ID: 1093642029

View in Genome Browser
Species Human (GRCh38)
Location 12:21538888-21538910
Sequence TCTATTTTACTCTTGCCAAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 196}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093642023_1093642029 24 Left 1093642023 12:21538841-21538863 CCATAAATGCTCATCTAGTTCAA 0: 1
1: 0
2: 0
3: 14
4: 169
Right 1093642029 12:21538888-21538910 TCTATTTTACTCTTGCCAAGCGG 0: 1
1: 0
2: 2
3: 15
4: 196
1093642027_1093642029 -1 Left 1093642027 12:21538866-21538888 CCTCCTGGGGTGCTGAACTTACT 0: 1
1: 0
2: 0
3: 9
4: 130
Right 1093642029 12:21538888-21538910 TCTATTTTACTCTTGCCAAGCGG 0: 1
1: 0
2: 2
3: 15
4: 196
1093642028_1093642029 -4 Left 1093642028 12:21538869-21538891 CCTGGGGTGCTGAACTTACTCTA 0: 1
1: 0
2: 0
3: 7
4: 72
Right 1093642029 12:21538888-21538910 TCTATTTTACTCTTGCCAAGCGG 0: 1
1: 0
2: 2
3: 15
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093642029 Original CRISPR TCTATTTTACTCTTGCCAAG CGG Intronic
901244657 1:7720318-7720340 TCCATTTTTCTCTTGAAAAGGGG + Intronic
908067107 1:60417944-60417966 TCTATTATACTCTTGCAGAAGGG + Intergenic
910392319 1:86757712-86757734 ACTATTTTCTTCTTGCCAACGGG - Intergenic
912220284 1:107666202-107666224 ATTATTTTACTCTTGACAATTGG - Intronic
912782563 1:112565475-112565497 TCTACTTTACTCTTGCCCTAAGG + Intronic
913445771 1:118949301-118949323 TTTATGTTATTCTTTCCAAGTGG + Intronic
913586746 1:120282249-120282271 GCTATCTTTCTCTTTCCAAGTGG + Intergenic
913621440 1:120616121-120616143 GCTATCTTTCTCTTTCCAAGTGG - Intergenic
914568762 1:148894134-148894156 GCTATCTTTCTCTTTCCAAGTGG + Intronic
914604066 1:149236122-149236144 GCTATCTTTCTCTTTCCAAGTGG - Intergenic
915328783 1:155096139-155096161 GCTATTCTCCTCTTGCCAAATGG - Intergenic
915435757 1:155904678-155904700 GCTTTTTTACTCTAGCAAAGGGG - Intronic
916862576 1:168822084-168822106 TCTATTTAACTCTTGCCTCTTGG - Intergenic
918337221 1:183529058-183529080 TTTTTTTTTCTCTTTCCAAGAGG + Intronic
918442171 1:184578484-184578506 TCTATTTTATTGTGTCCAAGTGG + Intronic
918581721 1:186138604-186138626 TCTATTAAACTCTTTCCATGTGG + Intronic
919179381 1:194061012-194061034 TCTATTTTAATTTTGCTATGTGG + Intergenic
922976666 1:229790438-229790460 TCTACTTTACTTTTTACAAGTGG - Intergenic
923464156 1:234233177-234233199 ACTATTTTACTCTTGCCTTTGGG - Intronic
924440809 1:244083561-244083583 CCTCTTTCACTGTTGCCAAGAGG + Intergenic
1063085876 10:2817280-2817302 TCTGCTTTACTCTTCCCTAGAGG + Intergenic
1063309519 10:4939133-4939155 TCTATTTTTCTCTTGCAACTTGG + Intronic
1064710955 10:18123885-18123907 TCTATATTACTATTGCCATCTGG + Intergenic
1065371979 10:24996557-24996579 TCTATTTTAATATAGCCAAATGG + Intronic
1065433342 10:25682001-25682023 TCAATTCTAATCTAGCCAAGTGG + Intergenic
1067900096 10:50231102-50231124 TCTATTTTACTCTTGGCTGAAGG - Intronic
1068147462 10:53089306-53089328 ACTATTTTGCTCTTTCCAAGTGG + Intergenic
1068575967 10:58684766-58684788 TCTTTATTAGTCTTGCCTAGTGG + Intronic
1068922499 10:62499517-62499539 CCTAATTTACTCTGGCCAAGAGG + Intronic
1069207164 10:65705307-65705329 TATATTTTACTATTTACAAGTGG + Intergenic
1071355217 10:84786703-84786725 TCTGTTTTTCTTTTGCAAAGAGG + Intergenic
1071817121 10:89243543-89243565 TTTATTTTATTTTTGGCAAGAGG - Intronic
1072075206 10:91964351-91964373 TCTTTTTTACTCTAGCCATTCGG + Intronic
1072395427 10:95034279-95034301 ACTATTTTTCTATTTCCAAGTGG + Intergenic
1075176612 10:120169322-120169344 TATGTATTAGTCTTGCCAAGGGG + Intergenic
1076091659 10:127691929-127691951 TCTATTTTACTCCTCAGAAGTGG - Intergenic
1079644608 11:22847519-22847541 TGTATTTTAATCTTGTCTAGTGG - Exonic
1080322008 11:31021033-31021055 TTTTTTTTAATCTTGCCAATTGG + Intronic
1080445072 11:32331127-32331149 TCTACTTTAGTATTGCCCAGGGG + Intergenic
1085976629 11:81662371-81662393 ACTATTTTGCTATTACCAAGTGG + Intergenic
1086525335 11:87718774-87718796 TTTTTGTTTCTCTTGCCAAGTGG - Intergenic
1086626389 11:88960134-88960156 TCCATCTTACTCTGGCCAAATGG - Intronic
1088470827 11:110186481-110186503 ACTATTTTGCTATTTCCAAGTGG - Intronic
1088916955 11:114234821-114234843 TCTCTTTCTCTCTTGCCGAGTGG + Intronic
1090529173 11:127572448-127572470 TGTATTTTACTGTTGCTGAGTGG - Intergenic
1090629858 11:128636624-128636646 TCTATTTTTCTGTTTCCAAGTGG - Intergenic
1090929607 11:131283698-131283720 TCTATATCACATTTGCCAAGAGG + Intergenic
1091134718 11:133178466-133178488 TATATTAGACTCTTGCCAGGTGG + Intronic
1091181667 11:133610136-133610158 TATATATTACTGTTTCCAAGAGG + Intergenic
1093642029 12:21538888-21538910 TCTATTTTACTCTTGCCAAGCGG + Intronic
1093700976 12:22220280-22220302 TCTGTTTTACTTTTGTGAAGAGG - Intronic
1093942611 12:25071096-25071118 TCTATTTTGCTCTTACCTAGAGG + Intronic
1095518692 12:43036451-43036473 TTTATTTTAGTCATGCCATGAGG + Intergenic
1096883850 12:54697591-54697613 TTTATTTTAGTGTTTCCAAGTGG - Intergenic
1097540598 12:60937266-60937288 ACTATTTTGCTCTTTCCAAGTGG + Intergenic
1098261805 12:68679256-68679278 TTTTTTTTAGTCTTGGCAAGTGG - Intergenic
1099163341 12:79273078-79273100 ACTATTTTGCTCTCTCCAAGTGG - Intronic
1101128065 12:101659946-101659968 TCTTTTTTTTTCTTGCCTAGAGG + Intronic
1101689088 12:107058375-107058397 GTTCTGTTACTCTTGCCAAGAGG - Intronic
1102513413 12:113430745-113430767 TTTATTTTATTTTTGCCATGTGG - Intronic
1103408321 12:120691850-120691872 TTTTTTTTTTTCTTGCCAAGTGG - Intronic
1103691562 12:122779138-122779160 TCAATTTTCCTCTTTCCATGAGG - Intronic
1108657452 13:52548907-52548929 TCTTTATTAGTCTTGCCTAGCGG + Intergenic
1109309342 13:60673224-60673246 ACTATTTTGCTATTTCCAAGTGG + Intergenic
1112409620 13:99151704-99151726 TCTATTTTATTCTTGACACATGG + Intergenic
1114975653 14:28094861-28094883 TCTATTTCAAGATTGCCAAGTGG + Intergenic
1116152640 14:41160767-41160789 TAAATTTTAATTTTGCCAAGGGG - Intergenic
1116188227 14:41627464-41627486 TATATTTTCCTTTTGTCAAGTGG + Intronic
1116896643 14:50322489-50322511 GCTTTTTTTCTCTTGCCAACAGG + Exonic
1118502580 14:66376314-66376336 TCTATGATACTTTTGGCAAGAGG - Intergenic
1118941407 14:70342436-70342458 TCTTTTTTTCTTTTGCCACGGGG - Intronic
1120105673 14:80491393-80491415 TCTATTTTACTCAGGCCAGAGGG + Intronic
1120374962 14:83692928-83692950 TCAATTTTTCTTTTTCCAAGTGG + Intergenic
1120930684 14:89845086-89845108 ATTATTTTACTCTTGCAAATAGG + Intronic
1125415311 15:39446283-39446305 TCTATTTGACTCCTGCCAGATGG - Intergenic
1126231009 15:46324892-46324914 TCTCTTTTACTCTGGCCACTTGG - Intergenic
1129595805 15:76963218-76963240 TCTATTTTATTACTGCTAAGTGG + Intergenic
1129638306 15:77346538-77346560 TCTATTTTCTGCTTGCCAGGTGG - Intronic
1133684400 16:8152071-8152093 ACTATTTTACTATTCCCACGAGG + Intergenic
1133740255 16:8645908-8645930 TCTATTTTACTGTGGCAGAGAGG - Intronic
1144574774 17:16422484-16422506 TCTCTTTTAATCCTCCCAAGGGG + Intronic
1149403097 17:56318975-56318997 TCTATTTTCTACTTGCCAACAGG - Intronic
1152173310 17:78768837-78768859 TATTTTTTATTTTTGCCAAGAGG - Intronic
1153207388 18:2717677-2717699 ACTATTGTACTGTTTCCAAGTGG + Intronic
1154513247 18:15133649-15133671 ACTATTTTACTACTTCCAAGTGG - Intergenic
1156728015 18:40153357-40153379 TCTATACTCCTCTTCCCAAGAGG + Intergenic
1157844642 18:50992016-50992038 TCTATTCTTATCCTGCCAAGAGG - Intronic
1158107746 18:53904779-53904801 TCTAGTCTATTCTTGCCCAGAGG + Intergenic
1159303961 18:66615924-66615946 ACTATTTTGCTATTTCCAAGTGG - Intergenic
1164485990 19:28656258-28656280 ACTATTTTGCTATTTCCAAGTGG - Intergenic
1166459116 19:42970526-42970548 TCTACTTTACTCATGCCAACCGG + Intronic
928031647 2:27784726-27784748 TCAATATTAAACTTGCCAAGGGG + Intronic
928854309 2:35785857-35785879 TCTTTTTTCTTATTGCCAAGAGG + Intergenic
933336529 2:80966569-80966591 ACTATTTTGCTATTTCCAAGTGG - Intergenic
933428744 2:82147309-82147331 CCAATTTTTCTCTTGCCAAGGGG - Intergenic
936801799 2:116278587-116278609 ACTATTTTGCTATTTCCAAGTGG - Intergenic
938115465 2:128600259-128600281 TCTATTGTGCTTTTGGCAAGGGG + Intergenic
938122339 2:128642772-128642794 TCCAGTTTAATCTTGCCAATGGG + Intergenic
938513495 2:131978263-131978285 ACTATTTTACTACTTCCAAGTGG - Intergenic
941214878 2:162694380-162694402 TCTATTTTACTCTGGCAGACAGG + Intronic
942259220 2:174140832-174140854 GCTTCTTTACTCTTGCCAATGGG + Intronic
942391777 2:175502545-175502567 TCTATCTCACTGTAGCCAAGTGG + Intergenic
942883963 2:180899635-180899657 TCTACTCTACTCTAGCCAAGTGG + Intergenic
943241332 2:185388137-185388159 TCAATTTTGCTGTTGTCAAGAGG - Intergenic
943566427 2:189522222-189522244 TCTATGATATTCTTGCCAAATGG + Intergenic
943699433 2:190973686-190973708 TTCATTTTACACTTGCCAATAGG + Intronic
945412208 2:209523718-209523740 TTTATTTTTCTCTTGCCAGGTGG + Intronic
945506781 2:210651495-210651517 TCTATTTTATTCCTGGCCAGGGG + Intronic
948208910 2:236178245-236178267 CCTATTTCCCTCTTTCCAAGGGG - Intergenic
948979697 2:241486903-241486925 TCTCTCTTACTCTTCCCAAGTGG + Intronic
1169439766 20:5624326-5624348 TATGTTTTACTCATGCCATGAGG - Intergenic
1170070034 20:12357061-12357083 ACTATTTTGCTATTTCCAAGTGG - Intergenic
1170651829 20:18250102-18250124 TCTCTTTTACTATTAGCAAGGGG - Intergenic
1177532629 21:22381189-22381211 GATATTTTTCTCTTGCCAAAAGG - Intergenic
1184526328 22:45025652-45025674 TCTACTTTACACCTGCCCAGAGG + Intergenic
955125431 3:56106299-56106321 TCTATTTTCCTTTTTCCATGGGG - Intronic
956563216 3:70606031-70606053 TTTATTTTACTCTAGATAAGAGG + Intergenic
958591064 3:96158518-96158540 TCTTTGTTACTCTAGCTAAGTGG - Intergenic
959567213 3:107844683-107844705 TCAATAGTACTCTTGCCAAAAGG + Intergenic
959808220 3:110584412-110584434 TCTGTTCCACTCTTCCCAAGAGG + Intergenic
960824186 3:121766318-121766340 ACTATTTTGCTATTTCCAAGTGG - Intergenic
963547113 3:146672939-146672961 TATATTTTGCTATTTCCAAGTGG + Intergenic
963740458 3:149075074-149075096 CTTATTTTTCTCTTGACAAGTGG - Intronic
964009843 3:151879187-151879209 TGTTTTTAACTCTTGTCAAGAGG - Intronic
964141131 3:153400950-153400972 TGTATTCTACTTTTTCCAAGAGG - Intergenic
964199511 3:154102583-154102605 TCCAGTTTATTCTTGCCATGAGG + Intergenic
964546130 3:157835572-157835594 TCTGTTTTACTTTGGGCAAGAGG - Intergenic
969533811 4:7743742-7743764 TCTATTTTATCCCTGCCAACTGG - Intergenic
971082361 4:23228170-23228192 TCTACTTTGCTATTTCCAAGAGG - Intergenic
971528218 4:27650154-27650176 TCTAATTTACTTCTGCCTAGGGG - Intergenic
971820072 4:31540201-31540223 ACTATTTTGCTATTTCCAAGTGG + Intergenic
972709434 4:41579793-41579815 TGTATGTTACACATGCCAAGAGG - Intronic
973267152 4:48222020-48222042 TCCATTCTACTTTTGCCAGGAGG + Intronic
974767737 4:66369838-66369860 TCTCTTTTAATCTTTACAAGAGG + Intergenic
976820603 4:89202263-89202285 TTTATTTTTCTCTTGGCAGGAGG + Intergenic
977066063 4:92317299-92317321 TTTATTTTACTTCTGCCATGAGG - Intronic
978971656 4:114815054-114815076 TCAATTTTACTCTTTTCAAAAGG - Intergenic
979199122 4:117955750-117955772 TCTAGTTAAATGTTGCCAAGTGG - Intergenic
980133581 4:128839359-128839381 TCTATTTTACTTTACACAAGTGG - Intronic
980275559 4:130646023-130646045 TCTATTTTTCTCTTTCCAAGTGG - Intergenic
981898238 4:149830529-149830551 TCTATTATAGTTTTGTCAAGTGG + Intergenic
983404522 4:167311173-167311195 ACTATTTTGCTCTTTCTAAGTGG - Intergenic
985310558 4:188593371-188593393 TCTACTATACTCTAGGCAAGGGG + Intergenic
986185690 5:5434817-5434839 TTTATTTTAGTCTAGCCTAGTGG + Intronic
986370246 5:7073077-7073099 ACTATCTTACTATTGCCAGGAGG + Intergenic
986762843 5:10895797-10895819 CTTTTTTTCCTCTTGCCAAGTGG + Intergenic
987946897 5:24621510-24621532 TGTATTTTACTTTTTCCATGTGG - Intronic
988304685 5:29479911-29479933 CCTATTTTGCTATTTCCAAGTGG - Intergenic
989306106 5:39958507-39958529 TATATTTTACTATTGCCACTCGG + Intergenic
989649887 5:43675974-43675996 TCTAATTTAATCTTGACAACGGG - Intronic
991554622 5:67881446-67881468 TTTCTTTTACTCTTACCAATGGG + Intergenic
993418711 5:87672057-87672079 TTTATATTGCTCTGGCCAAGTGG + Intergenic
994150598 5:96443196-96443218 GCTATTTTACTCTTGGTGAGAGG - Intergenic
994547697 5:101187543-101187565 ACTATTTTGCTCTTTCCAAGGGG - Intergenic
994759668 5:103836763-103836785 TCTCATTTACTCTTGCCAGTGGG + Intergenic
994833308 5:104814478-104814500 TCTTTTTTTTTCTTTCCAAGAGG + Intergenic
995657778 5:114446294-114446316 CCTATTTTACTTTGGCAAAGAGG + Intronic
995769805 5:115656321-115656343 TCTATTTTATTCTTGCTAAGAGG + Intergenic
998901383 5:146858850-146858872 TCATTGTTACTCTTGCCAAGTGG - Intronic
999352993 5:150894807-150894829 TCCCTTTTACTCTTCCCAACTGG - Exonic
1000690736 5:164316980-164317002 TTTATATTACTCTTGCCACACGG - Intergenic
1001878685 5:175223428-175223450 TCCATTTAAGTGTTGCCAAGAGG - Intergenic
1002551460 5:179995894-179995916 ACTATTTTGCTTTTTCCAAGTGG + Intronic
1003187304 6:3843307-3843329 TCTATTTTTCTCTTCCCTGGAGG - Intergenic
1004148089 6:13088992-13089014 TTTATTTTAGATTTGCCAAGAGG + Intronic
1005129646 6:22491086-22491108 TTTATTTTGGTTTTGCCAAGTGG + Intergenic
1007868668 6:45006582-45006604 TCAATTATACTCCTACCAAGAGG + Intronic
1008347127 6:50441639-50441661 TCCATGTTACTCTGGCCCAGTGG + Intergenic
1011132062 6:84061862-84061884 TCTCTTTTACTCTGGAAAAGTGG + Intronic
1011590186 6:88963959-88963981 TCTATTTTACTGATGAAAAGAGG + Intergenic
1011751813 6:90461588-90461610 TCTATCTTACTCAGGCCAAAAGG - Intergenic
1011963208 6:93117535-93117557 TTTTTTTTAATCTTGGCAAGGGG - Intergenic
1012037264 6:94158297-94158319 TTTATTTTGCTGTTGGCAAGTGG + Intergenic
1013826657 6:114219278-114219300 TCGATTTTACTCAGCCCAAGAGG + Intronic
1016570496 6:145507256-145507278 ACTATTTTGCTGTTTCCAAGTGG - Intronic
1019076415 6:169391998-169392020 CCAACTTTAGTCTTGCCAAGTGG + Intergenic
1020429382 7:8103903-8103925 TGTATTTTTGTCTTGCCAATAGG - Intergenic
1021245324 7:18254541-18254563 TCTATGCTACTCTAGCCAACTGG - Intronic
1021895043 7:25225572-25225594 TCCTTTTTGCTCTTGCCAAAGGG + Intronic
1022568769 7:31430551-31430573 TTTAGTTTACTCTTGACAGGAGG - Intergenic
1023561875 7:41483096-41483118 TTTTTTTTACAGTTGCCAAGAGG - Intergenic
1023588718 7:41758720-41758742 TGTATTTTCCTCTTGCCCAGAGG - Intergenic
1024057896 7:45677335-45677357 TCTATTTTCCTTTTGGCAAATGG + Intronic
1027950320 7:84807258-84807280 GCTGTCTTACTCTTGCCAGGTGG + Intergenic
1028945855 7:96579682-96579704 GCTGTTTTACTCTTTTCAAGAGG - Intronic
1030407468 7:109132765-109132787 ACTATTTTGCTATTTCCAAGTGG - Intergenic
1032326278 7:130931783-130931805 TATAATTTACTATTTCCAAGAGG + Intergenic
1034092515 7:148377122-148377144 TCTATTTCTCTCTCTCCAAGAGG + Intronic
1038591825 8:28846043-28846065 TCTTTTTTCCTCATGCCCAGTGG - Intronic
1040668380 8:49658082-49658104 TTTTTTTTTCTCTTGGCAAGAGG + Intergenic
1043691887 8:83164544-83164566 TATATTTTAGTTTTACCAAGTGG + Intergenic
1046116872 8:109795400-109795422 TCTATTTTACTTTTGCCTGTTGG + Intergenic
1046549355 8:115694100-115694122 TCTATTTTCCTTGTGCCCAGTGG - Intronic
1046791224 8:118324241-118324263 TCCAATTTAATTTTGCCAAGGGG + Intronic
1046859385 8:119072859-119072881 TCTATTTTTCAGTTGCTAAGAGG - Intronic
1047605684 8:126471939-126471961 TATATTTTACTATTGCACAGAGG + Intergenic
1048809107 8:138269107-138269129 TCTTTTTTTCTCTTGCCATCTGG - Intronic
1048962529 8:139592763-139592785 TCTATTTTTCTCTTCCAAAAGGG + Intergenic
1050402129 9:5267020-5267042 ACTATTTTGCTATTTCCAAGTGG + Intergenic
1050989735 9:12134794-12134816 ACTATTTTGCTCTTTCCAAGTGG + Intergenic
1052849339 9:33367126-33367148 TCTGTTTTCCCCATGCCAAGAGG - Intronic
1055694491 9:78869318-78869340 TGTATTTTATTCTTTGCAAGGGG - Intergenic
1055883044 9:81024853-81024875 TTTGTTTTGCTCTTTCCAAGTGG + Intergenic
1056559429 9:87717375-87717397 CCTTTCTTGCTCTTGCCAAGAGG - Intergenic
1058860580 9:109114401-109114423 TCTATTTTACACATCACAAGAGG - Intronic
1059546969 9:115186187-115186209 TTTATTTTACTTTTGCCATGTGG + Intronic
1059804857 9:117787530-117787552 TCTATTTTTCTCTTGGGCAGTGG + Intergenic
1189191316 X:39109654-39109676 TCTCTTTTACTCTAGTTAAGGGG + Intergenic
1192761880 X:74103082-74103104 ACTATTTTGCTATTTCCAAGTGG - Intergenic
1193031694 X:76906076-76906098 ACTATTTTTCTATTTCCAAGTGG - Intergenic
1193995525 X:88362847-88362869 ACTATCTTGCTCTTCCCAAGAGG - Intergenic
1194487671 X:94505634-94505656 ACTATTTTGCTATTTCCAAGTGG - Intergenic
1196117236 X:112011045-112011067 TGTATTTTACCCTTGTCAAATGG - Intronic
1196668540 X:118342202-118342224 TTTGTATTATTCTTGCCAAGAGG + Intergenic