ID: 1093646160

View in Genome Browser
Species Human (GRCh38)
Location 12:21587599-21587621
Sequence GTCTCACAGTTCCACAGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 19745
Summary {0: 1, 1: 185, 2: 3435, 3: 7067, 4: 9057}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093646160_1093646164 16 Left 1093646160 12:21587599-21587621 CCAGCCCTGTGGAACTGTGAGAC 0: 1
1: 185
2: 3435
3: 7067
4: 9057
Right 1093646164 12:21587638-21587660 CTTATAAATTACCCAGTCTCAGG 0: 412
1: 7381
2: 13906
3: 14307
4: 10797

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093646160 Original CRISPR GTCTCACAGTTCCACAGGGC TGG (reversed) Intronic
Too many off-targets to display for this crispr