ID: 1093639886

View in Genome Browser
Species Human (GRCh38)
Location 12:21513803-21513825
Sequence AAAGAAAAAAGAGAAAGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 22996
Summary {0: 3, 1: 30, 2: 454, 3: 3850, 4: 18659}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093639879_1093639886 26 Left 1093639879 12:21513754-21513776 CCGCCACACTATAGCCTGGGCAA 0: 2
1: 66
2: 1200
3: 12400
4: 98812
Right 1093639886 12:21513803-21513825 AAAGAAAAAAGAGAAAGGAAAGG 0: 3
1: 30
2: 454
3: 3850
4: 18659
1093639883_1093639886 12 Left 1093639883 12:21513768-21513790 CCTGGGCAATAGGGCAAAACCTT 0: 1
1: 35
2: 753
3: 7144
4: 32612
Right 1093639886 12:21513803-21513825 AAAGAAAAAAGAGAAAGGAAAGG 0: 3
1: 30
2: 454
3: 3850
4: 18659
1093639884_1093639886 -7 Left 1093639884 12:21513787-21513809 CCTTGTCTCAAACAAAAAAGAAA 0: 12
1: 381
2: 15347
3: 24133
4: 49908
Right 1093639886 12:21513803-21513825 AAAGAAAAAAGAGAAAGGAAAGG 0: 3
1: 30
2: 454
3: 3850
4: 18659
1093639880_1093639886 23 Left 1093639880 12:21513757-21513779 CCACACTATAGCCTGGGCAATAG 0: 1
1: 10
2: 305
3: 2321
4: 4884
Right 1093639886 12:21513803-21513825 AAAGAAAAAAGAGAAAGGAAAGG 0: 3
1: 30
2: 454
3: 3850
4: 18659

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093639886 Original CRISPR AAAGAAAAAAGAGAAAGGAA AGG Intronic
Too many off-targets to display for this crispr