ID: 1093639778

View in Genome Browser
Species Human (GRCh38)
Location 12:21512892-21512914
Sequence TGTATTTGCGGGGGTAGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 5, 3: 28, 4: 197}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093639778_1093639785 -2 Left 1093639778 12:21512892-21512914 CCATCTCTACCCCCGCAAATACA 0: 1
1: 0
2: 5
3: 28
4: 197
Right 1093639785 12:21512913-21512935 CAAAAATTAGCTGGGTGTGATGG 0: 874
1: 20817
2: 60021
3: 127910
4: 178276
1093639778_1093639784 -10 Left 1093639778 12:21512892-21512914 CCATCTCTACCCCCGCAAATACA 0: 1
1: 0
2: 5
3: 28
4: 197
Right 1093639784 12:21512905-21512927 CGCAAATACAAAAATTAGCTGGG 0: 1
1: 123
2: 7843
3: 84992
4: 152152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093639778 Original CRISPR TGTATTTGCGGGGGTAGAGA TGG (reversed) Intronic
903082052 1:20818466-20818488 GGTATTTGTGTTGGTAGAGACGG - Intronic
905968247 1:42117332-42117354 TGTCTTTGAAGGGGCAGAGAGGG + Intergenic
906190171 1:43893753-43893775 TGCATTTGCTGGTGGAGAGAAGG - Intronic
906207363 1:43994273-43994295 TGTATTTGTTTTGGTAGAGATGG - Intronic
908914450 1:69109661-69109683 TGTACTTGTGGGGGTAGAGAGGG - Intergenic
909711710 1:78658621-78658643 TTTATTTGAAGGGGCAGAGAAGG - Intronic
912093591 1:106112995-106113017 TGTATCTGCGTGTGTAGATATGG - Intergenic
912853166 1:113144632-113144654 TGTACTTAAGGGTGTAGAGAAGG - Intergenic
914214696 1:145614746-145614768 TGCATTTGGGAGGGCAGAGAGGG + Intronic
914466636 1:147935138-147935160 TGCATTTGGGAGGGCAGAGAGGG + Intronic
915389911 1:155533081-155533103 TCTATTTTCAGGGGTAGAAAGGG + Intronic
917262878 1:173188894-173188916 GGTTTTTGAGGGGGTAGAGATGG + Intronic
918495108 1:185126648-185126670 TGAATTGGAGGTGGTAGAGAGGG + Intronic
919058726 1:192603884-192603906 TGAAGTTGAGGGAGTAGAGAAGG - Intergenic
919122118 1:193354251-193354273 TTTTTTGTCGGGGGTAGAGATGG - Intergenic
920257186 1:204663570-204663592 TGCATTTCCCAGGGTAGAGAGGG - Intronic
920941101 1:210483545-210483567 TGTATTTGTGGGGTAAGGGAGGG + Intronic
922075278 1:222237512-222237534 TGCATTTGTGGGTGGAGAGAAGG - Intergenic
923867617 1:237956995-237957017 TGTATGTGTGTGTGTAGAGATGG + Intergenic
924548781 1:245054673-245054695 TGTATTGGCTGGGAAAGAGAAGG - Intronic
1062909167 10:1201250-1201272 TGCATTTGCAGAGGGAGAGAGGG - Intronic
1062962219 10:1581122-1581144 TGTATTGGCGAGGATATAGAGGG - Intronic
1063369656 10:5512784-5512806 GGTATTTGCAGGGGGTGAGACGG + Intergenic
1063444860 10:6106006-6106028 TGAAGTTGCAGGGGTAGAGGGGG - Intronic
1065355015 10:24832197-24832219 TGTTTTTGTTGGGGTAGAGACGG - Intergenic
1065606637 10:27424961-27424983 TGTATTTCCAGTGGTAAAGAGGG + Intergenic
1068716847 10:60198295-60198317 TGTATTTGGGGGGACAGAGCAGG + Intronic
1069525373 10:69165634-69165656 TGTATTTTTTGGGATAGAGATGG - Intronic
1071537936 10:86451789-86451811 TGTCTCTGCTGGGGTAGAAAGGG - Intronic
1072094994 10:92169489-92169511 TGTCTTTACTGGGGGAGAGAAGG - Intronic
1078361231 11:10669475-10669497 TGTATTTGCTGGGGAGGACAGGG - Intronic
1079192217 11:18288995-18289017 TGTTTTTGTGTGTGTAGAGACGG + Intronic
1079205363 11:18410227-18410249 TTTATTTTTGGGGGTAGAGATGG + Intergenic
1080595431 11:33769867-33769889 TTTTTTTGCGGGGGTAGAAGAGG + Intronic
1081099042 11:38978705-38978727 AGCATTGGCGGGGGTGGAGAGGG - Intergenic
1082007037 11:47425091-47425113 TGTATGTGGAGGGGAAGAGAGGG - Intronic
1083914832 11:65735008-65735030 TTTTTTTGGGGGGGTAGAGATGG - Intergenic
1084072771 11:66746877-66746899 TTTATTTTTGGGGGGAGAGAGGG - Intronic
1084790047 11:71469296-71469318 TGTATTTTCTTTGGTAGAGAGGG - Intronic
1088414036 11:109569249-109569271 TGTATTTGCAGTGGTGGACAAGG + Intergenic
1091389016 12:114169-114191 TGGATTTTCGAGGGCAGAGAGGG + Intronic
1091854245 12:3726067-3726089 TGTATTTCAGGTGGTAAAGATGG - Intronic
1093639778 12:21512892-21512914 TGTATTTGCGGGGGTAGAGATGG - Intronic
1094302073 12:28975698-28975720 TGGATTTATGGGAGTAGAGAAGG - Intergenic
1095473282 12:42559631-42559653 TTTTTTGGGGGGGGTAGAGATGG + Intronic
1095857191 12:46873340-46873362 TGTATGTGTTGGGGTAGAGATGG + Intergenic
1098328128 12:69323725-69323747 TGAATTTGGGGGTGTAGTGAAGG - Intergenic
1098819265 12:75208368-75208390 TGTGTTTGGGGAGGCAGAGAGGG - Intronic
1099637572 12:85234058-85234080 TGTATTTTTGGGGGTAGAGATGG - Intronic
1099847589 12:88047772-88047794 TGTGTTTGCGGGGGCAGAGGTGG - Intronic
1102681686 12:114694879-114694901 CCAATTTGCAGGGGTAGAGAAGG + Intergenic
1102850999 12:116245040-116245062 TTTATTTGCTGGGGTGAAGAAGG - Intronic
1102904767 12:116666091-116666113 TGAATTTGAGGGGGCACAGAAGG - Intergenic
1103395406 12:120603123-120603145 CGTGGTTGCGGGGGTAGAGACGG - Intergenic
1105823922 13:24105307-24105329 TGTATTTTGGGGGGTAGAGACGG + Intronic
1105955362 13:25277096-25277118 TGTATTTGTGAGGGGTGAGAGGG - Intronic
1105964301 13:25371453-25371475 TGTGCGTGCGGGGGTTGAGAAGG + Intergenic
1106035192 13:26037857-26037879 TGTATTTGCTTGTGTAGATACGG - Intergenic
1109901704 13:68781174-68781196 TGTATTTGCGGAAGCAGAGTGGG - Intergenic
1114036872 14:18637292-18637314 TGTATGTGCGGGGGAGAAGATGG - Intergenic
1114121767 14:19677751-19677773 TGTATGTGCGGGGGAGAAGATGG + Intergenic
1114554222 14:23552149-23552171 AGTAATTGCTGCGGTAGAGAAGG - Intronic
1115517945 14:34205074-34205096 TGTATTTGAGGTGATGGAGAAGG - Intronic
1117872010 14:60210947-60210969 TTTTTTTTGGGGGGTAGAGATGG + Intergenic
1118960475 14:70525390-70525412 TTTTTTTGGGGGGATAGAGATGG + Intronic
1119807984 14:77495058-77495080 TATTTTTTGGGGGGTAGAGATGG + Intronic
1120164041 14:81175017-81175039 TTTTTTGGCGGGGGGAGAGAGGG + Intergenic
1120505458 14:85349843-85349865 TGTCTTTGCCAGGGTAGACATGG - Intergenic
1122803323 14:104243873-104243895 TGTATTTTTGGTAGTAGAGACGG + Intergenic
1122964941 14:105118721-105118743 TGTATGTGTGGGGGGAGGGATGG + Intergenic
1123625724 15:22225645-22225667 TTTTTTTTGGGGGGTAGAGAAGG + Intergenic
1124890107 15:33724958-33724980 AGTCTTGGCGGGGGTGGAGAGGG + Intronic
1126800504 15:52293481-52293503 TGTATTTGCAGGGGTTGAAGGGG - Intronic
1128292086 15:66485578-66485600 TTTATTTGCGGGGGTTGGGAGGG + Intronic
1128603300 15:69015790-69015812 TGTCTTTGGGGGGGCAGTGATGG + Intronic
1128876704 15:71207800-71207822 GGTGGTGGCGGGGGTAGAGATGG - Intronic
1132668275 16:1091602-1091624 TGCAGTTGTGGGGGCAGAGAGGG - Intronic
1141131017 16:81436915-81436937 TCTTTTTTTGGGGGTAGAGATGG + Intergenic
1143950427 17:10628384-10628406 TGCATGTGCGGAGGGAGAGATGG - Intergenic
1146918666 17:36695147-36695169 TGTATTTGGGGGGGTGGTTACGG + Intergenic
1147734690 17:42628298-42628320 TGTATTTGATGAGGCAGAGAGGG - Intergenic
1148883185 17:50748492-50748514 TTTTTTTGGGGGGGTAGAGATGG + Intronic
1150051218 17:61965116-61965138 TGTATTTGCTTGTGTAGACATGG + Exonic
1151257655 17:72891393-72891415 TTTTTTTGAGAGGGTAGAGAAGG - Intronic
1151923233 17:77173514-77173536 TGGCTTTGAGGGGGTAGAGGTGG + Intronic
1152600026 17:81257658-81257680 TGTTGGTGCGGGGGCAGAGATGG - Intronic
1155010028 18:21767922-21767944 TGTATTGGCGGGGGCAGTGGGGG - Intronic
1155988970 18:32259647-32259669 TGTATTTTTCGGGGTAGAGATGG + Intronic
1156253587 18:35375272-35375294 TTTTTTTGGTGGGGTAGAGATGG - Intronic
1157552206 18:48589605-48589627 TGTTTTTGTGGTGCTAGAGAGGG + Intronic
1161518413 19:4710109-4710131 TGTGTTTGCAGGGGCAGAGCTGG - Intronic
1161909598 19:7183113-7183135 TGTATTTCCCTGGGTGGAGAGGG - Intronic
1162772856 19:12960254-12960276 ATTTTTTGCGGGGGTAGAGAAGG - Intergenic
1167009227 19:46795958-46795980 TGTATATTTGGGGGTAGAGACGG - Intergenic
925521766 2:4754425-4754447 TGTATTTGTGGGGGTTGAGGGGG + Intergenic
929305040 2:40351781-40351803 AGTATTTGAGGTTGTAGAGATGG + Intronic
929477907 2:42271296-42271318 TTTATTTAAGAGGGTAGAGAAGG + Intronic
933301684 2:80547860-80547882 TGTATTTGTGGTAGTAGAGACGG + Intronic
935033572 2:99345772-99345794 TTTTTTTTAGGGGGTAGAGATGG - Intronic
935280699 2:101515394-101515416 TGCCTTTGCAGGGGTACAGATGG - Intergenic
935982202 2:108638571-108638593 TGTATTTTTAGTGGTAGAGACGG - Intronic
936150680 2:110020133-110020155 GTTTTTTGGGGGGGTAGAGATGG - Intergenic
936193996 2:110351236-110351258 GTTTTTTGGGGGGGTAGAGATGG + Intergenic
936863276 2:117047568-117047590 TTTCTTTGTGGGGGTAGATATGG - Intergenic
936982833 2:118279766-118279788 TGTATTTTTTGTGGTAGAGATGG - Intergenic
939835384 2:147124127-147124149 TGTGGTGGCGGGAGTAGAGAAGG + Intergenic
941483441 2:166047336-166047358 AATATTTGAGGGGGTAGATAGGG + Intronic
942193812 2:173497645-173497667 TGTACTTCAGGGAGTAGAGAGGG - Intergenic
943627314 2:190215203-190215225 TGTGTTTACTGGGGAAGAGAGGG + Intronic
945396720 2:209327095-209327117 TGTATTTGTTTTGGTAGAGACGG - Intergenic
946105458 2:217365436-217365458 TGTATTTGAGGGGGTGGATCGGG + Intronic
946143323 2:217710294-217710316 TATCTTTGTGGGAGTAGAGATGG - Intronic
946481985 2:220066133-220066155 TTTATTTAGTGGGGTAGAGAAGG - Intergenic
947060558 2:226160231-226160253 TGTCTTTCAGCGGGTAGAGAAGG - Intergenic
947576643 2:231280282-231280304 TGTATTTTCAGTGGGAGAGAAGG - Intronic
948094107 2:235320031-235320053 GGTGTTTCCTGGGGTAGAGAGGG - Intergenic
1169390589 20:5187087-5187109 TTTAGTTGCGGGGGTAGGGTGGG + Intronic
1170792935 20:19522577-19522599 GGCGTTTGCGGGGGAAGAGACGG - Intronic
1171125799 20:22601019-22601041 TGGACTTGGGAGGGTAGAGAGGG + Intergenic
1171969313 20:31553803-31553825 TGTATTTGCTGAGGGAGAAAAGG - Intronic
1172725015 20:37033128-37033150 GCTATTTGCGGGGGTTGAAATGG - Intronic
1173854499 20:46241350-46241372 TGTATGTGCTGGAGAAGAGATGG - Intronic
1174209569 20:48866754-48866776 TATATTTTTGGGGGTAGAGATGG - Intergenic
1174512926 20:51068703-51068725 TGTATTTTTGTTGGTAGAGATGG + Intergenic
1175179195 20:57133204-57133226 TGCATTTGCGGCGGTAGACTTGG - Intergenic
1176864667 21:14039591-14039613 TGTATGTGGGGGAGTAGAGAAGG - Intergenic
1177201762 21:17965161-17965183 TACATTTGAGGAGGTAGAGAGGG - Intronic
1177347417 21:19891467-19891489 TGTATCTGCGGAGGTAAAGGAGG - Intergenic
1177347767 21:19895739-19895761 TGTATCTGCGGAGGTAAAGGAGG - Intergenic
1178997354 21:37415635-37415657 TTTATTTTTTGGGGTAGAGATGG + Intronic
1180460996 22:15564340-15564362 TGTATGTGCGGGGGAGAAGATGG - Intergenic
1180714722 22:17864196-17864218 TGTGTTTGTAGAGGTAGAGATGG + Intronic
1183168113 22:36162973-36162995 TGTATTTGCTGCATTAGAGAGGG + Intronic
1183810023 22:40247896-40247918 TGTATTTTTGTTGGTAGAGACGG - Intronic
1183824928 22:40378556-40378578 TGTATTTTTGGTAGTAGAGATGG - Intronic
1184792436 22:46708340-46708362 TGCATTTGTGGGAGCAGAGAGGG + Intronic
949361760 3:3239789-3239811 TCTACATGTGGGGGTAGAGATGG + Intergenic
950434408 3:12970107-12970129 TGAATTAGCTGGGGTAGAGGTGG - Intronic
953061929 3:39434747-39434769 AGTATTGGCGGGGATACAGAGGG - Intergenic
955973392 3:64458266-64458288 TGAATTTGCGGGGGGAGGGGTGG - Intergenic
960040169 3:113142605-113142627 TGTGTGTGAGGGGATAGAGAGGG + Intergenic
960743050 3:120856049-120856071 TTTTTTTGCGGGGGGAGAGAGGG - Intergenic
961135288 3:124504508-124504530 TGGATTTGCTGGGGCAGAGTGGG - Intronic
961645441 3:128390415-128390437 TGTATTTTGGGAGGTAGAGGGGG + Intronic
962776890 3:138669515-138669537 TGTATTTGTTGGGGTAGAGTGGG + Intronic
964311566 3:155399359-155399381 TGTTTTTGTGGTGGTAGAGAGGG + Intronic
964569546 3:158096599-158096621 TGAATTTGACGGGATAGAGAGGG + Intronic
965178373 3:165365965-165365987 TGTATTTTCCGGGGGAGAGGTGG - Intergenic
966885736 3:184377275-184377297 TTTATGTGTGGGGGTAGATAGGG - Intronic
968352455 3:198070959-198070981 TGAGTTTGAGGAGGTAGAGAAGG - Intergenic
973271128 4:48264331-48264353 GTTTTTTGCTGGGGTAGAGAAGG - Intronic
974322023 4:60362948-60362970 TGAATTTGCGAGCATAGAGATGG - Intergenic
974409505 4:61521162-61521184 TCTATTTGGTGGGTTAGAGAAGG + Intronic
981665850 4:147225226-147225248 TGTATTTGTGTGGGTAGATATGG - Intergenic
982074545 4:151725385-151725407 TGTATTTGCTGAGGTAGTCATGG - Intronic
983364036 4:166763645-166763667 TGTGTGTGCTGGGGTAGGGAGGG + Intronic
985920512 5:2968112-2968134 TGTATTTCAGGGTATAGAGAAGG - Intergenic
989573458 5:42967227-42967249 TTTTTTTGCGTGTGTAGAGATGG - Intergenic
992782052 5:80136961-80136983 TGTATTTTTGGGGGTAGAGATGG - Intronic
994310590 5:98265934-98265956 TTTATTTGCTGTGCTAGAGACGG - Intergenic
994458556 5:100046721-100046743 TGTATTAGTGGGGTTAGCGATGG + Intergenic
995123113 5:108556099-108556121 TGGATTGGAGGGGGTACAGAGGG + Intergenic
996518932 5:124404912-124404934 TGTATTTACAAGGGTAGAGAAGG - Intergenic
996711578 5:126548432-126548454 TTTTTTTGCGGGGGAAGACAGGG + Intronic
997389203 5:133499785-133499807 TGTACTGTCGGAGGTAGAGATGG - Intronic
997659691 5:135579605-135579627 TGTGTATGCGGGGGTGGGGACGG + Intergenic
999910602 5:156194203-156194225 TGTATTTTTTGTGGTAGAGATGG - Intronic
1000138904 5:158382096-158382118 AATATTGGCAGGGGTAGAGAGGG + Intergenic
1001928307 5:175655449-175655471 TGTATATCCTGGAGTAGAGAAGG - Intergenic
1002065843 5:176651293-176651315 TGTGTCAGCGGGGGTAGCGACGG - Intronic
1002939646 6:1704837-1704859 TGTTTTGGCGGCGGTGGAGAGGG + Intronic
1003780388 6:9417841-9417863 TGTTTTTTCTTGGGTAGAGATGG + Intergenic
1003861358 6:10324973-10324995 TATATTTTTGGGGGTAGAGATGG - Intergenic
1008399369 6:51047001-51047023 TTTTTTTGTGGGGGTAGAGACGG + Intergenic
1011193202 6:84755031-84755053 TGTGTGTGCGTGTGTAGAGAGGG - Intronic
1012274898 6:97261338-97261360 TGTCTTCGGGGTGGTAGAGATGG - Intronic
1015357912 6:132301567-132301589 TGTCTTTCTCGGGGTAGAGAAGG + Intronic
1016885886 6:148959423-148959445 TGTATTTAAGGAGGCAGAGACGG - Intronic
1018187317 6:161277325-161277347 TGTGATGGCGGAGGTAGAGATGG + Intergenic
1022857571 7:34330508-34330530 TGTATTTGGGGCAGTAGGGAAGG + Intergenic
1023149277 7:37184735-37184757 TCTTTTTTGGGGGGTAGAGATGG - Intronic
1023225582 7:37965566-37965588 TGAAGTTGCGGGGAAAGAGAAGG + Intronic
1023895899 7:44432632-44432654 TGTATTTGGGGTGGTGGAGAGGG - Intronic
1024098443 7:46005186-46005208 TGTGTTTCCTGGGGTAGAGGCGG + Intergenic
1025637173 7:63332692-63332714 TGTATTTTCAGGGGCAGACAGGG - Intergenic
1025645522 7:63415410-63415432 TGTATTTTCAGGGGCAGACAGGG + Intergenic
1025831490 7:65055081-65055103 TGTAGTTGGGGGGTTAGAGGGGG - Intergenic
1026194598 7:68162239-68162261 TGTGTTTGTGTGTGTAGAGATGG - Intergenic
1027125910 7:75556509-75556531 TGTATTTTCTTTGGTAGAGACGG - Intronic
1027137279 7:75633751-75633773 TGTATTTGCTGGGTTGGAGGAGG - Intronic
1029145507 7:98443011-98443033 TGTATTTTGGGGGGTAGAGATGG + Intergenic
1033151619 7:138919669-138919691 TGTATGTGTGGGGGTGGGGAGGG + Intronic
1033266720 7:139893373-139893395 TGTATATTCGGGGGTATTGAAGG - Intronic
1034108451 7:148512897-148512919 TGTATCAGAGGGAGTAGAGATGG - Intergenic
1034341713 7:150361453-150361475 TGTGTTGGCGGGGGTACAGGGGG + Intergenic
1037547448 8:19938816-19938838 TGACTTTGCGGGGGTGGGGATGG + Intronic
1038049386 8:23794877-23794899 TATTTTTACGGGGGAAGAGAGGG - Intergenic
1040725449 8:50377119-50377141 TGTATTTGAGGAGGGTGAGAAGG + Intronic
1041207942 8:55517418-55517440 TGTATCTGCGTGGGTACTGACGG - Intronic
1042003479 8:64154078-64154100 TGTATTTGCATGTGTAGTGATGG + Intergenic
1042369795 8:67978199-67978221 TGTATGTGCGGGGGGAGAGGAGG - Intronic
1042825080 8:72971923-72971945 TGTATTTGTTTCGGTAGAGATGG - Intergenic
1045004893 8:97909111-97909133 TGTATTTCTTGTGGTAGAGATGG + Intronic
1046600403 8:116310391-116310413 TGTATTTTCATGGGCAGAGATGG - Intergenic
1050515778 9:6442660-6442682 TTTTTTTGGGGGGGTAGAGATGG + Intronic
1051295317 9:15588880-15588902 TGTATTTGTTTTGGTAGAGATGG + Intronic
1053502248 9:38608263-38608285 TGAGTTTGAGGAGGTAGAGAAGG - Intergenic
1055320260 9:75076761-75076783 TGTATTTTTTTGGGTAGAGATGG + Intronic
1057602494 9:96470972-96470994 TGTATTTGTGTGACTAGAGAGGG + Intronic
1059030483 9:110688244-110688266 GGTAATTGCAGGAGTAGAGATGG - Intronic
1060130600 9:121094112-121094134 TTTTTTTGCGGGGGTGGGGAGGG - Intronic
1060591042 9:124817172-124817194 TGTGTATGTGGGGGTGGAGATGG - Intergenic
1062118780 9:134822844-134822866 TGTATTTGCCCGGCTAGAGTGGG - Intronic
1062361100 9:136188550-136188572 TTTTTGGGCGGGGGTAGAGACGG - Intergenic
1062504807 9:136867653-136867675 TGTATTTTGTGGGGTAGAGATGG + Intronic
1185652586 X:1659570-1659592 TATATTTGCGTGTGTAGATATGG + Intergenic
1185724960 X:2412190-2412212 TGTATTTGGGGGGGCAGGGGAGG + Intronic
1185857393 X:3548787-3548809 TTTATTTGTGGTGGCAGAGAGGG - Intergenic
1186381902 X:9069705-9069727 TGTATTTGCAGGGTTGCAGACGG + Intronic
1186625642 X:11290475-11290497 TTTTTTTGCTGGGGTAGAGTTGG - Intronic
1189216785 X:39332145-39332167 TGTGTTGGCGGGGGGAGAGAGGG - Intergenic
1190085887 X:47394991-47395013 TGTATTTTTGTTGGTAGAGATGG + Intronic
1190512035 X:51182845-51182867 TGTATGTGGGTGGGTAGATAGGG - Intergenic
1192981729 X:76351322-76351344 TGTGTCTGCGGTGGTAGACAAGG - Intergenic
1193990995 X:88307274-88307296 TGTACTTGAGGGTGAAGAGAGGG - Intergenic
1194588376 X:95766329-95766351 TGTATGTGCTGGGGCAGGGATGG - Intergenic
1195670513 X:107466061-107466083 TGTATTTGAGGAGGAAAAGAAGG - Intergenic
1196166896 X:112545496-112545518 TGTATCTGTGGGGGTAGGAATGG - Intergenic
1196198624 X:112860824-112860846 TGTGTTTGCGGGGGGAGGGGGGG + Intergenic
1196399107 X:115295247-115295269 TGTATTTTCTTTGGTAGAGACGG + Intronic
1197144875 X:123160214-123160236 TGTGTTTGCGGGGGGCAAGAGGG + Intergenic