ID: 1093646164

View in Genome Browser
Species Human (GRCh38)
Location 12:21587638-21587660
Sequence CTTATAAATTACCCAGTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46803
Summary {0: 412, 1: 7381, 2: 13906, 3: 14307, 4: 10797}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093646155_1093646164 27 Left 1093646155 12:21587588-21587610 CCGAGGCCTCCCCAGCCCTGTGG 0: 2
1: 53
2: 114
3: 223
4: 808
Right 1093646164 12:21587638-21587660 CTTATAAATTACCCAGTCTCAGG 0: 412
1: 7381
2: 13906
3: 14307
4: 10797
1093646157_1093646164 21 Left 1093646157 12:21587594-21587616 CCTCCCCAGCCCTGTGGAACTGT 0: 141
1: 4268
2: 7024
3: 7919
4: 6372
Right 1093646164 12:21587638-21587660 CTTATAAATTACCCAGTCTCAGG 0: 412
1: 7381
2: 13906
3: 14307
4: 10797
1093646159_1093646164 17 Left 1093646159 12:21587598-21587620 CCCAGCCCTGTGGAACTGTGAGA 0: 1
1: 213
2: 3782
3: 7378
4: 9382
Right 1093646164 12:21587638-21587660 CTTATAAATTACCCAGTCTCAGG 0: 412
1: 7381
2: 13906
3: 14307
4: 10797
1093646160_1093646164 16 Left 1093646160 12:21587599-21587621 CCAGCCCTGTGGAACTGTGAGAC 0: 1
1: 185
2: 3435
3: 7067
4: 9057
Right 1093646164 12:21587638-21587660 CTTATAAATTACCCAGTCTCAGG 0: 412
1: 7381
2: 13906
3: 14307
4: 10797
1093646161_1093646164 12 Left 1093646161 12:21587603-21587625 CCCTGTGGAACTGTGAGACAATT 0: 15
1: 1986
2: 4627
3: 7958
4: 8596
Right 1093646164 12:21587638-21587660 CTTATAAATTACCCAGTCTCAGG 0: 412
1: 7381
2: 13906
3: 14307
4: 10797
1093646158_1093646164 18 Left 1093646158 12:21587597-21587619 CCCCAGCCCTGTGGAACTGTGAG 0: 167
1: 3418
2: 6890
3: 8786
4: 7387
Right 1093646164 12:21587638-21587660 CTTATAAATTACCCAGTCTCAGG 0: 412
1: 7381
2: 13906
3: 14307
4: 10797
1093646154_1093646164 28 Left 1093646154 12:21587587-21587609 CCCGAGGCCTCCCCAGCCCTGTG 0: 131
1: 1154
2: 2299
3: 4587
4: 5162
Right 1093646164 12:21587638-21587660 CTTATAAATTACCCAGTCTCAGG 0: 412
1: 7381
2: 13906
3: 14307
4: 10797
1093646162_1093646164 11 Left 1093646162 12:21587604-21587626 CCTGTGGAACTGTGAGACAATTA 0: 14
1: 836
2: 1379
3: 3045
4: 4582
Right 1093646164 12:21587638-21587660 CTTATAAATTACCCAGTCTCAGG 0: 412
1: 7381
2: 13906
3: 14307
4: 10797

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093646164 Original CRISPR CTTATAAATTACCCAGTCTC AGG Intronic
Too many off-targets to display for this crispr