ID: 1093639880

View in Genome Browser
Species Human (GRCh38)
Location 12:21513757-21513779
Sequence CTATTGCCCAGGCTATAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7521
Summary {0: 1, 1: 10, 2: 305, 3: 2321, 4: 4884}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093639880_1093639886 23 Left 1093639880 12:21513757-21513779 CCACACTATAGCCTGGGCAATAG 0: 1
1: 10
2: 305
3: 2321
4: 4884
Right 1093639886 12:21513803-21513825 AAAGAAAAAAGAGAAAGGAAAGG 0: 3
1: 30
2: 454
3: 3850
4: 18659
1093639880_1093639887 30 Left 1093639880 12:21513757-21513779 CCACACTATAGCCTGGGCAATAG 0: 1
1: 10
2: 305
3: 2321
4: 4884
Right 1093639887 12:21513810-21513832 AAAGAGAAAGGAAAGGAGAAAGG 0: 2
1: 21
2: 200
3: 1737
4: 9999
1093639880_1093639885 18 Left 1093639880 12:21513757-21513779 CCACACTATAGCCTGGGCAATAG 0: 1
1: 10
2: 305
3: 2321
4: 4884
Right 1093639885 12:21513798-21513820 ACAAAAAAGAAAAAAGAGAAAGG 0: 1
1: 18
2: 501
3: 5995
4: 50005

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093639880 Original CRISPR CTATTGCCCAGGCTATAGTG TGG (reversed) Intronic
Too many off-targets to display for this crispr