ID: 1093642028

View in Genome Browser
Species Human (GRCh38)
Location 12:21538869-21538891
Sequence TAGAGTAAGTTCAGCACCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 72}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093642028_1093642029 -4 Left 1093642028 12:21538869-21538891 CCTGGGGTGCTGAACTTACTCTA 0: 1
1: 0
2: 0
3: 7
4: 72
Right 1093642029 12:21538888-21538910 TCTATTTTACTCTTGCCAAGCGG 0: 1
1: 0
2: 2
3: 15
4: 196
1093642028_1093642033 23 Left 1093642028 12:21538869-21538891 CCTGGGGTGCTGAACTTACTCTA 0: 1
1: 0
2: 0
3: 7
4: 72
Right 1093642033 12:21538915-21538937 CCTATATTTAAACACTTCCTTGG 0: 1
1: 0
2: 0
3: 8
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093642028 Original CRISPR TAGAGTAAGTTCAGCACCCC AGG (reversed) Intronic
909339135 1:74511977-74511999 TCAAGTAAGTTCAGTACCCAAGG + Intronic
912641213 1:111347368-111347390 TAGAGTAAGTTCAGCTCTGTGGG + Intronic
913500329 1:119467153-119467175 TAGAATAAGATCTGCTCCCCAGG + Intergenic
923821208 1:237444470-237444492 TAGATTTAGTTCAGTACACCTGG + Intronic
1067460046 10:46451533-46451555 CAGAGGAAGTTCAGCTCCCCAGG - Intergenic
1067627144 10:47933080-47933102 CAGAGGAAGTTCAGCTCCCCAGG + Intergenic
1069955822 10:72050823-72050845 AACTGTGAGTTCAGCACCCCAGG - Intergenic
1073531949 10:104240241-104240263 CAGGGTAAGTTCAGCTTCCCAGG - Intronic
1075232809 10:120698100-120698122 CTGAGTAAGTTCATCACCACAGG - Intergenic
1092216573 12:6688209-6688231 TACAGAAAGTTCAGGAGCCCTGG - Exonic
1093642028 12:21538869-21538891 TAGAGTAAGTTCAGCACCCCAGG - Intronic
1096587050 12:52629534-52629556 CAGAGCAAGTTCAGGGCCCCAGG + Intergenic
1096792750 12:54055070-54055092 CAAAGTCAGGTCAGCACCCCCGG + Exonic
1099019736 12:77388768-77388790 TTGATTTATTTCAGCACCCCAGG - Intergenic
1101320520 12:103669326-103669348 TAGAGCCAGTCCAGCACCCAGGG + Intronic
1107017970 13:35723186-35723208 TAGAGGAAATTCAGGACCTCTGG - Intergenic
1107266659 13:38563518-38563540 TAGAGTATTTACAGCACCCCTGG - Intergenic
1108163542 13:47667895-47667917 TTAAGTAAGTTCAGCTTCCCTGG - Intergenic
1112816854 13:103282895-103282917 TAAAGGAAATTCAGCACCCTGGG - Intergenic
1116266897 14:42703793-42703815 TTGAATAAGTTCAGCACCACAGG - Intergenic
1122314471 14:100817683-100817705 TGGGGTAACTTCACCACCCCAGG - Intergenic
1126963755 15:54028101-54028123 TACAGTAAGTTCACCACTACTGG - Intronic
1130573638 15:85071262-85071284 TAGAGCAACTCCAGCATCCCAGG - Intronic
1131044412 15:89302090-89302112 TAGAGTACCTTCAGGAGCCCAGG + Intronic
1139949356 16:70661676-70661698 TAGAGTATGTACAGCCCCCGGGG + Exonic
1142952431 17:3494392-3494414 TAGAGAAAGTTGATTACCCCCGG + Exonic
1143439840 17:6961461-6961483 CTGAGGAAGTTCATCACCCCTGG + Intronic
1147332278 17:39706048-39706070 TAGAGGAGGTAAAGCACCCCTGG - Intronic
1149151438 17:53569048-53569070 TTGAGTAAATGCAGCACACCTGG - Intergenic
1150577632 17:66444203-66444225 TAGAGCCAGGTCAGCACCCAGGG - Intronic
1151319499 17:73343954-73343976 TAGAGTCAGTGCAGAGCCCCTGG - Intronic
1158343651 18:56492563-56492585 CAGAATAATTTCAGCCCCCCAGG + Intergenic
1159061160 18:63515349-63515371 AAAAGCAAATTCAGCACCCCTGG - Intergenic
1159491781 18:69145872-69145894 TAGAATATTTTCAGCACCACAGG - Intergenic
1164650741 19:29889833-29889855 TAGAGCAAGTTCTGCACCTGGGG - Intergenic
935811281 2:106799946-106799968 TAGTGTTAGGTCAGCATCCCAGG + Intergenic
936065954 2:109332340-109332362 AGGAGCAAGTGCAGCACCCCTGG - Intronic
936156681 2:110051517-110051539 TGGAGGAAGTTCAGCACAGCAGG - Intergenic
936188011 2:110319927-110319949 TGGAGGAAGTTCAGCACAGCAGG + Intergenic
940241617 2:151569388-151569410 CAGAATGAGTTCAGCAACCCTGG + Intronic
941723846 2:168840079-168840101 TTGAGAATGCTCAGCACCCCAGG - Intronic
945039635 2:205733251-205733273 TGGAGACAGTTCAGCACCCACGG - Intronic
1173967367 20:47122903-47122925 TAGAAAAAGTTCACCACCCCTGG + Intronic
1176643878 21:9331287-9331309 TTGAGTAAGTACAGTACACCAGG + Intergenic
1177806713 21:25882248-25882270 TAGACTAAATTCAGCAGTCCAGG - Intronic
1179549655 21:42135801-42135823 TGGCTTATGTTCAGCACCCCAGG + Intronic
953546458 3:43867198-43867220 TACAGTGAGGTCAGCAGCCCAGG + Intergenic
960973860 3:123157256-123157278 ACCAGTAAGTTCAGCCCCCCAGG - Intronic
963432010 3:145219590-145219612 TAGAGCAAATTCAGCATCCCTGG + Intergenic
1202743010 3_GL000221v1_random:73779-73801 TTGAGTAAGTACAGTACACCAGG - Intergenic
969219735 4:5751934-5751956 GAGATCAAGTCCAGCACCCCAGG - Intronic
977632114 4:99254593-99254615 TACAGTAAGTTCATCACCTGAGG - Intergenic
983945195 4:173578248-173578270 TAGAATAAGTGCAGCCCCTCCGG + Intergenic
985825846 5:2191004-2191026 TAGAGTGAGTTGGGCACCTCCGG - Intergenic
995041100 5:107588965-107588987 TAGAGCAAGTTGAGGACCCTTGG - Intronic
995476332 5:112552198-112552220 AAGAGCAAGTGCAGCAGCCCTGG + Intergenic
997428772 5:133823234-133823256 AAAAGTAGCTTCAGCACCCCAGG + Intergenic
998223040 5:140303451-140303473 AAGAGTAAGTCCAGAACCTCAGG + Intergenic
1000944573 5:167404882-167404904 TAGAGTATTTTTATCACCCCAGG + Intronic
1022355413 7:29609961-29609983 TAGAGTAAGGTCTGCAGCCCAGG + Intergenic
1025000839 7:55313294-55313316 GAGAGAAATTGCAGCACCCCTGG - Intergenic
1027423267 7:78037753-78037775 GAGTGTCAGTGCAGCACCCCAGG + Intronic
1031520381 7:122757475-122757497 TACAATAAATTTAGCACCCCAGG + Intronic
1032115704 7:129115427-129115449 TAGACTATGTTCAGCAACACTGG - Intergenic
1032233576 7:130099654-130099676 TAGAGAAAGTTCAGCACAGTGGG + Intronic
1035836859 8:2764119-2764141 TTCAGTAAGTTCAGCAGCTCTGG + Intergenic
1039216206 8:35274450-35274472 TGGATGAAGTTCAGCACCTCTGG + Intronic
1041112132 8:54493228-54493250 AAGAGTAAGTTCAGGACAGCAGG - Intergenic
1041712010 8:60902982-60903004 TAGAGAAACTTAAGAACCCCAGG - Intergenic
1044774519 8:95674407-95674429 TAGAGATACTTCAGTACCCCAGG + Intergenic
1045315518 8:101040587-101040609 TAGAGGAAGTTCAACCCCACTGG - Intergenic
1045416863 8:101976183-101976205 TAGAGATAGTGCAGCACCCAGGG - Intronic
1047828443 8:128604855-128604877 GAGAGTAGGTTCAACATCCCTGG - Intergenic
1055675639 9:78657563-78657585 TGGAGTAGGTGCTGCACCCCAGG + Intergenic
1057366767 9:94429764-94429786 TGGAGTAAATGCAGCACCGCTGG - Intronic
1057656568 9:96958300-96958322 TGGAGTAAATGCAGCACCGCTGG + Intronic
1058518766 9:105799699-105799721 TGGAGTAATATCAACACCCCCGG + Intergenic
1203711644 Un_KI270742v1:103705-103727 TTGAGTAAGTACAGTACACCAGG - Intergenic
1185691581 X:2159403-2159425 TAGAGTAAGGTCAACAGACCAGG - Intergenic
1190035242 X:47017008-47017030 TAGAGTAATTCTAGCACCCAAGG - Intronic