ID: 1093639885

View in Genome Browser
Species Human (GRCh38)
Location 12:21513798-21513820
Sequence ACAAAAAAGAAAAAAGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56520
Summary {0: 1, 1: 18, 2: 501, 3: 5995, 4: 50005}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093639879_1093639885 21 Left 1093639879 12:21513754-21513776 CCGCCACACTATAGCCTGGGCAA 0: 2
1: 66
2: 1200
3: 12400
4: 98812
Right 1093639885 12:21513798-21513820 ACAAAAAAGAAAAAAGAGAAAGG 0: 1
1: 18
2: 501
3: 5995
4: 50005
1093639883_1093639885 7 Left 1093639883 12:21513768-21513790 CCTGGGCAATAGGGCAAAACCTT 0: 1
1: 35
2: 753
3: 7144
4: 32612
Right 1093639885 12:21513798-21513820 ACAAAAAAGAAAAAAGAGAAAGG 0: 1
1: 18
2: 501
3: 5995
4: 50005
1093639880_1093639885 18 Left 1093639880 12:21513757-21513779 CCACACTATAGCCTGGGCAATAG 0: 1
1: 10
2: 305
3: 2321
4: 4884
Right 1093639885 12:21513798-21513820 ACAAAAAAGAAAAAAGAGAAAGG 0: 1
1: 18
2: 501
3: 5995
4: 50005

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093639885 Original CRISPR ACAAAAAAGAAAAAAGAGAA AGG Intronic
Too many off-targets to display for this crispr