ID: 1093656120

View in Genome Browser
Species Human (GRCh38)
Location 12:21695589-21695611
Sequence AACCCCGAGCTGGAATAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 7, 3: 34, 4: 142}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093656114_1093656120 9 Left 1093656114 12:21695557-21695579 CCTGAACTGCTGAGACAGACTCA 0: 1
1: 0
2: 4
3: 27
4: 255
Right 1093656120 12:21695589-21695611 AACCCCGAGCTGGAATAAATGGG 0: 1
1: 0
2: 7
3: 34
4: 142
1093656113_1093656120 10 Left 1093656113 12:21695556-21695578 CCCTGAACTGCTGAGACAGACTC 0: 1
1: 1
2: 2
3: 40
4: 321
Right 1093656120 12:21695589-21695611 AACCCCGAGCTGGAATAAATGGG 0: 1
1: 0
2: 7
3: 34
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093656120 Original CRISPR AACCCCGAGCTGGAATAAAT GGG Intronic
902131620 1:14266606-14266628 GACCCTGAACTGGAATAAATGGG - Intergenic
904021973 1:27473810-27473832 GACCCTGAACTGGAATAATTAGG - Intronic
907107676 1:51899053-51899075 AACACTGACCTGGAATAATTGGG - Intergenic
909500949 1:76335326-76335348 ACGGCTGAGCTGGAATAAATGGG - Intronic
910737353 1:90474437-90474459 AACCCAAAGCTGACATAAATTGG + Intergenic
913267722 1:117060816-117060838 AACCCAGAGCTGGAAAACACCGG - Intronic
914360229 1:146928945-146928967 ATCTCAGAGCTGTAATAAATTGG - Intergenic
914493519 1:148170952-148170974 ATCTCAGAGCTGTAATAAATTGG + Intergenic
916520534 1:165559868-165559890 AACCCTGAACTGAAATAATTAGG - Intronic
918861536 1:189832674-189832696 AACCCTGAACTGGAATAAGAAGG - Intergenic
919143988 1:193609729-193609751 AAGCCCAAGCTGGAGTCAATAGG - Intergenic
921342373 1:214146876-214146898 GACCCCGAGCTGGCCAAAATAGG + Intergenic
921617908 1:217293039-217293061 AACCCTGAACTGGAATAAGCAGG + Intergenic
921856731 1:219994373-219994395 AACCCTGAACTAGAATAAATGGG + Intronic
924183024 1:241458336-241458358 GACCCTGAACTGGAATGAATGGG - Intergenic
924489302 1:244519700-244519722 AACCCTGAACTGGAATAAGCAGG + Intronic
924507563 1:244700217-244700239 AACCTCGAGGTGGAAAAACTGGG + Intronic
1064317428 10:14271306-14271328 AACCCGGACCTGGAATAATGGGG - Intronic
1066195172 10:33092070-33092092 GACTCTGAACTGGAATAAATGGG + Intergenic
1068894301 10:62182651-62182673 AACCCTCATCTGGAATAATTGGG - Intergenic
1072553449 10:96496355-96496377 AACCCTTAGCTGGAACAAATGGG - Intronic
1074660936 10:115656591-115656613 CACCCTGAACTGGAATAAGTTGG + Intronic
1078583746 11:12561829-12561851 GACCCTGAACTGCAATAAATGGG - Intergenic
1083347444 11:62003420-62003442 AACCCCAGGCTGGAAAAAGTGGG + Intergenic
1085213457 11:74804293-74804315 AACCCTGAACTGGAATAAATAGG + Intronic
1085561721 11:77477951-77477973 AACCCTGAACTGGAAAAATTGGG - Intergenic
1086521170 11:87669375-87669397 AGCCAGGAGCTTGAATAAATAGG + Intergenic
1088404577 11:109459342-109459364 AACCCTGAACTGGAATAACTGGG + Intergenic
1089048322 11:115523562-115523584 AACCCTGTTCTGGAATTAATAGG + Intergenic
1090267251 11:125360974-125360996 AGCCCAGAGCTGGAAACAATGGG - Intronic
1092282008 12:7104689-7104711 GACCCCAAACTGGAATAATTGGG + Intronic
1093656120 12:21695589-21695611 AACCCCGAGCTGGAATAAATGGG + Intronic
1094695922 12:32818712-32818734 GAACCCAAGCTGAAATAAATAGG - Intronic
1095606338 12:44072128-44072150 AATGCCAAACTGGAATAAATGGG - Intronic
1095658274 12:44697238-44697260 AACCCTGAACTGAAATAAGTGGG - Intronic
1098141621 12:67455567-67455589 GACCCTGAACTGGAATAACTGGG + Intergenic
1098730805 12:74035383-74035405 ACCCCCTAGCTAGAATAAATAGG - Intergenic
1100452025 12:94716404-94716426 AACCCTGAACTGGAATAACTGGG - Intergenic
1101608632 12:106269965-106269987 AACCTTGAACTGGAATAATTGGG - Intronic
1104646670 12:130502390-130502412 AACCCGGATTGGGAATAAATTGG - Intronic
1106577423 13:30988415-30988437 AACCCCAAACTGGCACAAATTGG - Intergenic
1108347234 13:49558326-49558348 AACCCTGAACTGGAACAAACGGG + Intronic
1109613219 13:64793899-64793921 AACCCTGAAATGGAATAATTGGG + Intergenic
1109690271 13:65879187-65879209 AACCCTGAACTGGAGTAACTGGG - Intergenic
1109874461 13:68381998-68382020 GACCCCGAACTGGACTAAATGGG - Intergenic
1112979765 13:105368845-105368867 AACCCCAAGATGGAATACAATGG + Intergenic
1116053240 14:39831302-39831324 AACCCTGAATTGGAATAAGTAGG - Intergenic
1118403155 14:65397716-65397738 GATCCTGAACTGGAATAAATGGG + Intergenic
1120152182 14:81048589-81048611 GACCCTGAGCTGGAATAAGCAGG + Intronic
1123027356 14:105432993-105433015 AACCCCGTGCTGTAATATAGGGG + Intronic
1126341755 15:47648452-47648474 AACCCTGAACTGGAATAACTGGG + Intronic
1126992633 15:54399703-54399725 AACCCCGAGAGGGGAAAAATAGG - Intronic
1127253327 15:57265489-57265511 GACCCTGAACTGGAATAATTGGG + Intronic
1129567194 15:76635139-76635161 GACCCTGAACTGGAATAATTGGG - Intronic
1131425162 15:92340139-92340161 AACCCCAAACCTGAATAAATTGG - Intergenic
1132410103 15:101571129-101571151 CACCCTGATCTGGAATAATTGGG - Intergenic
1137235263 16:46611245-46611267 AACCCTGAACTGGAATAAGCAGG + Intronic
1138955287 16:61964267-61964289 AACCCTGAACTGGAATAATTGGG - Intronic
1139203271 16:65001130-65001152 ACCCCCGAGCTGAAATAATTGGG - Intronic
1143839151 17:9717729-9717751 GATCCTGAGCTGGAATAAGTGGG + Intronic
1144116818 17:12102943-12102965 AACCTCTAGCTGGACTAATTGGG - Intronic
1154054888 18:11003558-11003580 AACCCTGAACTAGAATAAGTGGG - Intronic
1155293126 18:24360902-24360924 ACACCTGAACTGGAATAAATGGG + Intronic
1157274946 18:46303852-46303874 CACCACGAGCTGGAAGAGATGGG + Intergenic
1159475399 18:68914422-68914444 GACCCTGAACTGGAATAAACAGG + Intronic
1159667916 18:71185926-71185948 GACCCTGAACTGGAATAACTGGG + Intergenic
1160626572 18:80212310-80212332 AACCATGAACTGGAATAAACAGG + Intronic
1165192481 19:34076561-34076583 AACCCTGAACTGGAATAACTGGG + Intergenic
925985931 2:9214610-9214632 CAACCCGAGCTGGAATACTTGGG + Intronic
926005780 2:9372692-9372714 GACCCTGAACTGGAATAAGTGGG - Intronic
928186876 2:29118300-29118322 AACACAGAGCAGTAATAAATGGG - Intronic
931294862 2:60912240-60912262 GACCCTGAACTGGAATAATTGGG + Intronic
934694658 2:96390770-96390792 AGCCCCAGGCTGGAATGAATTGG - Intergenic
935586890 2:104808824-104808846 AAGCCTGAGATGGAATAAAATGG - Intergenic
938585898 2:132690363-132690385 AACCCTGAGCTGGAATAATTGGG + Intronic
938786844 2:134637446-134637468 AACCTAGAACTAGAATAAATGGG + Intronic
938979831 2:136515654-136515676 AACTCTGAACTGGAATAAATGGG + Intergenic
941314772 2:163978743-163978765 TACCCTGAACTGGAATAACTGGG + Intergenic
941978736 2:171433025-171433047 GACCCTGAACTGGAATAATTAGG - Intronic
942894601 2:181036692-181036714 TACCCTGAACTGGAATAAGTGGG + Intronic
944762943 2:202836021-202836043 AACTCCTAGCTAGAATAATTAGG - Intronic
947987803 2:234463787-234463809 AACACCGAGGTGGCATAAGTAGG - Intergenic
948130686 2:235598294-235598316 CACCCTGAACTGGAATAATTGGG + Intronic
948934933 2:241157674-241157696 AACCCCGAGGAGGAACCAATGGG - Intronic
1170050105 20:12132921-12132943 AACCCAGATATGGAATATATAGG - Intergenic
1175938795 20:62527831-62527853 CACCCTGAACTGGAATAAGTGGG - Intergenic
1176907647 21:14522787-14522809 AACCCTGAGCTGGAATAACTGGG - Intronic
1177032869 21:16004592-16004614 AACCCTGAACTGAAATAAATGGG - Intergenic
1178267483 21:31157513-31157535 GATCCTGAGCTGGAATAAGTGGG - Intronic
1182605763 22:31502054-31502076 GACCCTGAACTGGAATAAGTGGG + Intronic
1182900065 22:33890284-33890306 AACCCTAAGATGGAATAAACAGG - Intronic
1185039920 22:48498598-48498620 AACCCTGAACTGGGAGAAATTGG - Intronic
950731656 3:14964862-14964884 CACCCTGAACTGGAATAAGTGGG - Intronic
951328653 3:21337957-21337979 AGCCCTGAACTGGAATAATTGGG - Intergenic
951354205 3:21644300-21644322 GACCCTGAGCTGGAATAACTGGG - Intronic
951734516 3:25849426-25849448 GACCCTGAACTGGAATAATTGGG + Intergenic
952756048 3:36868111-36868133 AACACTGAACTGGAATAACTCGG + Intronic
953540407 3:43813024-43813046 CACACCAAGATGGAATAAATGGG + Intergenic
956044099 3:65176637-65176659 AACCCTGAGCTGAATTTAATAGG - Intergenic
956578254 3:70780344-70780366 AACCCTGAGCTGGAATAACTGGG - Intergenic
961261049 3:125602241-125602263 AACCCGCAGCTGGAATGAATGGG + Intergenic
961964582 3:130889027-130889049 AACCCGGAACTGGAATAATTGGG - Intronic
964807244 3:160624404-160624426 AACCCTGAACTGGAATGAGTGGG - Intergenic
964839568 3:160979250-160979272 AACCCTGAACTGGAATAAGTGGG - Intronic
966612766 3:181884438-181884460 CACCCTGAACTGGAATAAATGGG - Intergenic
968092317 3:195907108-195907130 AACGCCGACCTGAAATAAGTAGG + Intronic
971428591 4:26540252-26540274 ATACCCCAGCTGGAATAAAAAGG - Intergenic
972402497 4:38718507-38718529 AACTCAGAGCTGGAATAATAAGG + Intergenic
973110971 4:46397442-46397464 CAGGCCGAGCTGGAATAAAAAGG - Intronic
975440465 4:74404475-74404497 TACCCTGAACTGGAATAAGTGGG + Intergenic
975626091 4:76348508-76348530 AACCCCAAGGTGGAACCAATGGG - Intronic
976002632 4:80389320-80389342 AACCCAGAGATGGAGTAAGTTGG - Intronic
976892700 4:90069357-90069379 AACCCTAAGGTGGAATGAATTGG - Intergenic
979181247 4:117730441-117730463 GACCCTGAACTGGAATAAATGGG - Intergenic
981660853 4:147164761-147164783 AACCCTGAGCTGGAATAACTGGG + Intergenic
981952399 4:150424489-150424511 AACCCTGAAGTGGAATAAATGGG - Intronic
983184805 4:164689611-164689633 CACTCCCAGCTGGAATAAGTAGG - Intergenic
983467884 4:168117784-168117806 AACCCTGAAGTGGAATAAGTTGG - Intronic
983864457 4:172748188-172748210 ATCCCTGAACTGGAATAAACAGG - Intronic
984253747 4:177365354-177365376 AACCCAGAACTGGAATAAGTGGG + Intergenic
984494329 4:180475383-180475405 AACCCTGAACTGGAATAAGCAGG + Intergenic
984792157 4:183624847-183624869 GACCCTGAGCTGGAATAAGCAGG + Intergenic
985853459 5:2406171-2406193 AACCCTGAACTGAAATAATTGGG + Intergenic
987418014 5:17684666-17684688 GACCCTGAGCTGGAATAATTGGG + Intergenic
988273051 5:29042211-29042233 GACCCTGAGCTAGAATAATTGGG - Intergenic
988919539 5:35927575-35927597 AAGCCCGAGCTAGAAGAAATAGG - Intronic
990412347 5:55553489-55553511 AACCCTGAACTGGAATAAATGGG + Intergenic
990547735 5:56839870-56839892 GACCCTGAACTGGAATAAGTGGG + Intronic
992285437 5:75230239-75230261 AACCCTGAAGTGGAATAACTGGG + Intronic
992286319 5:75239240-75239262 AACCCTGAACTGGAATGACTAGG - Intergenic
993383420 5:87233973-87233995 AACCCTGAACTGGAATAAGCAGG + Intergenic
995105208 5:108369934-108369956 AACCCTGAACTGGAATAACTGGG - Intronic
999844238 5:155460857-155460879 TACCCTGAGCTGGAATCATTGGG - Intergenic
1000790637 5:165602591-165602613 GCCCCTGAACTGGAATAAATGGG + Intergenic
1001207871 5:169781000-169781022 GACCCTGAACTGGAATAAGTGGG - Intronic
1002295419 5:178228095-178228117 AACCTCGAGTTGGAACACATGGG + Intronic
1004160274 6:13206646-13206668 CACCCGGAACTGGAATAATTGGG - Intronic
1006282157 6:33062146-33062168 AACACTGAGCTGTAATAAATTGG - Intergenic
1006827589 6:36947609-36947631 GACCCTGAACTGGAATAATTGGG - Intergenic
1006968052 6:38010124-38010146 CACCCTGAGCTGGAATAACTGGG - Intronic
1007799961 6:44383999-44384021 AACCCTGAACTGGAATAAGCGGG - Intergenic
1009481936 6:64169946-64169968 AACCCCTTGCTTGGATAAATAGG + Intronic
1009661940 6:66624715-66624737 GACCCCGAACTGGAATAGATGGG - Intergenic
1010319783 6:74492284-74492306 AAACCCCAACTGAAATAAATTGG + Intergenic
1010375223 6:75160992-75161014 GACCCTTAACTGGAATAAATGGG - Intronic
1010943406 6:81946951-81946973 AATCCTGAACTGGAAAAAATAGG - Intergenic
1011025130 6:82860462-82860484 AACCCTGAACTGGAGTAAGTGGG - Intergenic
1014261158 6:119218837-119218859 AACCTTGAACTGGAATAACTGGG + Intronic
1014300204 6:119672328-119672350 AACCACAAGGTGGTATAAATTGG - Intergenic
1015995484 6:138992072-138992094 AACCCCGAAATGGAATAAGTAGG - Intergenic
1017344279 6:153361731-153361753 AACCCTGAACTGGAATAATTGGG + Intergenic
1018816065 6:167332222-167332244 AACCCCGTGCTGTAACAAACAGG - Intronic
1021136604 7:16972021-16972043 CACCCTGAACTGGAATAAGTAGG + Intergenic
1022037452 7:26548148-26548170 AACCCCAAGCTGGAAGCAAAGGG - Intergenic
1023953431 7:44866628-44866650 AACCCTGAACTGGAATAAATGGG - Intergenic
1024371085 7:48584643-48584665 AACCCTGAACTGGAATAATTGGG + Intronic
1026299634 7:69086104-69086126 AACCCTGAACTGGAATGAGTCGG - Intergenic
1029941666 7:104487352-104487374 GACCCTGAGCTGGAATAATTTGG - Intronic
1033051915 7:138012795-138012817 AACCCTGTGTTGGAATAAAAGGG - Intronic
1037471889 8:19218583-19218605 ATCCCCAAGTTGGAAAAAATGGG - Intergenic
1038274087 8:26105356-26105378 GACCCTGAGCTAGAATAAGTGGG + Intergenic
1039997125 8:42543035-42543057 AACCCCTAGTTGTAATATATTGG + Intronic
1041457793 8:58078981-58079003 AACACCGAGTTGGAAAAAAAAGG - Intronic
1042058224 8:64788622-64788644 GACCCTGAACTGGAATAATTGGG + Intronic
1042097453 8:65232844-65232866 AACCCTGAACGGGAATAATTTGG + Intergenic
1042887189 8:73565029-73565051 AATCCTGAACTGGAATAAGTGGG + Intronic
1043317747 8:78942198-78942220 GACCCTGAACTGGAATAATTGGG + Intergenic
1044323885 8:90838438-90838460 AACCCTGAACTGGAGTAAGTGGG - Intronic
1046376151 8:113383818-113383840 AAACCAGAGTTGGAATAAAAAGG - Intronic
1049130529 8:140836040-140836062 GACCCTGAACTGGAATAACTGGG + Intronic
1050307203 9:4316749-4316771 AACCCTGAACTGGAATAAGCTGG + Intronic
1053246373 9:36537887-36537909 AACCTTGAACTGGAATAAGTGGG - Intergenic
1056946048 9:90997796-90997818 AACCCTGAACTGGAATAAGCAGG + Intergenic
1057342549 9:94215676-94215698 AACCCTGAACTGGAATAAGCAGG + Intergenic
1058913899 9:109546914-109546936 AACCCTGAGCTGAAATAATTGGG - Intergenic
1059605887 9:115835378-115835400 GACCCTGAACTGGAATAATTGGG - Intergenic
1062683171 9:137795295-137795317 AACCCTGACCTGGAATAACTGGG - Intronic
1187569922 X:20490411-20490433 AACCCTCAGGTGGAATAACTTGG + Intergenic
1187716803 X:22110797-22110819 AACCCTGAACTAGAATAACTGGG - Intronic
1189166595 X:38867054-38867076 GACCCTGAACTGGAATAAGTAGG - Intergenic
1195770580 X:108347079-108347101 AACCCTGAGCTGGAATTAGCGGG - Intronic
1196365717 X:114921449-114921471 GACCCTGAACTGGAATAATTAGG + Intergenic
1197827295 X:130603423-130603445 AACCCTGAACTGGAATAAACCGG + Intergenic
1199456419 X:148034218-148034240 AACCCTAAACTGGAATAAGTAGG + Intergenic