ID: 1093643435

View in Genome Browser
Species Human (GRCh38)
Location 12:21554669-21554691
Sequence GTGTGTTAGGGAAAGGTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 207}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093643430_1093643435 2 Left 1093643430 12:21554644-21554666 CCGTTCCTGTCTGGAGTAGAGGA 0: 1
1: 0
2: 1
3: 10
4: 187
Right 1093643435 12:21554669-21554691 GTGTGTTAGGGAAAGGTGCAAGG 0: 1
1: 0
2: 0
3: 20
4: 207
1093643431_1093643435 -3 Left 1093643431 12:21554649-21554671 CCTGTCTGGAGTAGAGGAATGTG 0: 1
1: 0
2: 3
3: 35
4: 753
Right 1093643435 12:21554669-21554691 GTGTGTTAGGGAAAGGTGCAAGG 0: 1
1: 0
2: 0
3: 20
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093643435 Original CRISPR GTGTGTTAGGGAAAGGTGCA AGG Intronic
902682317 1:18052077-18052099 GTGTGTTAGGGGAAGGAGTAGGG - Intergenic
904703663 1:32374670-32374692 GTGAGTTTGGGGCAGGTGCAGGG - Intronic
906187528 1:43872297-43872319 GTGTGTTGGGGAGAGGTGAGAGG + Intronic
906466648 1:46087116-46087138 GTGTGTGGGGGAATGGTGGAGGG + Intronic
908083769 1:60608722-60608744 GTGAGTTAGGGAAAAGGGCAAGG - Intergenic
908119267 1:60970471-60970493 GTATGTTAGGGAGAAGAGCAGGG - Intronic
909120636 1:71598937-71598959 CTCTGTTAGGGCAAGGTTCAAGG + Intronic
910130061 1:83893839-83893861 GTGTCCTAGGGGAAGGGGCAGGG + Intronic
913526447 1:119697978-119698000 GTGTGATAGAGAATGCTGCAGGG - Intronic
914680766 1:149936743-149936765 GGGTGTTAGGGAGAGGGGTAGGG + Exonic
914732830 1:150387366-150387388 GTGTGTTAGGGAAAGGAGAGAGG + Intronic
915567146 1:156721515-156721537 GTGTGTCAGGGGGAGTTGCATGG + Intergenic
916243825 1:162666571-162666593 GTGTGTGGGGGAAAGGGGGAGGG + Intronic
916499523 1:165375049-165375071 GTGTTTTGGGGAAAGAAGCAAGG + Intergenic
916801827 1:168223102-168223124 GTGTGTTAGGGGAAGGGAAAGGG + Intergenic
916836014 1:168545826-168545848 GTGTGTGAGTGAATGGTGGAAGG - Intergenic
916838452 1:168574749-168574771 GTGTGTGAGTGAATGGTGGAAGG + Intergenic
920285112 1:204873648-204873670 GTGTGCTAGGGACAGCTGCTGGG + Intronic
920853834 1:209647627-209647649 GGGTGATAGGGAAGGGTGAAGGG + Intronic
921233190 1:213095061-213095083 TTGTGTTAGGGAAGGGTTCAAGG - Intronic
922325807 1:224527156-224527178 GTGTGTGGGGGACAGGTGCTTGG + Intronic
923087565 1:230713068-230713090 GTGTGGTGGGGAAAGCTGCAGGG - Intronic
924089217 1:240485583-240485605 GTGTGTTAGGGGTAGGTGTGGGG - Intergenic
1067035616 10:42914318-42914340 GTGTGTAGAGGGAAGGTGCAAGG - Intergenic
1067081310 10:43214124-43214146 GGGTGATAGGGCAGGGTGCAAGG - Intronic
1069184397 10:65404856-65404878 GTGTGTCAGGAAAAGGCACAAGG + Intergenic
1069991993 10:72321748-72321770 CTGTGATAGGGAAAGGGGGAGGG - Intergenic
1070932407 10:80270718-80270740 CAGTGTTAGGGAAATGTGGACGG - Intergenic
1071591942 10:86883122-86883144 GTGGGTGAGGGAGAAGTGCATGG - Intronic
1071946653 10:90653485-90653507 GTGTGTGAGGGGAAGCTGCAAGG - Intergenic
1072718562 10:97767228-97767250 GAGGGTAAGGGAAAGGTGGAGGG - Exonic
1073246296 10:102092544-102092566 GTGTGATAGGAAAAGGTGGATGG - Intergenic
1076243854 10:128931217-128931239 ATGTGTTTGGGATAAGTGCACGG + Intergenic
1076305550 10:129463472-129463494 GAGGGTAAGGGAATGGTGCAGGG - Intergenic
1077491947 11:2865041-2865063 ATGTGTTAGGGAAAGGCCCCAGG - Intergenic
1078270510 11:9790081-9790103 GTGTGTTATGTAGATGTGCATGG + Intronic
1078346741 11:10556477-10556499 GTGGAGTAGGGAAAGGAGCATGG + Intergenic
1079222241 11:18573381-18573403 GGGTATTAGGGAAAGGAGGAAGG - Intronic
1080007066 11:27420762-27420784 GTGTCTTGGGGGAAGGTGGAGGG + Intronic
1081460554 11:43268924-43268946 GTGAATTAGGGAAAGGGGAAAGG + Intergenic
1082054182 11:47799437-47799459 ATGAGATAGGGAAATGTGCATGG - Intronic
1082200508 11:49360664-49360686 ATGTGGGAGGGAAAGGGGCAGGG + Intergenic
1086655172 11:89345574-89345596 ATGTGGGAGGGAAAGGTGCAGGG - Intronic
1088754962 11:112878174-112878196 GTGTATTAGGTAAGGCTGCATGG + Intergenic
1089538173 11:119173435-119173457 ATGTGTCAGGGAAAGGGGCCTGG - Intronic
1089638225 11:119830297-119830319 GAGTGCTACAGAAAGGTGCAAGG - Intergenic
1091401773 12:185494-185516 GTGTGTTAGTGAGATGTGCTTGG + Intergenic
1091544208 12:1490100-1490122 ATGAGTTAGAGAAAGGTGAACGG + Exonic
1091650852 12:2308170-2308192 GTGGGTTAGAGAAAGAAGCAAGG + Intronic
1091666262 12:2420515-2420537 GTGTGTTGGGCCAAGGTGGAAGG + Intronic
1093643435 12:21554669-21554691 GTGTGTTAGGGAAAGGTGCAAGG + Intronic
1095358060 12:41300819-41300841 GTGTTTTATGGAAAGCTTCAGGG + Intronic
1096499709 12:52057281-52057303 GTGTATCAGGGAAAGGGGCTGGG - Intronic
1099022188 12:77420475-77420497 GTGTGTTCAGGAAAGGTGTTGGG + Intergenic
1099051415 12:77785565-77785587 CTGTATTAGGGATAGGTTCAAGG + Intergenic
1100304584 12:93338619-93338641 GTGGTTTTGGGATAGGTGCAGGG - Intergenic
1100981903 12:100168666-100168688 GTTGGTTAGGCAAGGGTGCAGGG - Intergenic
1102879875 12:116476143-116476165 GTGTGTAAGGTAAAAGTGGATGG + Intergenic
1106253842 13:28004001-28004023 GCCTGTTAGGGATAGGTGGAGGG + Exonic
1111716440 13:91885519-91885541 GTGTATTGGGAAAAGATGCAAGG - Intronic
1113362211 13:109641945-109641967 CTGTGTTTAGGAAAGGTGCATGG + Intergenic
1114927233 14:27419319-27419341 GTGTGTTGGGGAATGGTGACAGG + Intergenic
1115755901 14:36525557-36525579 GGGTGTGAGGGAAGGGTGGAGGG + Intergenic
1119538156 14:75419642-75419664 GTGTGGTAGAGAGAGGTGTAGGG - Intergenic
1121581951 14:95038322-95038344 GTGTTTTAGTGAATGCTGCAGGG + Intergenic
1121930534 14:97967805-97967827 GAGTGTTATGGAAAGATCCATGG - Intronic
1124039515 15:26087682-26087704 GTGTGTTAGGAGAAGCTTCAAGG - Intergenic
1126100630 15:45116315-45116337 GTGTGTCAGGGATAGCTGGAGGG + Intronic
1127670228 15:61187941-61187963 GTGTGTTAGGGGAGGGTTGAGGG - Intronic
1127693323 15:61419134-61419156 GTGGGTTAGGGAAGGGGTCAGGG + Intergenic
1128358341 15:66943679-66943701 GTGTGTCAGGGGCAGGGGCAGGG + Intergenic
1129594416 15:76950315-76950337 GTGGGATAGGGAAAAGTGAAGGG + Intronic
1130674382 15:85939187-85939209 GGGTGTTAGGGAAAGCAGCTTGG + Intergenic
1134304682 16:13021462-13021484 GTGAGTTAGGGAGAGGGGCTTGG + Intronic
1136014203 16:27384575-27384597 GAGTGTCAGGGAAGGCTGCATGG - Intergenic
1136684153 16:31984218-31984240 GTGTGTTGGGGAAGAGGGCATGG + Intergenic
1136784781 16:32927770-32927792 GTGTGTTGGGGAAGAGGGCATGG + Intergenic
1136885002 16:33926036-33926058 GTGTGTTGGGGAAGAGGGCATGG - Intergenic
1139494126 16:67303515-67303537 GTGTGGTAGGGAGTGGGGCATGG + Intronic
1141331560 16:83116078-83116100 GGGTGTGACGGAAAGGGGCAGGG + Intronic
1203087440 16_KI270728v1_random:1191776-1191798 GTGTGTTGGGGAAGAGGGCATGG + Intergenic
1142698664 17:1646883-1646905 GTATGTTGGGGAAAGGGGAAAGG - Intronic
1146049130 17:29534961-29534983 GTGTATTAGGGAAAGGGCGATGG + Intronic
1146508920 17:33429080-33429102 GTGTGTCAGGGTAAGGTGTCTGG + Intronic
1146665277 17:34698116-34698138 GTGTGTTGGGGAAAGGGGTTTGG - Intergenic
1147381967 17:40061694-40061716 GTGTGTTAGGGGGAGCTGCTCGG - Intronic
1148489030 17:48011669-48011691 GTGTGTTAGGGACGGGAGAAGGG - Intergenic
1155103004 18:22632316-22632338 ATTTGCTAGGGAAAGGTGGAAGG - Intergenic
1155267436 18:24107270-24107292 GTGTGTTAGAGAAGGATGAAAGG - Intronic
1155361623 18:25008923-25008945 GTGTGTTAGAAAAAGGGTCAAGG + Intergenic
1156605666 18:38664263-38664285 GTGGGATAGAGAAAGGTCCAAGG - Intergenic
1159002663 18:62987743-62987765 GTGTGGAAGGGACAAGTGCAAGG - Intergenic
1160821691 19:1062014-1062036 GTGTGGGAGGTAGAGGTGCAGGG - Intronic
1162009619 19:7804349-7804371 GTGTGTTGGGGAGTGGGGCAGGG - Intergenic
1164584116 19:29455219-29455241 CTGTGGTAGATAAAGGTGCAGGG + Intergenic
1164879301 19:31717622-31717644 GTGTGTTTGGTAAAGGTGAAAGG - Intergenic
1165538750 19:36472743-36472765 GTGTGTTAGGTAAAGGGGAAAGG + Intronic
1165618924 19:37227692-37227714 GTGTATAAGGCAAAGGGGCAGGG + Intronic
1165829595 19:38723909-38723931 GTGTGGGAGGGAAGGGGGCAGGG - Intronic
1166378869 19:42344224-42344246 GTGGGATAGGCAAAGGTTCAGGG - Intronic
1166484127 19:43198404-43198426 GTGTGTTAAAGACAGATGCATGG + Intronic
1168504229 19:56919716-56919738 GTGCTTTTGGGAAACGTGCACGG + Intergenic
1168520864 19:57049638-57049660 GTGTGGAAAGGAAAGCTGCAAGG - Intergenic
925584741 2:5453374-5453396 GTGTGGGAGGGAGAGGTGGATGG - Intergenic
925691174 2:6524986-6525008 GTGTTTTATGAAAAGGTGGAAGG + Intergenic
927369844 2:22341844-22341866 GTGAGTTTGGGAAAGGTTGAAGG - Intergenic
928573190 2:32628461-32628483 CTGTGTTAGGGAAAAATGAAGGG - Intronic
930364206 2:50418365-50418387 GTGTGTTGGGGGAGGCTGCAAGG - Intronic
933246021 2:79975744-79975766 ATGTGTTAGGGCAAGGTACGGGG + Intronic
934137828 2:89015222-89015244 GTTAGTTAAGGCAAGGTGCAGGG + Intergenic
934231421 2:90185405-90185427 GTTAGTTAAGGCAAGGTGCAGGG - Intergenic
938812466 2:134866382-134866404 TTGGGTTTGGCAAAGGTGCATGG - Intronic
939019236 2:136939444-136939466 GTATGTTAGGTAAAAGTGAATGG - Intronic
939687982 2:145223390-145223412 GTGGGTAAGGGAAATGTGAAAGG + Intergenic
941736502 2:168982519-168982541 GTCTGGTAGGGAAAGATGAAGGG - Intronic
941915377 2:170809514-170809536 GTGTGTTAGGGAAGGAAACAAGG + Intergenic
947538197 2:230954221-230954243 CTGTGTCAGGGGAAGGGGCAAGG - Intronic
1170125431 20:12957998-12958020 GTGTGTGTGGCAAGGGTGCAGGG - Intergenic
1170356305 20:15495788-15495810 GTCTGTGAGGTAAAGGTACATGG + Intronic
1171061798 20:21971564-21971586 GTGTGGAAGGGAGAGGCGCATGG + Intergenic
1171748755 20:29026650-29026672 GTGGGTTGGGGTAAGGGGCAGGG + Intergenic
1173861900 20:46289240-46289262 GGTTGTAAGGGAAAGGTGCATGG - Intronic
1175833602 20:61980027-61980049 GTTTGTTAGGTACAGGTGCTGGG + Intronic
1176093214 20:63328163-63328185 GTGTGGTAGGCACAGGTGCAGGG - Intronic
1179307674 21:40169789-40169811 GTGTGTGAAGGAGGGGTGCAGGG - Intronic
1180611862 22:17103586-17103608 GTGTGGTGTGGACAGGTGCAGGG + Intronic
1180799625 22:18625729-18625751 GCCTGGTAGGGAATGGTGCAGGG + Intergenic
1181222091 22:21369537-21369559 GCCTGGTAGGGAATGGTGCAGGG - Intergenic
1181304600 22:21908033-21908055 GTGAGTTAGGGAAAAGGGGAAGG + Intergenic
1181637851 22:24182531-24182553 GCCTGGTAGGGAATGGTGCAGGG - Intronic
1184729856 22:46366171-46366193 GGTTGTTGGGGGAAGGTGCAGGG + Intronic
951504620 3:23429676-23429698 GTGAGATAGGAAAAGGGGCAGGG + Intronic
951991676 3:28682358-28682380 GTGTGTGTAGGAAGGGTGCATGG - Intergenic
953031514 3:39183006-39183028 GTGTGATGGGGATAGGGGCAAGG + Intergenic
953709709 3:45259830-45259852 GTGTGTTAGGGAAAAGCTAAAGG - Intergenic
954228554 3:49199164-49199186 GGGTGTGAGGGAACGTTGCATGG + Intronic
954288480 3:49636389-49636411 GTGTGTATGGGGAGGGTGCAGGG + Intronic
955837639 3:63074557-63074579 GTGTGGTAGGTACTGGTGCAAGG - Intergenic
956345919 3:68278670-68278692 CTGTGCTAAGAAAAGGTGCAAGG - Intronic
956779440 3:72592601-72592623 GTGTGTGAGAGAAGGGAGCAGGG + Intergenic
958258401 3:91351532-91351554 TAGTCTTAGGGCAAGGTGCATGG - Intergenic
959563711 3:107812993-107813015 GTGTGGGAGGGAAAAGTGTAAGG - Intergenic
960483283 3:118219533-118219555 GTGTGTTGGGGGAGGGGGCAGGG + Intergenic
963556192 3:146791957-146791979 TTGTTTTAGGGAAAAGTACAAGG - Intergenic
970367630 4:15376068-15376090 GTTTATTAGGTAAAGGTGAAAGG - Intronic
970920470 4:21388662-21388684 GAGTGTTGGGGAAAAGTGGAGGG - Intronic
973718700 4:53702470-53702492 GTATGGTAGGGAAAGGGGCCTGG - Intronic
974413747 4:61577206-61577228 GTGTGTTAGGGAAATGGGGGGGG + Intronic
974640793 4:64627277-64627299 GGGAGGTAGGGAAAGGTACAAGG + Intergenic
979437090 4:120706025-120706047 GGGTGTGAGTGAAAGCTGCATGG + Intronic
981580341 4:146243778-146243800 GTGTGTTCAGGAAATGTGCGCGG + Intergenic
982651996 4:158098158-158098180 CTGAGATAGGGAAAGATGCAGGG + Intergenic
983520992 4:168708939-168708961 GTTTGTTGTGGAAAGGTGGAGGG + Intronic
985493117 5:190765-190787 GTGCGGCAGGGAAAGCTGCAGGG - Intergenic
985865892 5:2514088-2514110 GTGTGTTTGGGAAAGAAGAAAGG - Intergenic
986227365 5:5828339-5828361 GAGTGGTAGGTAAAGGTGCCAGG + Intergenic
986448563 5:7844798-7844820 GTGTGTGTGGTAAAGGTGCTTGG + Intronic
986759780 5:10869371-10869393 CTATTTTAGGGAAAGGTGGATGG + Intergenic
986806301 5:11311764-11311786 GTGTGTGAGGTGAGGGTGCATGG - Intronic
988407819 5:30846813-30846835 GTGTATTAGGGAAAAGTAGATGG - Intergenic
990646695 5:57853465-57853487 GTGTGTTAGGGAAATATAAAAGG - Intergenic
993050973 5:82925500-82925522 GTGTGTTAGGGGAAGTTGTCAGG + Intergenic
994067586 5:95560657-95560679 GTGTGTTTGTGTATGGTGCAAGG - Intronic
997760812 5:136445961-136445983 GTGTGTTCGGGAGAGGAGGAAGG - Intergenic
998385850 5:141756743-141756765 GTGTGTGAAGGAGAGGTGGAGGG - Intergenic
1000020973 5:157319188-157319210 GTGAGTTAGGGTAAGGAGAAGGG + Intronic
1000530285 5:162410753-162410775 CTGTGTCAGGGAAAGCTTCATGG - Intergenic
1000654364 5:163858254-163858276 GTGTTCTAGGGAAAAGTCCATGG + Intergenic
1002304680 5:178276177-178276199 CTATGTTAGGGAAAGGTCCAGGG + Intronic
1003186393 6:3835143-3835165 TTGTGTTAGGGCAGGGTGGAAGG + Intergenic
1003541111 6:7018878-7018900 GTTTGGGAGGGCAAGGTGCATGG - Intergenic
1004179096 6:13365461-13365483 GTGTGTGAGGTGCAGGTGCACGG - Exonic
1004620059 6:17324125-17324147 GAGTGTAAGGGAATGGTGTAAGG + Intergenic
1006604284 6:35244934-35244956 GTGAGTTGGGGAGAGGTGGAAGG - Intronic
1006718047 6:36132516-36132538 GTGTATTAGGAAAGGGTGGATGG + Intronic
1007075494 6:39063634-39063656 GTTTGTTTGGGAAAGGAGCTGGG + Intronic
1007231067 6:40348020-40348042 GTGTGCTGGGGGAAGGGGCAGGG + Intergenic
1007623084 6:43226649-43226671 ATTGATTAGGGAAAGGTGCATGG + Intronic
1008199845 6:48572773-48572795 ATGTGGTGAGGAAAGGTGCATGG + Intergenic
1008498178 6:52153624-52153646 TTAAGTTAGAGAAAGGTGCATGG - Intergenic
1008892032 6:56505749-56505771 GTCTGTTAGGAAACGGAGCAAGG + Intronic
1009185375 6:60568490-60568512 TAGTCTTAGGGCAAGGTGCATGG + Intergenic
1010197972 6:73258842-73258864 GTGTCTTAGGGAAAGGCAGAAGG - Intronic
1012438883 6:99243622-99243644 GTGAGTTATGGAAAGCTGCAGGG - Intergenic
1013149740 6:107432930-107432952 GGGTGGTAGGGAAAGGTAGAGGG - Intronic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1015319245 6:131853668-131853690 GTGTGTGAGGGTAAGGTGGGAGG + Intronic
1015497205 6:133894264-133894286 GAGCATTAGGGAGAGGTGCAAGG - Exonic
1017902226 6:158728257-158728279 GTGTGTGAGTGAATGGTGTAAGG + Intronic
1018755998 6:166850274-166850296 GTGTGTTTGGGTAAGATGCAAGG - Intronic
1019351631 7:556762-556784 GTGTGTTTGGAGAAGGTGAAAGG - Intronic
1019523025 7:1469056-1469078 GTGTGTTAGGGTTAGGGACAGGG - Intergenic
1022762126 7:33366052-33366074 GGGGGTTAGGGGAATGTGCAAGG + Intronic
1029418864 7:100461618-100461640 GGTTGTTAGGGGAAGGTGGAGGG - Intronic
1030721438 7:112875607-112875629 GTGTGATAGGGAAAGGTTAAGGG - Intronic
1031370745 7:120962549-120962571 GTGAGTTAGGGCAAGGTGTATGG + Intronic
1032024318 7:128429577-128429599 ATGTGTTAGGCACAGGGGCATGG + Intergenic
1033615498 7:143010546-143010568 ATGTAATAGGAAAAGGTGCAAGG - Intergenic
1039263506 8:35799304-35799326 TTGTGTGAGGGAAAGTTCCATGG + Intergenic
1039477192 8:37845381-37845403 GCTTGTTAGGGGAAGGTGGAGGG + Intronic
1039682183 8:39752588-39752610 GACTGCTAGGGAAAGGTGCAGGG + Intronic
1040584202 8:48725094-48725116 CTGTGGTAGGGAAAGGCACATGG + Intronic
1040826960 8:51633035-51633057 GTGAGAGAGGGAAGGGTGCAAGG - Intronic
1046229174 8:111331090-111331112 GTCTGTCAGGGACAGGTGGAGGG - Intergenic
1047499675 8:125431311-125431333 GGGTGGTAGGCAAAGGTGCTTGG + Intronic
1048443522 8:134477060-134477082 ATGAGTTAGGGAAAGCTTCACGG - Intergenic
1048662570 8:136622026-136622048 GTGTGGTAGGGAGAGGTGGAGGG - Intergenic
1049622447 8:143604775-143604797 GTCCGTTAGGGACAGGTGGAGGG + Exonic
1050220200 9:3379231-3379253 GTCTGTGAAGGAAAGGTACATGG + Intronic
1050425896 9:5512359-5512381 GTGTGTTAGAGACAGCTGGAAGG - Intronic
1051743874 9:20276635-20276657 GTGTGGAAGGGAAATGTGAAGGG - Intergenic
1054810932 9:69433302-69433324 GTGTGTGAGGTAAGGGTGGAGGG - Intronic
1054840618 9:69734793-69734815 GTGTGATAGGGAAAAGTAGAAGG - Intronic
1054870732 9:70045072-70045094 GTGAGTTGGGAAAAGTTGCATGG + Intronic
1055914961 9:81391521-81391543 GTCCTTTAGGGAAAGGGGCAGGG + Intergenic
1056764300 9:89435500-89435522 GTGAGTTGGGGAAAGGAGGAGGG - Intronic
1059671071 9:116493193-116493215 GTGGCCTAGTGAAAGGTGCATGG - Intronic
1060403488 9:123361509-123361531 GTGGGGGAGGGAAGGGTGCAGGG + Intronic
1060962355 9:127690232-127690254 GTGTGAGAGGGAAAGGGCCAGGG - Intronic
1061944668 9:133901942-133901964 GTGTGGTAGGAGGAGGTGCATGG - Intronic
1062282736 9:135759240-135759262 GTGTGGTGGGTAAAGGGGCAAGG + Intronic
1062677257 9:137753979-137754001 GAGAGTTAGGGAAAAGCGCAGGG + Intronic
1186112089 X:6269200-6269222 GTGTGTGAGGGGAAGGTGAGCGG - Intergenic
1186938051 X:14472840-14472862 GTGTGTTAGGGAATGTTGGTGGG + Intergenic
1192283158 X:69705437-69705459 TGGTGTTAGGGAAAGATGAATGG - Intronic
1195655477 X:107327833-107327855 GTGTGTTAGGGATGGGAGGATGG + Intergenic
1196196895 X:112846278-112846300 GTGTGGTTGGGAAGGGTGGAAGG - Intergenic
1202031200 Y:20576003-20576025 CTGTGTTCGGGAAAGGAGCTGGG + Intronic