ID: 1093639887

View in Genome Browser
Species Human (GRCh38)
Location 12:21513810-21513832
Sequence AAAGAGAAAGGAAAGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 11959
Summary {0: 2, 1: 21, 2: 200, 3: 1737, 4: 9999}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093639884_1093639887 0 Left 1093639884 12:21513787-21513809 CCTTGTCTCAAACAAAAAAGAAA 0: 12
1: 381
2: 15347
3: 24133
4: 49908
Right 1093639887 12:21513810-21513832 AAAGAGAAAGGAAAGGAGAAAGG 0: 2
1: 21
2: 200
3: 1737
4: 9999
1093639880_1093639887 30 Left 1093639880 12:21513757-21513779 CCACACTATAGCCTGGGCAATAG 0: 1
1: 10
2: 305
3: 2321
4: 4884
Right 1093639887 12:21513810-21513832 AAAGAGAAAGGAAAGGAGAAAGG 0: 2
1: 21
2: 200
3: 1737
4: 9999
1093639883_1093639887 19 Left 1093639883 12:21513768-21513790 CCTGGGCAATAGGGCAAAACCTT 0: 1
1: 35
2: 753
3: 7144
4: 32612
Right 1093639887 12:21513810-21513832 AAAGAGAAAGGAAAGGAGAAAGG 0: 2
1: 21
2: 200
3: 1737
4: 9999

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093639887 Original CRISPR AAAGAGAAAGGAAAGGAGAA AGG Intronic
Too many off-targets to display for this crispr