315245 TTCTCAGACTATTACTTGTGTGG - Intergenic
1129381632 15:75171422-75171444 TTCTCCATCTATGAAATGAGGGG + Intergenic
1136929659 16:34407828-34407850 TTCTCAAACTATCAGTGGTAAGG - Intergenic
1136974915 16:35003977-35003999 TTCTCAAACTATCAGTGGTAAGG + Intergenic
1138754507 16:59466999-59467021 TTCTCCAAATATAAAATGTGTGG - Intergenic
1138777962 16:59747846-59747868 TTCTTCTACTATGACTTGTCAGG + Intronic
1140344950 16:74203976-74203998 TTTTTAAACTATGAGTTTTGGGG + Intergenic
1140857601 16:78991622-78991644 TTCTCCACCTACCAGTGGTGGGG + Intronic
1144506680 17:15837436-15837458 TTCTCCAACAAAGAACTGTGTGG - Intergenic
1144692127 17:17274198-17274220 TCTTCCAATTTTGAGTTGTGGGG + Intronic
1145170860 17:20655370-20655392 TTCTCCAACAAAGAACTGTGTGG - Intergenic
1146144830 17:30405148-30405170 TTCTCCAAAGATGACTTTTGAGG + Intronic
1146572687 17:33966590-33966612 TTCTCATACTATCAGGTGTGTGG - Intronic
1147335566 17:39725283-39725305 TCCTCCAACTGTGTGTTGTGGGG - Intronic
1152345755 17:79750220-79750242 TTCTCTAACGATGGGTGGTGGGG - Intergenic
1155999560 18:32369921-32369943 TTCTTCAACTGTGAGGTTTGGGG + Intronic
1159367103 18:67482574-67482596 TTCTCAAACCATCTGTTGTGAGG - Intergenic
1159370294 18:67519781-67519803 AGCTCCAATTATGGGTTGTGTGG - Intergenic
1164882772 19:31748884-31748906 TTCTCCACGTTTGAGTTTTGTGG - Intergenic
1166693145 19:44836329-44836351 TCCTCCCACTCTGAGTAGTGGGG - Intergenic
1168297132 19:55382958-55382980 TCCTCCACCTACGTGTTGTGTGG + Intronic
925346069 2:3172847-3172869 TTCTCCACCTCTGCATTGTGTGG - Intergenic
926316044 2:11710728-11710750 TTCTTCTACTAGGAGCTGTGTGG - Intronic
927610194 2:24531289-24531311 CTCTCCAATTGTGAATTGTGTGG - Intronic
931120027 2:59206258-59206280 TTCTGCAAGTCTGAGGTGTGTGG + Intergenic
932964918 2:76461835-76461857 TTCTCCAAATAATATTTGTGAGG + Intergenic
940585374 2:155641761-155641783 TTCCCCAACTCTTAGTTTTGTGG + Intergenic
941871925 2:170394738-170394760 CTCTCCAACTCTGAATTCTGTGG + Intronic
943887150 2:193233800-193233822 TTCTCCAATGATTAGTGGTGTGG - Intergenic
944917468 2:204375651-204375673 TTTTCCAATTAAGAGTTTTGTGG + Intergenic
946252461 2:218421898-218421920 TTCTTCATCTATGAGCTGAGGGG - Intronic
1169532927 20:6504819-6504841 AGCTCTAACTATGAGTTATGTGG - Intergenic
1176162252 20:63653765-63653787 TTCTCCAACTTGGCTTTGTGAGG + Intergenic
1176739828 21:10591070-10591092 TTATCTACCTAAGAGTTGTGAGG - Intronic
1177004931 21:15660313-15660335 TTCACAAACTATGAGCAGTGGGG + Intergenic
1177086199 21:16708141-16708163 GTCTCCAACAATGAATTGGGGGG + Intergenic
1178718180 21:34985788-34985810 TTCTCCAACGATGTGGTATGCGG + Intronic
1181750494 22:24985884-24985906 TTCTCCAACTGTGTTTTGCGAGG + Intronic
1183238112 22:36635505-36635527 TTCTCCCACTATTAGATGTTTGG - Intronic
1184235371 22:43180386-43180408 TTCCCAAACTAAGAGTGGTGAGG + Intronic
952186188 3:30971786-30971808 TTCTCCATCTATCAGCTGTAGGG - Intergenic
952570319 3:34708147-34708169 TTCTTCAACTTTAAGTTCTGGGG - Intergenic
952646885 3:35670752-35670774 TGCTCCATCAATGTGTTGTGAGG + Intronic
952906456 3:38142095-38142117 TTCATCAAGTATGAGTTCTGGGG + Exonic
955970251 3:64431900-64431922 TTCTCCTACTTTGAGTGCTGAGG - Intronic
957308990 3:78494936-78494958 TTCTCCAACAATGAGGTGCTGGG - Intergenic
957610501 3:82459490-82459512 TTCTCCAACTATGGGTCATAAGG - Intergenic
963653056 3:148008663-148008685 TTCTCCAACTGAAAGTTGTCTGG - Intergenic
964442008 3:156721509-156721531 TTATCCAACTTTCAGATGTGAGG + Intergenic
966047875 3:175575096-175575118 TTCTTAAACTAAGAGTTGTCTGG - Intronic
966310720 3:178590710-178590732 TTCTCCAACTACAAGCTGTATGG - Intronic
967336060 3:188345961-188345983 TTCTCCATCTGTGAGATGGGAGG + Intronic
967713506 3:192736961-192736983 TTCTCCAACTTGGAGATTTGGGG - Intronic
967790953 3:193548555-193548577 TTCCCCCACTATGAGATCTGTGG + Intronic
969153462 4:5190010-5190032 CTCTCCACATATGATTTGTGGGG - Intronic
970652469 4:18193672-18193694 TTCTCCAACCATCAGGTGGGTGG + Intergenic
972163994 4:36260408-36260430 GACTCCAACTTTGAATTGTGAGG - Intergenic
974970608 4:68821782-68821804 TTCCCTAACTATGAGTACTGAGG - Intronic
974991837 4:69102312-69102334 TTCCCTAACTATGAGCTCTGAGG - Intronic
984085716 4:175308739-175308761 TTCTCACACAATGAGCTGTGTGG - Intergenic
985852142 5:2396828-2396850 TTCTCCCACTTTGAGGTGTGTGG + Intergenic
987524563 5:19030791-19030813 TTCTATCACTCTGAGTTGTGAGG - Intergenic
987686844 5:21215673-21215695 TTCTCCATCTATGATTTAAGTGG - Intergenic
990004482 5:50930102-50930124 TTCTCCATTTATGAAATGTGCGG - Intergenic
990272411 5:54157768-54157790 TTCTCCAAATAGAACTTGTGTGG + Intronic
991292162 5:65043557-65043579 TTCTCCAAATAGGAGTGGAGGGG + Intergenic
996127802 5:119746519-119746541 TTTTCCACCAATGAGATGTGTGG + Intergenic
996384659 5:122898558-122898580 TTCTCCATCTTTGAGTTCTTTGG + Intronic
996863118 5:128087234-128087256 TTCTCCATTTATGAGTTATTGGG + Intronic
997837605 5:137208383-137208405 TCTCCCATCTATGAGTTGTGTGG - Intronic
1003487414 6:6591657-6591679 TTCTGCCACTATTAGCTGTGTGG - Intronic
1003722596 6:8720632-8720654 TTCTTAAAATATGAGTTTTGGGG - Intergenic
1003763136 6:9204701-9204723 TTCTCCAAATATGAGTAGATTGG + Intergenic
1007996865 6:46316927-46316949 TTTTCCCATTATGAGTTGTGTGG + Intronic
1013464084 6:110401408-110401430 TTCTCCAAATTTGGGGTGTGTGG + Intronic
1014768095 6:125430379-125430401 TTCTCCATCTGTGAAATGTGAGG + Intergenic
1015188960 6:130452137-130452159 TTAACCAACTATGATGTGTGTGG - Intergenic
1015877487 6:137837732-137837754 TTTTGCAACTGTGAATTGTGCGG + Intergenic
1022533685 7:31082778-31082800 TTCTCCAGCTCTGAGTTCTACGG - Intronic
1025165035 7:56704932-56704954 TACTCCAACTATGAGCTGCCAGG - Intergenic
1025705259 7:63857160-63857182 TACTCCAACTATGAGCTGCCAGG + Intergenic
1026113932 7:67480516-67480538 TTCTCCATCCATCAGGTGTGAGG + Intergenic
1028325035 7:89513066-89513088 TTCTCCAGCTATAAAATGTGTGG + Intergenic
1037719390 8:21429993-21430015 AGCTCCAAATGTGAGTTGTGGGG - Intergenic
1039099157 8:33922276-33922298 TTCTCAAACTCTGATTTATGAGG + Intergenic
1046017246 8:108619861-108619883 TTCTCCCACAAAGAGTTATGTGG - Intronic
1046175975 8:110575436-110575458 TTCTCAATCTATGAGTTCTCAGG - Intergenic
1046353068 8:113041254-113041276 TTCTCCAACAATGGAATGTGTGG + Intronic
1046791940 8:118331900-118331922 TTCCCCAATTATGAATAGTGAGG - Intronic
1047602040 8:126435312-126435334 TTCTCCAAATATAGGTTGAGGGG - Intergenic
1048681974 8:136853148-136853170 TACTCCTACTATGAGTTGCAAGG + Intergenic
1050622573 9:7469863-7469885 TTCTCCAAAGATGATTTTTGAGG + Intergenic
1052623833 9:30948665-30948687 TTTTTCAACTATGAGTTTTCTGG + Intergenic
1187424318 X:19163291-19163313 TTCTTCAATTTTGAGTTGTGTGG + Intergenic
1190024991 X:46913838-46913860 TTCTCCGACTTTGAGTTGCAAGG + Intronic
1190722200 X:53158951-53158973 TTCTCCAAATTTGAGGTGTATGG + Intergenic
1190722786 X:53164003-53164025 TTCTCCAAATTTGAGGTGTATGG + Intergenic
1192829279 X:74733458-74733480 TTCTCAAACTATCTGTGGTGAGG - Exonic
1195789077 X:108561365-108561387 GTCTCAACCTATCAGTTGTGGGG + Intronic
1202598121 Y:26564926-26564948 TTATCTACCTAAGAGTTGTGAGG - Intergenic