ID: 1093652011

View in Genome Browser
Species Human (GRCh38)
Location 12:21657214-21657236
Sequence CCGGCTCTGACGGTCTTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 74}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093652011_1093652017 17 Left 1093652011 12:21657214-21657236 CCTGGAAAGACCGTCAGAGCCGG 0: 1
1: 0
2: 0
3: 2
4: 74
Right 1093652017 12:21657254-21657276 GCCAAACGTGCTGGTCATCTAGG 0: 1
1: 0
2: 0
3: 3
4: 47
1093652011_1093652016 8 Left 1093652011 12:21657214-21657236 CCTGGAAAGACCGTCAGAGCCGG 0: 1
1: 0
2: 0
3: 2
4: 74
Right 1093652016 12:21657245-21657267 AAGTGCAGCGCCAAACGTGCTGG 0: 1
1: 0
2: 0
3: 1
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093652011 Original CRISPR CCGGCTCTGACGGTCTTTCC AGG (reversed) Intronic
900549679 1:3247997-3248019 CCGGCTCCGGCGGGCTCTCCAGG - Intronic
900577139 1:3388999-3389021 CCGGTTCTGACTGTCTGGCCAGG + Intronic
900991347 1:6099762-6099784 CCAGCCCTGCCCGTCTTTCCAGG - Exonic
901762416 1:11479541-11479563 CCACCCCTGACCGTCTTTCCCGG - Intronic
912167913 1:107061785-107061807 TTGGCCCTGACAGTCTTTCCAGG - Intergenic
916745770 1:167683896-167683918 TGGTCTCTGCCGGTCTTTCCTGG - Exonic
920838883 1:209537206-209537228 CCAGGTCTGACTGACTTTCCAGG - Intergenic
922728695 1:227939060-227939082 CCACCTCTGACTGTCATTCCAGG + Intronic
923819824 1:237426240-237426262 CCTACCCTGACTGTCTTTCCTGG - Intronic
1063925942 10:10977512-10977534 CCTTCTTTGACTGTCTTTCCTGG + Intergenic
1072789681 10:98309196-98309218 CCAGCTCTGACAGTCCTTGCTGG + Intergenic
1084363978 11:68685833-68685855 CCGGCTCTGCCGCCCTGTCCCGG + Intronic
1093652011 12:21657214-21657236 CCGGCTCTGACGGTCTTTCCAGG - Intronic
1097054207 12:56240174-56240196 CCGGGTCTGCTGGTCCTTCCTGG + Exonic
1102563658 12:113780402-113780424 CCAGCTCTGATGTCCTTTCCTGG - Intergenic
1113900413 13:113793804-113793826 CCGGCTCTGATGGGGCTTCCAGG + Intronic
1116944518 14:50823776-50823798 CAGGCTCTGGCTGTCTTCCCAGG + Intronic
1117844438 14:59896214-59896236 CCAGCTCTGCCAGTCTTTCTGGG - Intergenic
1130421208 15:83748857-83748879 CCGGCTCCCACTGTCTTTCAAGG - Intronic
1131960793 15:97788387-97788409 CAGGCTCAGCCGGACTTTCCAGG - Intergenic
1135940179 16:26815617-26815639 CCAGCTCTGAGGGTCTCTGCTGG + Intergenic
1141858101 16:86698352-86698374 CCTTCTCTGATGGGCTTTCCTGG + Intergenic
1143284849 17:5781324-5781346 CCTCCTCTGAGGGTCTTGCCTGG + Intronic
1143340768 17:6209031-6209053 CCGGCTATGACGATTTTTCGTGG - Intergenic
1143942864 17:10560896-10560918 CTGGCACTGAGGGTATTTCCTGG + Intergenic
1148780333 17:50117777-50117799 CGGGCCCTGAGGGTCCTTCCGGG + Intronic
1152325015 17:79630990-79631012 CTGGCTCTGACGGCCGTCCCTGG - Intergenic
1152561221 17:81079705-81079727 ACGGCTCTGCCGGTCTGTTCTGG + Intronic
1152817648 17:82418048-82418070 CTGGCTCAGGCGGACTTTCCAGG + Intronic
1152906492 17:82973441-82973463 CCGGTTTTCACGGTCTTCCCGGG + Intronic
1153906432 18:9665701-9665723 CAGGCTCTGGCGAGCTTTCCTGG + Intergenic
1157553616 18:48598166-48598188 GAGGCTCTGATGGTCTTACCAGG + Intronic
1160321849 18:77903916-77903938 GCGGCTCTGGTGGTCTTACCTGG - Intergenic
1161478313 19:4498373-4498395 CAGGCCCTGAGGGTCTTACCGGG - Exonic
1161820854 19:6530747-6530769 CCCTCTCTGCCGCTCTTTCCCGG - Intergenic
1163003928 19:14385654-14385676 CTGGCCCTGGCGGTCTGTCCTGG - Intronic
1165472152 19:36009889-36009911 CCAGCTCTGCCTGTATTTCCTGG - Intronic
1167435321 19:49475521-49475543 CCATCTCTGCCTGTCTTTCCCGG - Intronic
933832801 2:86224407-86224429 CCAGCTCTGACAGTCTCTACTGG - Intronic
935739841 2:106137846-106137868 TCGGCTCTGAAGGTCTGGCCAGG - Intronic
936040355 2:109145114-109145136 CCGGCTCTGTCTGTGTCTCCAGG + Intronic
936288723 2:111201233-111201255 TTGCCCCTGACGGTCTTTCCAGG - Intergenic
937260271 2:120581055-120581077 CCGGTTCTGTCGTTCCTTCCTGG - Intergenic
938383986 2:130851797-130851819 CCTGCTCTGCCAGTCTCTCCGGG + Intronic
1169931984 20:10843471-10843493 CCTGCTCTGGCTGCCTTTCCAGG + Intergenic
1172064321 20:32208160-32208182 CCCGCTCTGAGGTTCTCTCCTGG - Intronic
1181155528 22:20917693-20917715 CCGGCTCTGCCGTGCATTCCCGG + Exonic
952270827 3:31829885-31829907 ACGGCTGTGACGGTCCTTCCTGG - Intronic
953253860 3:41270246-41270268 CCAGCTCTCACACTCTTTCCTGG - Intronic
953344575 3:42164664-42164686 TTGGCTCTCACTGTCTTTCCAGG + Intronic
953683584 3:45058844-45058866 CTGGCTGTGAGGGTGTTTCCAGG - Intergenic
954025747 3:47781833-47781855 CCGGCCCTCGCGGTGTTTCCCGG + Exonic
962842914 3:139251917-139251939 GGGGCTCTGAGGGTCTGTCCTGG + Intronic
965882062 3:173397870-173397892 CCGGCTCGGACGGGCTCTCCCGG - Intronic
967108058 3:186269797-186269819 CCTGCCCTGGTGGTCTTTCCTGG - Intronic
968801701 4:2747207-2747229 CGGGCACTCACGGTCCTTCCAGG + Intronic
984927267 4:184817866-184817888 CCTCCTCTGAAGGTCTGTCCTGG + Intronic
985520433 5:371666-371688 GTGGCTCTGACTGTCCTTCCAGG + Intronic
985686836 5:1285986-1286008 CCAGCTCTGACGGTGCTGCCTGG - Intronic
989674670 5:43959805-43959827 CAGACTCTGACTCTCTTTCCAGG + Intergenic
994139985 5:96331404-96331426 CAGGCTCTGCCTGTGTTTCCCGG - Intergenic
1002561905 5:180088375-180088397 TGGGCTCTGACGCTCTCTCCAGG - Intergenic
1007656371 6:43453493-43453515 CCGGCCCTGATGGCCTTTCAAGG - Intronic
1011762768 6:90586678-90586700 CCGGCTCTGAAGGTGCCTCCCGG - Intronic
1016876707 6:148872832-148872854 CCCACTCTGACTGTCTTGCCTGG + Intronic
1018450343 6:163901557-163901579 GCGAGTCTTACGGTCTTTCCTGG + Intergenic
1019481862 7:1270591-1270613 CCTGCACTGACGGCCTTCCCAGG - Intergenic
1022494780 7:30846009-30846031 CCGCCTCTGAGGGCCGTTCCTGG - Intronic
1025182656 7:56831429-56831451 CTGCCTCTGACAGTCTCTCCAGG - Intergenic
1026890269 7:73977611-73977633 CAGGCTCTGAAGGTCTCTCGGGG - Intergenic
1026924242 7:74178634-74178656 CAGACTCTGAATGTCTTTCCAGG + Intronic
1061450912 9:130666571-130666593 CGGGCTCTGACCGGTTTTCCTGG + Intronic
1061987531 9:134138185-134138207 CCTCCTCTGAGGGTGTTTCCAGG + Intronic
1062180390 9:135188195-135188217 CGAGCACTGATGGTCTTTCCTGG - Intergenic
1185645240 X:1610959-1610981 CTGGCAGAGACGGTCTTTCCTGG + Intergenic
1198913907 X:141644922-141644944 CCTCCTCAGAAGGTCTTTCCTGG - Intronic
1201910207 Y:19126019-19126041 CCGGCTCTGCAGATCTTCCCCGG - Intergenic