ID: 1093658042

View in Genome Browser
Species Human (GRCh38)
Location 12:21720313-21720335
Sequence GTTCCCACCATTAGATGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 68}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093658042 Original CRISPR GTTCCCACCATTAGATGAGC AGG (reversed) Intronic
903223709 1:21883246-21883268 GTGGCCACCATTTGGTGAGCAGG - Intronic
905302011 1:36991949-36991971 GTTCCCAGCAGTAGATGGGCTGG + Intronic
914346732 1:146806447-146806469 TTTGCCCCCCTTAGATGAGCTGG - Intergenic
921551649 1:216543700-216543722 GTATCCACCATCAGATGAACAGG + Intronic
1063159079 10:3406807-3406829 GTTACCACCATGTGATCAGCTGG + Intergenic
1064148647 10:12844608-12844630 GTAGACACCATTAGAAGAGCTGG + Intergenic
1076773886 10:132682360-132682382 GTACCCACCTTCAGGTGAGCAGG - Intronic
1078542464 11:12222859-12222881 GGTCCCACCATTAGGCCAGCAGG - Intronic
1085523191 11:77150040-77150062 AGTCCCACCCTTAGGTGAGCAGG + Intronic
1093658042 12:21720313-21720335 GTTCCCACCATTAGATGAGCAGG - Intronic
1094068327 12:26385090-26385112 GTTCCTCCCTTTAGATGAGGAGG + Intronic
1096332106 12:50722627-50722649 GTCCCCACCATTACATGCCCAGG + Intronic
1098303429 12:69077949-69077971 GTTCTCACCATGTGATGTGCTGG - Intergenic
1103440512 12:120959409-120959431 GTTCCAACCTCCAGATGAGCTGG + Intergenic
1109595186 13:64543709-64543731 GTTACAAACATTAGATGAACAGG + Intergenic
1115616409 14:35099327-35099349 GTTGCCACAATTAGATGGTCTGG - Exonic
1128332747 15:66766494-66766516 GTTCTCAGCATTAAATGAGATGG + Intronic
1130760580 15:86815302-86815324 GTTGCCAGAATTAGATGAGTTGG + Intronic
1137530310 16:49275269-49275291 GCTTCCACCATTAGCCGAGCTGG - Intergenic
1139558990 16:67729877-67729899 GTTCCCACCACCAGCTGAGAGGG + Intronic
1139987249 16:70908823-70908845 TTTGCCCCCCTTAGATGAGCTGG + Exonic
1146695127 17:34903098-34903120 GTTCCCAGCATAAAATGAGGAGG + Intergenic
1152647208 17:81474941-81474963 TTTCCCCCCAGGAGATGAGCTGG - Intergenic
1153810188 18:8745658-8745680 GTTCCCAGGAGTAGATGTGCAGG + Intronic
1156092789 18:33491734-33491756 GCTCCCACTTTTAGAAGAGCAGG - Intergenic
1156428830 18:37047874-37047896 GCTGCCACCTTGAGATGAGCGGG - Intronic
1160671210 19:364635-364657 CTTACCACCATGACATGAGCAGG - Intronic
925762912 2:7203986-7204008 GTTTCTACCCTTAGCTGAGCGGG - Intergenic
936928240 2:117760009-117760031 ATTTCCACTATTAGATGTGCTGG + Intergenic
942570961 2:177313808-177313830 GCTCCTACCATTAGAAGGGCTGG + Intronic
942570969 2:177313857-177313879 GCTCTTACCATTAGAAGAGCTGG - Intronic
943744018 2:191442163-191442185 GTTCCCACAATTCAGTGAGCTGG + Intergenic
944322106 2:198358309-198358331 TGTCCCACCATAAGATGAGGAGG - Intronic
947291878 2:228584772-228584794 GTTCTAACCATTAGAAGAGCTGG - Intergenic
948655854 2:239476353-239476375 ATTCCCAGCATCAGAGGAGCTGG + Intergenic
948960940 2:241336599-241336621 GTTTCCACCACTAGATGAAAAGG + Intronic
1170929162 20:20753364-20753386 GTTCCCACTATTACAGGAGCTGG + Intergenic
950967289 3:17155101-17155123 GTTTCTACCATTTGCTGAGCAGG + Intergenic
961035667 3:123639818-123639840 ATTCTCACCATGAGGTGAGCAGG - Intronic
970445653 4:16121345-16121367 GTCCCCACCCTGAGTTGAGCAGG - Intergenic
974300366 4:60058329-60058351 GTTGCTACAATTAGCTGAGCTGG - Intergenic
975331823 4:73124689-73124711 ATTCCTACTTTTAGATGAGCAGG + Intronic
983518342 4:168679603-168679625 GTGCACACCATTAGATGTGCAGG + Intronic
984041453 4:174739704-174739726 GTTCCCACATTTCTATGAGCAGG + Intronic
985892697 5:2728079-2728101 CTTCCCACCATCGAATGAGCAGG + Intergenic
987075615 5:14379423-14379445 GTTCCCAGAGTTAGATGAACTGG + Intronic
990374327 5:55154175-55154197 GTTTCCACCCTTGGATGTGCTGG - Intronic
994966744 5:106682389-106682411 TTTCCCACCATTATATGCACAGG + Intergenic
1000234578 5:159345542-159345564 GTGCCTACCACCAGATGAGCAGG - Intergenic
1000268087 5:159657507-159657529 AATGCCACCATCAGATGAGCTGG + Intergenic
1004205528 6:13588414-13588436 GTTCCGACCTTCAGAGGAGCTGG + Exonic
1005587240 6:27288626-27288648 GTCCCCACCTTGAGCTGAGCCGG - Intronic
1007059814 6:38927660-38927682 GTTCCAAGAATAAGATGAGCAGG - Intronic
1008981081 6:57484910-57484932 GTTTCCACCATTAGAAGACAGGG + Intronic
1009034567 6:58100623-58100645 GTTCCCAACATTAGAGCAACAGG + Intergenic
1009169175 6:60377872-60377894 GTTTCCACCATTAGAAGACAGGG + Intergenic
1009210046 6:60851118-60851140 GTTCCCAACATTAGAGCAGCAGG + Intergenic
1011309686 6:85968334-85968356 TCTCCCACCATTAAATGAGATGG - Intergenic
1020680219 7:11227624-11227646 GATGCAACCCTTAGATGAGCAGG - Intergenic
1022948954 7:35317245-35317267 ATTCCCACAACTAGAGGAGCAGG - Intergenic
1024180576 7:46889373-46889395 GTTCCCCCCAATAGATGCTCAGG + Intergenic
1028896578 7:96048335-96048357 GTCCCCACCATTACTAGAGCAGG + Intronic
1036676339 8:10837085-10837107 GTTCCCACCATTCGCAGAACTGG + Intronic
1038663437 8:29517005-29517027 GTTCCCACCTTTAAATGCTCAGG - Intergenic
1040481758 8:47833268-47833290 GTTCCTACGATTAGATAAGAAGG + Intronic
1042661909 8:71163877-71163899 ATTCCCACCACAAGATGAGAAGG + Intergenic
1058757588 9:108097608-108097630 GCTTCCACCATAACATGAGCAGG - Intergenic
1059071508 9:111142191-111142213 GTTCCCACCATTTGCAGAACTGG - Intergenic
1060174786 9:121489576-121489598 GTTACCACCACTTGAGGAGCTGG - Intergenic
1185938575 X:4287635-4287657 GTTCCTACTATTTGATCAGCTGG - Intergenic
1186516759 X:10172022-10172044 GTTCCCACCATTCCCAGAGCTGG - Intronic
1188064496 X:25641839-25641861 GTTCCCAGCAGCAGATGAACAGG - Intergenic
1190175323 X:48144111-48144133 ATTCACACCCTTAGATCAGCAGG + Intergenic
1191258344 X:58289513-58289535 GTTCCCCCCATGAGATCGGCAGG - Intergenic
1194165329 X:90507939-90507961 GTTCCCAGCAGTGGATGAGCAGG - Intergenic
1200511598 Y:4085749-4085771 GTTCCCAGCAGTGGATGAGCAGG - Intergenic