ID: 1093641170

View in Genome Browser
Species Human (GRCh38)
Location 12:21528032-21528054
Sequence GGGAGCCGCAGCGCCAGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 394
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 349}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093641170_1093641178 17 Left 1093641170 12:21528032-21528054 CCCAGGCTGGCGCTGCGGCTCCC 0: 1
1: 0
2: 3
3: 41
4: 349
Right 1093641178 12:21528072-21528094 CGGCTGTTCAGCCAGCCCTCTGG 0: 1
1: 0
2: 1
3: 10
4: 113
1093641170_1093641174 -3 Left 1093641170 12:21528032-21528054 CCCAGGCTGGCGCTGCGGCTCCC 0: 1
1: 0
2: 3
3: 41
4: 349
Right 1093641174 12:21528052-21528074 CCCCAAGCCTTATTGGCTTGCGG 0: 1
1: 0
2: 2
3: 6
4: 107
1093641170_1093641179 25 Left 1093641170 12:21528032-21528054 CCCAGGCTGGCGCTGCGGCTCCC 0: 1
1: 0
2: 3
3: 41
4: 349
Right 1093641179 12:21528080-21528102 CAGCCAGCCCTCTGGCTGCCAGG 0: 1
1: 1
2: 3
3: 51
4: 421
1093641170_1093641172 -10 Left 1093641170 12:21528032-21528054 CCCAGGCTGGCGCTGCGGCTCCC 0: 1
1: 0
2: 3
3: 41
4: 349
Right 1093641172 12:21528045-21528067 TGCGGCTCCCCAAGCCTTATTGG 0: 1
1: 0
2: 1
3: 5
4: 62
1093641170_1093641180 26 Left 1093641170 12:21528032-21528054 CCCAGGCTGGCGCTGCGGCTCCC 0: 1
1: 0
2: 3
3: 41
4: 349
Right 1093641180 12:21528081-21528103 AGCCAGCCCTCTGGCTGCCAGGG 0: 1
1: 1
2: 2
3: 40
4: 350

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093641170 Original CRISPR GGGAGCCGCAGCGCCAGCCT GGG (reversed) Intronic
900154471 1:1198441-1198463 GGGAGCTGGAGCGCCAGGCTTGG - Intergenic
900345394 1:2208108-2208130 GGGAGGCTCAGCCCCTGCCTGGG + Intronic
900371774 1:2335436-2335458 GGCATCCCCAGCGCCTGCCTGGG - Intronic
900464077 1:2815600-2815622 GGGAGCAGGAGGGCCAGGCTGGG + Intergenic
900622348 1:3593226-3593248 GGGAGCGGCTGAACCAGCCTCGG + Intronic
900680329 1:3912820-3912842 GGGAGCCCAAGTGCCAGCCCAGG - Intergenic
901408167 1:9064108-9064130 GTGAGCCACAGTGCCAGCCTGGG + Intronic
902301307 1:15504652-15504674 GGGACCAGCTGCCCCAGCCTGGG - Exonic
902363939 1:15958707-15958729 GGCTGCCGAAGCGCCAGCCTGGG + Intronic
902696458 1:18143877-18143899 GGGAGTCACAGCTCCTGCCTTGG - Intronic
902696480 1:18143962-18143984 GGGAGACACAGCCCCAGCCCTGG - Intronic
902698392 1:18155510-18155532 GGGGGCTGGAGAGCCAGCCTGGG - Intronic
902786818 1:18738324-18738346 GGCAGCGGCAGCCCCGGCCTGGG + Intronic
903281658 1:22253609-22253631 GGAGGCTGCAGCTCCAGCCTTGG + Intergenic
903337408 1:22634407-22634429 GGGAGTCACAGCTCCAGCTTGGG + Intergenic
903557838 1:24206314-24206336 GGGAGACCCAGAGCCAGCCTGGG - Intergenic
903671609 1:25039260-25039282 GGGGGAGGCAGAGCCAGCCTGGG + Intergenic
903724665 1:25431412-25431434 GGGAGCCGCCGCGCCGCCGTTGG + Intronic
903765061 1:25728761-25728783 GGGAAACGCAGTGCCTGCCTGGG + Intronic
903820048 1:26095016-26095038 GGCAGGGGCAGGGCCAGCCTGGG + Intergenic
904330624 1:29755807-29755829 GGGGGCTGCAGGGCCAGGCTGGG - Intergenic
904416050 1:30361788-30361810 GGGGGCTGCAGGGCCAGGCTGGG + Intergenic
905717097 1:40161434-40161456 CGGAGCCTCAGCCCCAGCCCCGG - Exonic
905862122 1:41358763-41358785 GGGAGCTTGAGAGCCAGCCTGGG + Intergenic
906154720 1:43607162-43607184 GGGAGCCTCTGCAGCAGCCTGGG + Intronic
906720266 1:47998911-47998933 GGGAGCCAGAGCCCAAGCCTCGG + Intergenic
907280088 1:53341712-53341734 GGGACACTCAGCCCCAGCCTGGG + Intergenic
908132161 1:61083719-61083741 GGGAGCCGGAGCGGCGGCCCGGG + Intronic
915238242 1:154501737-154501759 GGGAGCGGCAGGGCCGGCGTCGG - Exonic
916203839 1:162296789-162296811 TGGAGGCGCATCGCAAGCCTTGG + Intronic
916791874 1:168132303-168132325 GAGAGCCACAGCGCCCGGCTTGG - Intronic
917565215 1:176206659-176206681 GGAGGCAGCAGCTCCAGCCTAGG - Exonic
919881269 1:201902725-201902747 GTGAGCCGCCGCGCCAGGCTGGG + Intronic
920234588 1:204494432-204494454 TGGAGCCGCAGAGCGAGCCCGGG - Intronic
920430504 1:205915568-205915590 GGGAGAGGCAGGGTCAGCCTAGG + Intronic
921199629 1:212792396-212792418 GAGATGCGCAGCGCCCGCCTCGG - Intronic
921220480 1:212970166-212970188 GGGAGCAGCAGCGCCAAGCCAGG - Intronic
922145821 1:222943128-222943150 GGGTGCTGCAGGGCCAGCCTCGG - Exonic
922432073 1:225565151-225565173 GTGAGCCACCGCGCCAGGCTCGG - Intronic
922475931 1:225907052-225907074 GGCAGCCACAGAGCCAGCCTTGG - Intronic
923299732 1:232630126-232630148 GGGAGCCGGCGCGGCAGACTGGG - Intergenic
924198968 1:241640223-241640245 GGGAACCGCAGCGGCGGCCACGG - Exonic
1063382850 10:5597114-5597136 GGGAGCCGCTGGGCCAGCCCTGG - Intergenic
1063663881 10:8050647-8050669 CGGAGCCCCGGCGCCTGCCTGGG - Intergenic
1064229056 10:13513771-13513793 GGGAGCTGCAGCTCCATCCTGGG - Intronic
1065619464 10:27565757-27565779 ATGAGCCACTGCGCCAGCCTAGG - Intergenic
1066058770 10:31704337-31704359 GGTAGGCACAGAGCCAGCCTGGG + Intergenic
1066221178 10:33336726-33336748 GAGCGCCGCAGAGGCAGCCTGGG + Intergenic
1067040878 10:42952529-42952551 GGGAGGCGCATCCCTAGCCTGGG - Intergenic
1067087288 10:43249664-43249686 GGAAGCCCCAGGGCCAGCCAGGG - Intronic
1070523566 10:77275816-77275838 GGGAGGCCCAGCCCCAGCCAAGG + Intronic
1070733410 10:78847113-78847135 GGTAGCAGCTGGGCCAGCCTCGG - Intergenic
1070752791 10:78973905-78973927 GGGATCGGGAGCGCAAGCCTCGG - Intergenic
1071677888 10:87673441-87673463 GTGAGCCACTGTGCCAGCCTGGG + Intronic
1073104338 10:101023645-101023667 GGGAGGCTCAGCCCCACCCTGGG - Intronic
1073113386 10:101076228-101076250 GGGTGACCCAGCCCCAGCCTAGG - Intergenic
1074866106 10:117545278-117545300 GGGAGCCGCAGAGCCTGGCCAGG - Intronic
1075316626 10:121458545-121458567 GGGATCCGCAGGGCCAGCCATGG - Intergenic
1075441693 10:122484900-122484922 GGCAGTGGCAGAGCCAGCCTGGG + Intronic
1076156853 10:128211114-128211136 GGGAGCAGCAGGGACAGCCTTGG + Intergenic
1076239490 10:128893099-128893121 GGGAGACTCAGAGCCAGGCTGGG - Intergenic
1076555261 10:131317436-131317458 GGGAGCCACAGCCCAGGCCTGGG - Intergenic
1076594491 10:131617478-131617500 GGGGTCTGCAGCCCCAGCCTAGG + Intergenic
1076817582 10:132922429-132922451 GGGTGCTGCAGCCCCAGCATGGG - Intronic
1077177235 11:1196453-1196475 GGGAATGACAGCGCCAGCCTCGG + Intronic
1077309630 11:1882592-1882614 GGGAGCAGCCTCGCCCGCCTAGG - Intronic
1077394949 11:2316131-2316153 TGGAGCTGCAGCGCCCACCTAGG - Intronic
1077445256 11:2587751-2587773 GGGGGCCGCAGCACGAGGCTGGG + Intronic
1077637253 11:3851744-3851766 GGGAGCCAAAGCCACAGCCTGGG - Intergenic
1078057338 11:8019067-8019089 GGGCGCGGCTGCGGCAGCCTGGG - Intergenic
1078097783 11:8311242-8311264 GGGAGCTGGAGCCCCAGGCTGGG - Intergenic
1078796806 11:14600536-14600558 GGGAGCCGCCGAGCCAGGCACGG + Intronic
1078801118 11:14644507-14644529 AGGAGCCGCAGCTCCGGCCCGGG - Exonic
1078988114 11:16614112-16614134 CGGAGCCGCAGCCCCTGACTTGG - Intronic
1081198248 11:40187050-40187072 AGGAGCCGCGGCGACTGCCTGGG + Intronic
1082813541 11:57493576-57493598 AGGAGCTGCAGCACCTGCCTGGG - Intronic
1083389191 11:62335557-62335579 TGGAGCTGCTGCACCAGCCTGGG + Intergenic
1083714280 11:64566991-64567013 GGGAGATGCAGCCACAGCCTGGG + Intronic
1083897968 11:65629736-65629758 GTGAGCCGCAGGACCAGGCTCGG + Intronic
1084177108 11:67428677-67428699 CGGAGCCGCCGCTCCGGCCTCGG - Intronic
1084273391 11:68040405-68040427 CGCAGCCCCAGCCCCAGCCTGGG - Intronic
1084634551 11:70382215-70382237 CGGAGCTGCAGTGCCAGACTAGG + Intronic
1086471081 11:87111363-87111385 GTGAGCCACAGCGCCAGGCTAGG - Intronic
1087328757 11:96753884-96753906 GGGAGCCCCCGCCCCAGCCAAGG - Intergenic
1089144277 11:116313071-116313093 GGGAGAGGCAGCACCAGCCCGGG + Intergenic
1089403215 11:118176910-118176932 GTGAGCCACTGCGTCAGCCTGGG - Intergenic
1089428004 11:118396050-118396072 GGGTGCCACTGCACCAGCCTGGG + Intronic
1089496523 11:118910955-118910977 GGGAGGCGCGGAGACAGCCTGGG + Intronic
1093641170 12:21528032-21528054 GGGAGCCGCAGCGCCAGCCTGGG - Intronic
1095097783 12:38157432-38157454 GGCAGCCCCTGCGCCAGACTCGG + Intergenic
1095530268 12:43179009-43179031 ATGAGCCACCGCGCCAGCCTAGG - Intergenic
1097159598 12:57037001-57037023 GGGTGCGGCAGCGCCAGCCTCGG + Exonic
1098201897 12:68064621-68064643 GGGACCCCCAGCTCCAGCCAAGG - Intergenic
1102980121 12:117234695-117234717 AGGAGCTGCAGTACCAGCCTGGG - Exonic
1103226532 12:119292579-119292601 GTGAGCCACAGCGCCCGACTGGG + Intergenic
1103955983 12:124577140-124577162 GGGAGCTGCTGCCCCAGCCCAGG - Intergenic
1103983110 12:124749603-124749625 GTGAGCCACCGCGCCTGCCTGGG + Intergenic
1104380219 12:128300827-128300849 AGGAGCCTCAACACCAGCCTGGG + Intronic
1104733579 12:131122399-131122421 GGGGGCCGCAGCGCCTCCCCGGG + Intronic
1104803895 12:131572620-131572642 TGCAGGAGCAGCGCCAGCCTGGG + Intergenic
1104980240 12:132570336-132570358 AGGAGCAGCAGCGCCCCCCTGGG + Exonic
1105378314 13:19864054-19864076 GGGAGCCGCTGCCGCAGCTTGGG - Intergenic
1105388907 13:19958294-19958316 GGGAGCCGCTGCCGCGGCCTGGG + Intergenic
1105914672 13:24902067-24902089 GAGAGCCTCAGTGCCAGCCTAGG - Intronic
1108807051 13:54170910-54170932 GTGAGCCACCACGCCAGCCTGGG + Intergenic
1108907493 13:55497125-55497147 GTGAGCCACTGCGCCAGCCCTGG - Intergenic
1110317929 13:74132980-74133002 GGAACCCGCAGAGCCGGCCTGGG - Intronic
1114170848 14:20271251-20271273 GGGTGCTCCAGCTCCAGCCTTGG - Intronic
1117482493 14:56161553-56161575 GTGAGCCACAGCGCCTGGCTGGG + Intronic
1118607645 14:67515239-67515261 GGGAGCCAGAGCGCCGGGCTTGG - Exonic
1120998497 14:90434782-90434804 GGGACCCCCAGCCCCAGCCTGGG - Intergenic
1121243965 14:92449592-92449614 TGGGGCAGCAGAGCCAGCCTGGG + Intronic
1122116324 14:99529142-99529164 GGGAGGAGCAGTGCCAGCCATGG - Intronic
1122137452 14:99643009-99643031 AGGAGCATCAGAGCCAGCCTGGG - Intergenic
1122207620 14:100155970-100155992 GGGAGCCTCAGCCCTGGCCTAGG + Intronic
1122262662 14:100531975-100531997 GGGAGCAGGAACCCCAGCCTGGG - Intergenic
1122388520 14:101364928-101364950 GTGAGCGGCAGGGCCAGCCCAGG + Intergenic
1122860024 14:104578350-104578372 GGGAGGAGCAGCTCCAGCCCTGG + Intronic
1124336826 15:28863543-28863565 GGGAGAGGCAGTGCCAGCATTGG - Intergenic
1124550214 15:30674051-30674073 GTGAGCCACTGCACCAGCCTAGG - Intronic
1125540636 15:40467832-40467854 GGGCTCTGCAGAGCCAGCCTTGG + Exonic
1126592426 15:50354330-50354352 GGCCCCCGCAGCGACAGCCTTGG - Intronic
1128269209 15:66293808-66293830 GGGAGGCGGAGCGCCAGCGGCGG + Intronic
1129515595 15:76155199-76155221 GGCAGCCACAGCACCAGCCCAGG - Intronic
1129803855 15:78438180-78438202 GAGAGCAGCAGAGCCAGCCCCGG - Exonic
1131118586 15:89809217-89809239 TGGTGCCCCAGTGCCAGCCTGGG - Intronic
1131503665 15:92996440-92996462 GTGAGCCACCGCGCCCGCCTGGG + Intronic
1132490676 16:228987-229009 CGGAGCCGCGGCGCCCGCCGGGG + Intronic
1132626826 16:895236-895258 GGGAGCCCCAGCTCCAGCCTCGG + Intronic
1133287385 16:4696962-4696984 GGGAGCAGCAGGGCCTGTCTGGG - Intronic
1135644447 16:24149227-24149249 GGCAGCCGCAGTGCCTGCCCAGG + Intronic
1136017815 16:27416190-27416212 GTGAGCTGCAACTCCAGCCTGGG - Intronic
1136091456 16:27923191-27923213 GGGAGCAGCAGAGCCAAGCTTGG - Intronic
1136348903 16:29694660-29694682 GGCAGCAGCAGCGCCAGGCCTGG - Exonic
1136554856 16:31001651-31001673 GAGAGCTGGAGAGCCAGCCTTGG - Intronic
1137442988 16:48511851-48511873 GGTAGCCTCAGCTCCAGCCTAGG - Intergenic
1137707992 16:50548536-50548558 GGCCGCCGCAGCCCCAGCATGGG + Exonic
1139373689 16:66483854-66483876 AGGCGCAGCAGAGCCAGCCTTGG - Intronic
1142133527 16:88441580-88441602 GGGAGGCCCAGCGCCCACCTGGG - Intergenic
1142220262 16:88850795-88850817 GGCGGCCGCACTGCCAGCCTAGG - Intronic
1142474165 17:180062-180084 GGGAGGGGCAGCACCAGCCCTGG + Intronic
1142552937 17:752115-752137 GGGAGCCGCGGCACCCACCTAGG + Exonic
1142803083 17:2357129-2357151 GGGAGCCCCAGGGCTAGTCTGGG + Intronic
1142853739 17:2718282-2718304 GGGAACCGAAGGCCCAGCCTTGG - Intergenic
1142858941 17:2749504-2749526 GGGATCTGCAGCGCCCGCCCCGG + Intergenic
1143078765 17:4366332-4366354 GGAAGCCCCGGCGCCAGCCCGGG - Exonic
1144119153 17:12133362-12133384 GTGAGCCACTGCGCCAGGCTGGG + Intronic
1144812819 17:18011626-18011648 AGGAGCTGCAGTGCCACCCTGGG + Intronic
1146536702 17:33658711-33658733 GTGAGCCGCAGCTCCAGCCAAGG - Intronic
1147377676 17:40032613-40032635 GGGAGGGGCAGAGCCAGTCTAGG - Intronic
1147972443 17:44226491-44226513 GTGAACCACCGCGCCAGCCTAGG - Intergenic
1148648132 17:49230763-49230785 AGCAGCCGCAGCGCCGGCCGCGG - Exonic
1149610422 17:57955040-57955062 GGGAGCCGCGCCGACAGCCCCGG + Intronic
1150270657 17:63862374-63862396 GGGAAACCCAGCTCCAGCCTTGG + Intergenic
1150274283 17:63885895-63885917 GGGAAACCCAGCTCCAGCCTTGG + Intergenic
1150276428 17:63900723-63900745 GGGAAACCCAGCTCCAGCCTTGG + Intergenic
1151191062 17:72398507-72398529 GTGAGCCACTGCGCCAGCCCAGG - Intergenic
1151386303 17:73757382-73757404 TGGAGCCGCCGGGCCAGCCTGGG - Intergenic
1151600819 17:75105066-75105088 GGCAGCTGCACCACCAGCCTTGG - Intronic
1151660385 17:75515503-75515525 GGGAGGCGCCGAGCCGGCCTTGG - Exonic
1151890284 17:76947441-76947463 GAGAGCCTCACAGCCAGCCTGGG + Intronic
1152407171 17:80104450-80104472 GGGTGCTGCAGTGCCAGCCGCGG + Intergenic
1152616708 17:81341316-81341338 AGGAGCCGCAGCGACAGCTTCGG - Intergenic
1152642434 17:81454780-81454802 TGGGGCTGCAGCCCCAGCCTTGG - Intronic
1153594725 18:6713770-6713792 GGAAGCCACATCCCCAGCCTAGG + Intergenic
1154133108 18:11752585-11752607 GGGAGCCGCCGCGCGCCCCTCGG - Intronic
1154954726 18:21242592-21242614 GGGAGCGCCAGTGCCAACCTGGG + Intronic
1155212997 18:23619187-23619209 AGGAGGCGCAGCACCAGCCAGGG + Intronic
1155524089 18:26699022-26699044 GGGAGCCTCAGGGGCAGCCTTGG - Intergenic
1156150217 18:34233322-34233344 GTGAGCCGCAGCGCCCGGCCTGG - Intergenic
1158710922 18:59837422-59837444 GTGAGCCACAGCGCCAGGCCTGG + Intergenic
1160535175 18:79587729-79587751 AGGAGCTTCAGCGCCAGCCAGGG + Intergenic
1160557997 18:79738454-79738476 GGTAGGAGCAGCGCCAGCCTCGG + Intronic
1160561631 18:79762235-79762257 GTGAGCCACAGCGCCTGGCTGGG - Intergenic
1161118421 19:2512153-2512175 GGCAGCAGCAGCTCTAGCCTTGG - Exonic
1161170169 19:2808512-2808534 GGAAGCCGAAGCCCCAGGCTTGG - Intronic
1161846583 19:6714577-6714599 GTGAGCCGCTGCGCCCACCTGGG - Intronic
1162029291 19:7910410-7910432 GGGAGCCTCAGCACCGGCCTGGG - Intronic
1162069144 19:8143202-8143224 GGGATCCTCAGCGGCACCCTGGG + Intronic
1162501862 19:11058654-11058676 TGTGGCCGAAGCGCCAGCCTCGG - Intronic
1164525531 19:29010536-29010558 GGGAAGCAGAGCGCCAGCCTTGG - Intergenic
1165070991 19:33254739-33254761 GGGAGCCACAGCCCCAAGCTAGG - Intergenic
1165129190 19:33621764-33621786 GGGAGCCGCAGAGCGCGCGTGGG + Intergenic
1165333426 19:35154041-35154063 GGGTGCAGCGGCTCCAGCCTTGG - Exonic
1166709534 19:44927790-44927812 GGCAGGCCCAGCCCCAGCCTAGG + Intergenic
1167050571 19:47075414-47075436 GGCAGCTGCAGCGCAAGCCATGG - Intronic
1167456083 19:49597256-49597278 GGGTGGCCCAGCGCCAGCCTTGG - Exonic
1167522048 19:49960959-49960981 GGCAGCCCCAGCCCCTGCCTGGG + Intronic
1167523334 19:49969766-49969788 GGCAGCCCCAGCCCCTGCCTGGG - Intergenic
1168347798 19:55659359-55659381 GGGATCCCCTGGGCCAGCCTGGG + Intronic
1168468106 19:56620225-56620247 GGGAGCCGGAGCCCCAGCCAGGG + Intronic
926035359 2:9631360-9631382 GGGAGACGCAGCCGCCGCCTAGG - Intergenic
927846989 2:26476825-26476847 GGGAGCAGCAGCCCCCACCTGGG - Intronic
927937031 2:27081973-27081995 AGGAGAGGCAGAGCCAGCCTGGG + Intronic
928149085 2:28810516-28810538 GGAGGCCGCAGCCCCAGCCCCGG + Intronic
929640130 2:43569856-43569878 GGGTGCAGCAGCTCCAGTCTGGG - Intronic
929924385 2:46196630-46196652 AGGGGCAGCAGCACCAGCCTAGG + Intergenic
930730686 2:54724986-54725008 GTCCGCCGCAGCCCCAGCCTCGG + Exonic
931338280 2:61372444-61372466 GTGAACCACAGCACCAGCCTGGG - Intronic
932215154 2:69961663-69961685 GGGAGCCCAGGGGCCAGCCTAGG - Exonic
932694997 2:73948541-73948563 TGCAGCCCCAGGGCCAGCCTTGG - Intronic
933399585 2:81777039-81777061 GCAAGAGGCAGCGCCAGCCTCGG - Intergenic
933775004 2:85766531-85766553 GGGAGACGCAGGGCCAGCCAGGG - Intronic
933890776 2:86767343-86767365 GTGAGCCACCGCACCAGCCTTGG + Intronic
933895799 2:86808707-86808729 GGGAGCTGGAGCCCCAGCCAGGG - Intergenic
933970938 2:87469262-87469284 GGGAGCCACAGTTCCAGCCCAGG + Intergenic
934845103 2:97657305-97657327 GGGAGTGGCAGCAGCAGCCTTGG + Intronic
935292319 2:101621069-101621091 GGGAGCCACAGTGCCCGGCTGGG + Intergenic
935396822 2:102619069-102619091 GGCCTCCGCAGCGCCAGGCTGGG + Intergenic
935979479 2:108612824-108612846 AGGAGCCGCAGCGCAAGCCCCGG - Intronic
936322789 2:111480927-111480949 GGGAGCCACAGTTCCAGCCCAGG - Intergenic
937243211 2:120475780-120475802 GGGAGCAGCAGCTCCAGGTTGGG + Intergenic
937252395 2:120533249-120533271 GGGAGCCGCACCTCCACCCAGGG - Intergenic
938110775 2:128563429-128563451 AGGAGCTCCAGCTCCAGCCTTGG - Intergenic
938110780 2:128563452-128563474 GGGAGATCCAGCTCCAGCCTTGG - Intergenic
938753535 2:134358585-134358607 AGAAACCCCAGCGCCAGCCTGGG - Intronic
942455391 2:176134991-176135013 GGGAACCGCAGCAGCAGCCAGGG - Intergenic
948646975 2:239411465-239411487 GGGAGCCGCCAGGCCTGCCTTGG + Intergenic
948723421 2:239917970-239917992 GGGAGCCACAGAGCCAGTCATGG + Intronic
1168882267 20:1217088-1217110 GGGACCCTCAGAGCCAGCCGCGG - Intergenic
1169747358 20:8955962-8955984 TGGAGCCACTGCTCCAGCCTGGG + Intronic
1173199984 20:40947361-40947383 GTGAGCCGCCGCGCCTGGCTTGG - Intergenic
1173549183 20:43920651-43920673 GGGGGCAGCAGTGCCAGGCTTGG - Intronic
1174393638 20:50233243-50233265 GGAGGCCTCAGCCCCAGCCTGGG - Intergenic
1175109845 20:56640005-56640027 GTGAGCCACCGCGCCAGGCTGGG + Intergenic
1176085793 20:63294876-63294898 GGCAGCCCCAGCTCTAGCCTTGG + Intronic
1176147992 20:63574012-63574034 GGGAGCCACAGACCCAGCCCGGG - Intronic
1176311657 21:5154028-5154050 GGGGGCCGCGGAGCCGGCCTGGG - Intronic
1177483856 21:21729293-21729315 GTGAGCCACTGCGCCAGGCTAGG + Intergenic
1179669858 21:42939071-42939093 GTGAGCCACCGCGCCAGCCCAGG + Intergenic
1179834862 21:44024066-44024088 GTGAGCCACCGCACCAGCCTAGG + Intronic
1180891341 22:19291446-19291468 GGACGCCGCAGCCCCAGCCCAGG + Intronic
1181052851 22:20245934-20245956 GGTGGCCGCAGGGCCAACCTGGG - Intronic
1181404790 22:22675382-22675404 GTGAGCCACCGCGCCAGCCTTGG + Intergenic
1181513278 22:23398282-23398304 GGGAGATGCAGAGCCTGCCTGGG + Intergenic
1182043922 22:27259635-27259657 GGGACCAGCAGCTCCAGCCCTGG - Intergenic
1182687621 22:32133098-32133120 TGGGGCTGCAGCTCCAGCCTGGG - Intergenic
1182820428 22:33210823-33210845 GGGAGCCGCAGAGGCATCCGTGG - Intronic
1183339681 22:37273312-37273334 GGGAGCCCCAGCGCTGCCCTGGG + Intergenic
1183622749 22:38983972-38983994 GGGAGGCCCAGGGCCATCCTGGG + Intronic
1184678154 22:46054442-46054464 GGGAGCCACGGCGCCAGGCCTGG - Intronic
1184832027 22:46994982-46995004 GGGAGCCGCAGCAACAGCTAAGG - Intronic
1185119498 22:48957579-48957601 GGGAGCCGCAGGGACAGGCCTGG + Intergenic
1185156013 22:49193986-49194008 GGCAGCCCCAGTGCCAGCCAAGG - Intergenic
1185238744 22:49729322-49729344 GGCAGACGCAGCCCCAGCCCCGG + Intergenic
950055895 3:10024142-10024164 TGGAGCCACAGAGCCAGTCTGGG - Intergenic
950634148 3:14303299-14303321 GGGAGCCGCTGGCCCAGCCTGGG - Intergenic
950680135 3:14579654-14579676 GGGAGACTGAACGCCAGCCTGGG - Intergenic
951264887 3:20553172-20553194 GGTAGCCGCAGCGGCACCCAGGG + Intergenic
951485268 3:23203179-23203201 GGCAGCCACAGCGACAGCCGCGG + Intronic
951858815 3:27227571-27227593 GGGAACAGCAGAGCAAGCCTGGG - Intronic
952808000 3:37375381-37375403 GGAAGCTCCAGCTCCAGCCTTGG - Intergenic
953885340 3:46711862-46711884 GGCAGCCCCAGCTTCAGCCTGGG + Intergenic
954138929 3:48595143-48595165 AGAAGCCGCAGCGTCATCCTAGG + Exonic
954325033 3:49858945-49858967 GGGACCTGCAGGGCCTGCCTAGG + Exonic
954442946 3:50531612-50531634 GGGATGGGCAGCACCAGCCTTGG - Intergenic
955386596 3:58485786-58485808 GTGAGCCACTGCGCCTGCCTAGG + Intergenic
958156080 3:89757337-89757359 GTGAGCCACAGCGCCCGGCTTGG + Intergenic
958825291 3:99022407-99022429 GGGAGAGGCAGAGCCATCCTCGG - Intergenic
961507087 3:127377268-127377290 TGCAGCCCCAGCTCCAGCCTGGG - Intergenic
961508229 3:127385643-127385665 GGGACCCTCAGCCCCGGCCTCGG - Intergenic
961570337 3:127793197-127793219 GGGAGCTGCTGAGCCAGCCAAGG - Intronic
961824145 3:129589993-129590015 TGGAGACGCAGAGCCAGCCGGGG - Intronic
961845067 3:129755818-129755840 GTGAGCCACCGCCCCAGCCTTGG - Intronic
962279268 3:134037948-134037970 GGGAGTCCCAGTGCCAGCCCTGG + Intronic
962312935 3:134338660-134338682 TGCAGCCCCAGCTCCAGCCTAGG - Intergenic
966936298 3:184711869-184711891 GGGAGCCGCCGCGCAAGCCCCGG + Exonic
968547905 4:1207979-1208001 GAGAGGCCCAGGGCCAGCCTGGG + Intronic
968728261 4:2258244-2258266 GGGAGCCGCAGCTCACGCCCTGG + Intronic
968812550 4:2806534-2806556 GCGAGCAGCAGTGCCAGCCGTGG + Intronic
968986766 4:3879892-3879914 GAGAGCCGCAGCCCCAGCGTGGG + Intergenic
969353950 4:6614300-6614322 TGGAGCTGTAGCGCCAGCCAGGG - Exonic
969831710 4:9802844-9802866 GTGAGCCACAGCGCCCGGCTGGG + Intronic
972396658 4:38664107-38664129 GGGAGCCGCCGCGGCCGCCCGGG - Intergenic
973339076 4:48986097-48986119 GCGAGCCCCAGCGGCACCCTTGG - Intergenic
976512737 4:85930083-85930105 AGCAGCCGCAGCCACAGCCTTGG + Intronic
976760075 4:88539271-88539293 GGGACCCGCAGAGCCAGGCACGG - Intronic
978763380 4:112379479-112379501 GGGACACGCAGCGCCGCCCTTGG - Intronic
982771450 4:159400864-159400886 GGGAGAGGCAGCGAAAGCCTGGG - Intergenic
983568703 4:169181541-169181563 GTGAGCCACCGCGCCAGCCCTGG + Intronic
984801604 4:183721947-183721969 GTGAGCCGCCGCGCCAGCCTGGG - Intergenic
985629606 5:1007848-1007870 GGGTCCCGCACCGCCAGCCTCGG + Intergenic
986104447 5:4646213-4646235 AGGAGCTGCAGTGCCAGTCTTGG - Intergenic
995140241 5:108727939-108727961 GAGAGCCGCAGCGCCAGGCCCGG + Intergenic
995831640 5:116361368-116361390 GAGAGCCTCAGCGCCTGCCGCGG - Intronic
997346154 5:133193964-133193986 GGAAGCCACAGGGCCAGGCTAGG + Intergenic
997377163 5:133405510-133405532 GGGAGCGGCAGCCCTCGCCTGGG + Intronic
997883801 5:137613280-137613302 GGGAGCTGCTGTGCCAGCCCTGG + Intergenic
998095131 5:139392379-139392401 TGGAGGCGCCGCGGCAGCCTCGG - Exonic
998104477 5:139459706-139459728 GGGAGCAGCAGAGCCAGGCCAGG - Intronic
998134577 5:139668063-139668085 GGGTGCCGCAGGCCCAGCCCAGG - Intronic
998146718 5:139733428-139733450 GGGAGCCGCAGCACCATCAGAGG - Intergenic
999188522 5:149730469-149730491 GGGGGCCGCAGCTGCAGCCGCGG + Intronic
999498570 5:152124566-152124588 AGAAGCAGCAGCCCCAGCCTGGG + Intergenic
1002046280 5:176543320-176543342 CGCAGCCGCACCGCGAGCCTGGG - Intronic
1002185621 5:177453572-177453594 GGGAGCCTGAGCCCCAGGCTGGG - Intronic
1002360848 5:178669660-178669682 GCGAGCCACAGAGCCAGCCACGG + Intergenic
1002782862 6:380317-380339 GGGAGCCCCAACGCCAGCGAAGG - Intergenic
1002927868 6:1615102-1615124 TGGGGCCGCAGCGCCGGCCCGGG - Intergenic
1003212335 6:4079101-4079123 CGGAGCCGCAGCCCCGGCCCCGG - Exonic
1005315548 6:24599634-24599656 GGGGGCCTCAGCTACAGCCTGGG + Intronic
1005334057 6:24775439-24775461 CGGAGGCCCAGCGCCAGGCTAGG - Intronic
1005886787 6:30103137-30103159 GAGAGGAGCAACGCCAGCCTGGG - Exonic
1006092599 6:31636853-31636875 GGGGGCCGCACAGCCAGGCTGGG - Exonic
1006425358 6:33959878-33959900 GGAAGGCACAGCGCCAGCCAGGG - Intergenic
1006860560 6:37169664-37169686 GAGAGCCGCAGAGCCGGCCTCGG + Intergenic
1007223078 6:40294204-40294226 GGGAGACACAGCCCCGGCCTTGG + Intergenic
1007427688 6:41757861-41757883 GGGAGACACAGCCCCATCCTCGG - Intergenic
1007427701 6:41757900-41757922 GGGAGACACAGCCCCATCCTCGG - Intergenic
1007427714 6:41757939-41757961 GGGAGACACAGCCCCATCCTCGG - Intergenic
1010422150 6:75688188-75688210 GGGAGCCGCCGAGCCAGGCACGG + Intronic
1013155807 6:107490271-107490293 GGGAGCGGCAGCGGCAGCGAGGG + Exonic
1013345314 6:109254403-109254425 GGGATCAGCAGAGGCAGCCTTGG - Intergenic
1014925686 6:127267237-127267259 GGGCGCCGCAGCCCCTGCCCTGG + Intronic
1016714002 6:147203761-147203783 CGGAGCAGCAGCGGCAGCCGCGG - Intergenic
1016772480 6:147867549-147867571 GGGAGACGCAGGGTCAGCCAGGG - Intergenic
1016790855 6:148065289-148065311 GGGAGCCCCAACCCCAGCCAAGG - Intergenic
1017260047 6:152375223-152375245 GTGAGCCGCCGCGCCTGGCTTGG + Intronic
1018178990 6:161203716-161203738 GTGAGCCACAGCGCCTGGCTGGG + Intronic
1018914614 6:168125416-168125438 GGGAGCCGCAGCCCCTGCTCAGG - Intergenic
1018969728 6:168517914-168517936 GGGCGCCGGAGCGCGAGCCTGGG + Intronic
1018985840 6:168636776-168636798 GGCAGCTGCAACACCAGCCTCGG - Intronic
1019104192 6:169655661-169655683 GGCAGGGGCATCGCCAGCCTCGG - Intronic
1019319169 7:407716-407738 GGGAGGGGCAGCCACAGCCTTGG - Intergenic
1019416630 7:930534-930556 GTGAGCCACCGCGCCAGCCCTGG - Intronic
1021106308 7:16643950-16643972 GAGAGCTGCAACTCCAGCCTGGG + Intronic
1021704722 7:23355511-23355533 GTGAGCCACAGCGCCAGACCAGG + Intronic
1023992191 7:45134876-45134898 TGGAGCCCCAGGGCCAGGCTGGG + Intergenic
1024131266 7:46354973-46354995 GGCAGTCGCAGCGCCTGCCCTGG - Intergenic
1024667057 7:51557951-51557973 GGGAGCCACAGAGCCAGGCACGG + Intergenic
1025024402 7:55504584-55504606 GGGAGTGGCAGCGTCTGCCTGGG - Intronic
1025212093 7:57025650-57025672 GGGAGCCGGAACCCTAGCCTGGG + Intergenic
1025659861 7:63551178-63551200 GGGAGCCGGAACCCTAGCCTGGG - Intergenic
1025997289 7:66536009-66536031 GAGAGCCACAGAGCCAGCCCAGG + Intergenic
1026833579 7:73624080-73624102 GGGAGCCGCAGGACCGGGCTCGG + Intronic
1026875340 7:73876199-73876221 GAGACCCCCAGCCCCAGCCTTGG - Intergenic
1027138235 7:75639293-75639315 CGGAGCCGCAGCGCGCGCCGGGG + Intronic
1028860852 7:95648585-95648607 GTGAGCCACTGCGCCAGGCTTGG + Intergenic
1029423429 7:100483459-100483481 GGGCCCCGCAGCCGCAGCCTCGG + Intergenic
1029494387 7:100889358-100889380 GGTAGCCGCAGCCCCAGCCGCGG + Exonic
1030727230 7:112939861-112939883 AGGAACCGGAGCGACAGCCTTGG + Exonic
1032021568 7:128409688-128409710 CGGAGCCGCCGCGCCCTCCTCGG + Intronic
1034831996 7:154316848-154316870 GGGAGAAGGAGCACCAGCCTGGG + Intronic
1035388672 7:158490648-158490670 GGGAGTCGCACCGCCAGCAAAGG + Intronic
1036708466 8:11061940-11061962 GGGAGGAGCAGGGCCAGCCGAGG - Intronic
1036717119 8:11136230-11136252 GTGAGCCGCCGCGCCAGGCCAGG - Intronic
1037597959 8:20370139-20370161 GTGAGCCACCGCGCCAGGCTGGG + Intergenic
1037882464 8:22579723-22579745 GGAAGCCGCGGTGCCAGGCTGGG - Intronic
1037989310 8:23309263-23309285 GTGAGCCACCGCGCCAGGCTGGG + Intronic
1038465778 8:27761242-27761264 GAGAGCTGCAGCAACAGCCTGGG + Intronic
1039460137 8:37736872-37736894 TGGAGCCGCAGCCCCAGACCAGG + Intronic
1040047000 8:42974810-42974832 GGGAGCCGCAGAGACTGTCTGGG - Intronic
1040544282 8:48384979-48385001 TGGAGCTGCAGCGTCGGCCTTGG - Intergenic
1041902997 8:63002510-63002532 GTGAGCCTCAGCGCCACCCAGGG - Intergenic
1044971441 8:97624384-97624406 GGGAGCTGCAATGCCACCCTGGG - Intergenic
1045304989 8:100951240-100951262 GGGCGCCGCCGCGCCAGGCCTGG + Intronic
1046651296 8:116839160-116839182 GTGAGCCACTGCACCAGCCTGGG - Intronic
1046936310 8:119888571-119888593 GTGAGCCACCGTGCCAGCCTTGG - Intronic
1046946891 8:119982641-119982663 GGGAGTCTCAGTGTCAGCCTGGG - Intronic
1047251770 8:123186317-123186339 GGGAGCTGGAGCCTCAGCCTAGG + Intronic
1049162259 8:141105010-141105032 GGGAGCCGCTGCCCCAGTCCAGG - Intergenic
1049426893 8:142541745-142541767 AGGGGCCGTAGCGCCAGGCTTGG + Intronic
1049437967 8:142596358-142596380 TGGACCTGCAGCGCCTGCCTCGG - Intergenic
1049443026 8:142617791-142617813 GAGATCAGCAGGGCCAGCCTGGG - Intergenic
1049539335 8:143200494-143200516 GTGAGCCACCGCGCCAGCCCTGG + Intergenic
1049720924 8:144115142-144115164 GGGAGTGGCAGCCCCTGCCTTGG + Intronic
1052097394 9:24400188-24400210 GTGAGCCACCGCGCCAGGCTGGG - Intergenic
1052942694 9:34142797-34142819 GTGAGCCGCCGCGCCGGCCCAGG + Intergenic
1053435088 9:38069008-38069030 CGGAGCCGCAGCCTCCGCCTTGG + Exonic
1055000731 9:71446735-71446757 CGCAGCCGGAGCGCCAGCCGGGG - Intronic
1055764736 9:79650196-79650218 GTGAGCCACTGCGCCAGGCTTGG + Intronic
1056555844 9:87686469-87686491 GGAAACCTCAGGGCCAGCCTGGG + Intronic
1057270320 9:93646741-93646763 GGGAGCCACATGGCCACCCTGGG + Intronic
1058861291 9:109119843-109119865 GGGACCCGCGGCGCCGGCCCGGG + Exonic
1059386153 9:113966007-113966029 ACGAGTCGCAGAGCCAGCCTGGG - Intronic
1060634331 9:125188501-125188523 GTGAGCCACCGCGCCGGCCTAGG - Intronic
1060838985 9:126779552-126779574 GTGAGCCACCGCCCCAGCCTTGG + Intergenic
1061580202 9:131531488-131531510 CGAAGGCGCAGCCCCAGCCTCGG - Intergenic
1061789110 9:133049224-133049246 GGGAGAGGCTGCGGCAGCCTTGG - Intronic
1061871400 9:133522598-133522620 GGCAGCTGCGGGGCCAGCCTAGG + Intronic
1061949228 9:133926902-133926924 GGGAGGCCCAGCACCAGCCCTGG + Intronic
1061964124 9:134003633-134003655 GGGAGATGCAGAGCCAGTCTAGG + Intergenic
1062405596 9:136394770-136394792 GGGTGCCGCAGGGCCGGCCAGGG + Intronic
1062475508 9:136724896-136724918 GGCAGCCGCTGCCCCTGCCTGGG - Intergenic
1062559668 9:137135757-137135779 GGGAGCCGCCGCGCCCGGCTGGG + Intergenic
1185808655 X:3084253-3084275 GGGAGTCGCAGTTCAAGCCTTGG - Exonic
1187024245 X:15417230-15417252 GTGAGCCGCAGCGCCAGCTCCGG + Intronic
1187697990 X:21940502-21940524 GGGAGCGGCCGCGCGAGCCTTGG + Intergenic
1189236919 X:39494369-39494391 GGCAGCTGCAGAGCCAGCCCCGG - Intergenic
1195135840 X:101906668-101906690 TGGAGCCACAGGGCCAGCCTGGG - Intronic
1195709080 X:107759865-107759887 AGGAGCCTCAGGGCCAGCCTGGG + Intronic
1199384561 X:147208562-147208584 GGGTGCCCCAGTGCCAGCCTTGG + Intergenic
1200229397 X:154436760-154436782 GCGCGCCGCTGCGGCAGCCTGGG - Intergenic
1201411384 Y:13702747-13702769 GGGAGCCCCAACGCCACCCTAGG - Intergenic