ID: 1093659187

View in Genome Browser
Species Human (GRCh38)
Location 12:21734976-21734998
Sequence CAACCATGGTGGAGACAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 544
Summary {0: 1, 1: 5, 2: 38, 3: 135, 4: 365}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093659187 Original CRISPR CAACCATGGTGGAGACAGTG TGG Intronic
900356161 1:2265391-2265413 TAACCGTGGAGGAGACATTGTGG - Intronic
901436971 1:9252897-9252919 CAACCAGGGTGGACACTGGGAGG - Intronic
902650035 1:17831156-17831178 CAACCATGGGGGTGGCAGTGGGG - Intergenic
905319760 1:37107526-37107548 GCACCATGGTGGGGACTGTGTGG + Intergenic
905321184 1:37118600-37118622 GAGCCAGGGTGGAGACAGTGTGG + Intergenic
905409421 1:37757992-37758014 GATCCAGGGTGGAGACAGAGGGG - Intronic
906844872 1:49181071-49181093 CAGTCATGGTGGAGGCAGGGAGG + Intronic
907501091 1:54881557-54881579 CAACCATGTGGGAGACAGTGTGG + Intronic
907532547 1:55115586-55115608 CAATCATTGTGGAGACAGTGTGG + Intronic
907806577 1:57826544-57826566 CATCCATGGTGCACAGAGTGGGG - Intronic
908610685 1:65856752-65856774 CAACCATGCGGAAGACAATGTGG - Intronic
909772806 1:79445491-79445513 CAACCATGTGGAAGACAGTGTGG + Intergenic
910068942 1:83187607-83187629 CAACCATGTGGAAGTCAGTGTGG + Intergenic
911402873 1:97398518-97398540 CAACCATTGTGAAGTCAGTGTGG - Intronic
911424343 1:97687545-97687567 CAACCATGTGGAAAACAGTGTGG + Intronic
912007871 1:104926969-104926991 CAACCTTTGTGGAAAGAGTGTGG - Intergenic
912008270 1:104930842-104930864 CAACCATGGAGGAGTCAGAAGGG + Intergenic
912235188 1:107843683-107843705 AAAACTTGGTGCAGACAGTGTGG - Intronic
913108156 1:115634049-115634071 CAACCATGTGGAAGACAGTGTGG - Intergenic
913295482 1:117315386-117315408 CAACCATGTGGAAGTCAGTGTGG - Intergenic
913682569 1:121200409-121200431 CAAACCTGGGGGAGGCAGTGTGG + Intronic
914034412 1:143988038-143988060 CAAACCTGGGGGAGGCAGTGTGG + Intergenic
914155038 1:145079932-145079954 CAAACCTGGGGGAGGCAGTGTGG - Intronic
915011345 1:152689015-152689037 CACCCATGTGGGAGACAGTGTGG - Intergenic
915718465 1:157965993-157966015 TAACCTTTGGGGAGACAGTGAGG - Intergenic
915743964 1:158141948-158141970 CCACCTTGCTGCAGACAGTGGGG - Intergenic
916460197 1:165015944-165015966 CAACAATTGTGAAGTCAGTGTGG - Intergenic
916625059 1:166546695-166546717 CAACCATTGTGGAGACAGTGTGG - Intergenic
916637257 1:166685890-166685912 CAACCATTGTGGAAGAAGTGTGG - Intergenic
917682296 1:177379488-177379510 CAACCGTGTGGAAGACAGTGTGG - Intergenic
917880809 1:179333955-179333977 CAACCATGGCGGAGCCAGAGGGG + Intronic
918171968 1:182005886-182005908 CAACCATGTGAAAGACAGTGTGG - Intergenic
919819079 1:201461671-201461693 GAACCATGGTGGACCCACTGAGG + Intergenic
919839782 1:201600370-201600392 GAAGCATGGTGGAGACAGGCTGG + Intergenic
920469881 1:206218927-206218949 CAAACCTGGGGGAGGCAGTGTGG + Intronic
921628012 1:217400014-217400036 CAACCATCCTGATGACAGTGAGG - Intergenic
922339488 1:224643985-224644007 CAACCCTGGTGGATCTAGTGGGG + Intronic
922738407 1:228002157-228002179 CAACAAAGGTGGAGACGGGGCGG + Intergenic
922752980 1:228079593-228079615 CAACCATGTTGGAGACAGAGTGG + Intergenic
924037219 1:239949754-239949776 CATCCATGGAGGAGACCGAGGGG - Intergenic
924237442 1:242011085-242011107 CAATGATGGTGAAGACTGTGGGG - Intergenic
924396644 1:243628338-243628360 CAACCAGGCTGAATACAGTGGGG + Intronic
924690765 1:246347848-246347870 CAGCCACTGTGGAGACAGTTTGG + Intronic
924874007 1:248080846-248080868 CAACCAGTGTGAAGACAGTGTGG - Intronic
1063674013 10:8123693-8123715 CAACCTTCCTGAAGACAGTGAGG - Intergenic
1063971727 10:11385766-11385788 CAAACATGGTGGGGACAGGGGGG + Intergenic
1066707089 10:38192381-38192403 CAACCTTTGTGGAGACAGTGTGG + Intergenic
1066709843 10:38221818-38221840 CAACCATTGTGAAGACAGTGTGG + Intergenic
1066788118 10:39028524-39028546 CAACCATGTGGAAGTCAGTGTGG + Intergenic
1066982603 10:42432295-42432317 CAACCATTGTGGAGACAGTGTGG - Intergenic
1067193850 10:44096474-44096496 CAACCATGTGGAAGACAGTGTGG + Intergenic
1068462523 10:57345977-57345999 CAACCATGTGGAAGACAGTGTGG - Intergenic
1068535323 10:58235235-58235257 CAACCATGTGGAAGACAGTGTGG + Intronic
1068855866 10:61796647-61796669 AAACCAAGGTGGTTACAGTGTGG - Intergenic
1069943053 10:71968570-71968592 CTGGCATGGTGGAGACAGGGTGG - Intronic
1071141404 10:82513519-82513541 CAACCATTGGAAAGACAGTGTGG - Intronic
1072776954 10:98207371-98207393 CAACCATGGTGGAGGTTGTCAGG + Intronic
1073556694 10:104460022-104460044 CAACGATTGTGTAGACAGTGTGG - Intergenic
1073733442 10:106318824-106318846 CAACCATGGTGAAGATAGTGTGG + Intergenic
1074535201 10:114324150-114324172 CAACCATGGGGGAGAAAAAGAGG + Intronic
1076473169 10:130734397-130734419 TACCCATGGTGGTGACAGTGAGG + Intergenic
1076537688 10:131192429-131192451 CAACCCTGATGGAAACAGTATGG + Intronic
1079373900 11:19874663-19874685 CACCCATGGTAGAAACTGTGTGG + Intronic
1079877467 11:25877674-25877696 CAACCATGTGGAAGACAGTGTGG - Intergenic
1080332085 11:31150721-31150743 CAATTATGTTGGAGAAAGTGTGG - Intronic
1080398290 11:31910395-31910417 CAACCATTGTGGAACCAGTGTGG + Intronic
1080964343 11:37196562-37196584 CACCCTTTGTGGAGGCAGTGAGG - Intergenic
1081081115 11:38740319-38740341 CAACCATGTAGAAGACAGTGTGG - Intergenic
1081323892 11:41722315-41722337 CAACCATTGTAGAGACAGTGTGG - Intergenic
1081469215 11:43353986-43354008 CAGACATGGTGGAGCCAGTTTGG + Intergenic
1082151463 11:48745206-48745228 CAACCATTGTGAAGTCAGTGTGG - Intergenic
1083511384 11:63212236-63212258 CAACCATGTGGAAGACAGTGTGG + Intronic
1083661000 11:64251696-64251718 CCACCGTGGTGGAGACCCTGCGG + Exonic
1084461817 11:69300429-69300451 CCACCATCCTGGAGACAGAGAGG + Intronic
1085397389 11:76213482-76213504 AAACCTTGGTGGAGATGGTGGGG + Intergenic
1085672795 11:78484802-78484824 CAACCACTGCGAAGACAGTGTGG + Intronic
1086328752 11:85732161-85732183 CAACTGTTGTGAAGACAGTGTGG + Intronic
1086497017 11:87414849-87414871 CAACCATTTGGAAGACAGTGTGG + Intergenic
1086564018 11:88203807-88203829 CAACCATGGGGGAAAAAATGAGG + Intergenic
1086736215 11:90308319-90308341 CAACCATTGTGGAAGCAGTGTGG + Intergenic
1086962792 11:92996881-92996903 CAACCATGGGGAAGACAGTATGG - Intergenic
1087083050 11:94190229-94190251 CAACCACTGTGGAGACAATGTGG - Intergenic
1087447811 11:98276962-98276984 GAATCATGGTGGGCACAGTGGGG - Intergenic
1087627270 11:100609565-100609587 CAACCATGTGGAAGACAGTGTGG + Intergenic
1089179843 11:116575691-116575713 CAACCATTGTGGAGTCAGTGTGG + Intergenic
1089245035 11:117112890-117112912 CAACCATGTGGAAGACAGTGTGG + Intergenic
1090382024 11:126334055-126334077 GAACCAAGGTAGGGACAGTGGGG + Intronic
1092451640 12:8607747-8607769 AGATCATGGTGGTGACAGTGTGG - Intronic
1092516946 12:9224728-9224750 CAACCATTGTGAAGACAGTGTGG - Intergenic
1092684111 12:11022110-11022132 TAACCATGGATGAGAGAGTGTGG - Exonic
1093659187 12:21734976-21734998 CAACCATGGTGGAGACAGTGTGG + Intronic
1095509865 12:42939084-42939106 CAACCATGTGGAAGACAGTGTGG - Intergenic
1095538083 12:43276101-43276123 CAACCATTGTGAAGACAGTGCGG + Intergenic
1096619676 12:52856021-52856043 CAACCTTGTGGAAGACAGTGTGG + Intergenic
1096812251 12:54178550-54178572 AAACCATGTAGGAGGCAGTGTGG - Intronic
1098528889 12:71518418-71518440 CAACCATTGTGAAGACAGTGTGG + Intronic
1099059316 12:77886348-77886370 CATACATTGTGGTGACAGTGGGG - Intronic
1099143912 12:79014630-79014652 CAACCATGTGGAAGTCAGTGTGG + Intronic
1099528309 12:83742740-83742762 CAACCATTGTGGAGACAGTGTGG + Intergenic
1099727162 12:86446714-86446736 TAGCCATGGTGGAAAGAGTGTGG + Intronic
1100665278 12:96745259-96745281 CAACCACTGTGGAGACAGTGTGG - Intronic
1100676225 12:96871071-96871093 CAACAAGGAGGGAGACAGTGTGG + Intronic
1101159937 12:101963461-101963483 TAACTATGATGGAGACAGTGAGG - Intronic
1101198360 12:102408688-102408710 CAAGTATGGTGGGGACATTGAGG + Intronic
1102855722 12:116291667-116291689 CACCCAGGCTGGAGTCAGTGGGG + Intergenic
1105430269 13:20330818-20330840 CAACCATTGTGGAAACATTATGG + Intergenic
1107328261 13:39268883-39268905 CCACCATGGTGGACCCAGCGGGG + Intergenic
1108099778 13:46942639-46942661 AAACCATTGTGGATATAGTGTGG + Intergenic
1108656599 13:52539052-52539074 CAACCATGTAGAAGACGGTGTGG + Intergenic
1110018750 13:70441987-70442009 CAACCATGTGGAAGACAGTGTGG - Intergenic
1110390227 13:74965008-74965030 CAACCATTGTGAAGACAGTGTGG + Intergenic
1111303261 13:86372544-86372566 CAACCATTGTGGAAACAGTGGGG - Intergenic
1111417535 13:87968490-87968512 CAAACATGGTGGAGAAAGAGAGG + Intergenic
1111698735 13:91659746-91659768 CGATCATGGTGGAGGCGGTGGGG - Intronic
1111699804 13:91672651-91672673 CAACCATGTGGAAGACAGTGTGG + Intronic
1112152435 13:96778738-96778760 CAACCATTGTGGAAGAAGTGTGG + Intronic
1112379334 13:98873628-98873650 CATCCATGCTGGAGCCAGTAGGG - Intronic
1112617126 13:101017325-101017347 CAACAATGGAGCAGACAGAGAGG - Intergenic
1113098330 13:106690128-106690150 CAACCATGTGGAAGAGAGTGTGG + Intergenic
1113432319 13:110261714-110261736 CTGCCCAGGTGGAGACAGTGAGG + Intronic
1114586677 14:23820982-23821004 CAACCATTGTGGAAACAGTGTGG - Intergenic
1114960330 14:27879450-27879472 CAACCATTGTGGAGACAGTGTGG - Intergenic
1115521600 14:34238368-34238390 CCACCATTGTGAAGACTGTGGGG + Intronic
1115886521 14:37977964-37977986 CAACTGTGTTGGAGAAAGTGGGG + Intronic
1116606663 14:47007082-47007104 CATCCATGGAGGATACATTGAGG + Intronic
1117238493 14:53803738-53803760 CAACCATGTGGAAGACAGTGTGG + Intergenic
1117981653 14:61347905-61347927 CAAGCTTGGCGGAGGCAGTGGGG + Intronic
1118117910 14:62802398-62802420 TTACCATGCTGGAGAAAGTGTGG - Exonic
1119520081 14:75278735-75278757 CAACCACGGTGGCGCCAGAGGGG - Intergenic
1120064054 14:80018937-80018959 CAAACATGTGGAAGACAGTGTGG - Intergenic
1120070429 14:80096658-80096680 CCACCATGTGGAAGACAGTGTGG + Intergenic
1121155281 14:91677626-91677648 CAGCCATTGTGGAGACAGTGTGG + Intronic
1122556206 14:102581751-102581773 GCCCCATGGTGGGGACAGTGGGG + Intergenic
1122662251 14:103304525-103304547 CAATTTTGTTGGAGACAGTGTGG - Intergenic
1122867331 14:104613100-104613122 CAACCATTGGGAAGACAGTGTGG - Intergenic
1123439979 15:20283155-20283177 CAGCCAAGTTTGAGACAGTGGGG + Intergenic
1126017174 15:44363612-44363634 CAACCATTGTGGAAGCAGTGTGG + Intronic
1126153571 15:45544662-45544684 CAACCATATGGGAAACAGTGTGG - Intergenic
1126784917 15:52170134-52170156 CAACCCTGTGGAAGACAGTGTGG + Intronic
1126919101 15:53500599-53500621 CAACCACTGTGGAAACAGTGTGG - Intergenic
1126929793 15:53634806-53634828 CAACCAAGGTGGTGCCAGTAGGG + Intronic
1127074861 15:55315822-55315844 CAACCATTGTGAAGACAGTGTGG + Intronic
1127489278 15:59447178-59447200 CAACCATCTTGGAGAGGGTGAGG - Intronic
1127654229 15:61041048-61041070 GAACCATAGGGGAGACAGTCAGG + Intronic
1127934996 15:63628578-63628600 CAACGATGCTGGATACAGTTGGG + Intronic
1128842303 15:70860071-70860093 CAGCCCTGGTGGAGCCGGTGCGG - Intronic
1131204926 15:90436039-90436061 CAAGCAGGGAGGAGACAGAGAGG - Intronic
1131931270 15:97444900-97444922 CAGTCTTGGTGGAGAGAGTGAGG - Intergenic
1132147087 15:99435437-99435459 CAGCGAGGGTGGGGACAGTGAGG - Intergenic
1134215367 16:12313053-12313075 CACCCAGGGTGGAGTGAGTGGGG + Intronic
1136845195 16:33571254-33571276 CAGCCATGTTTGAGACAGTGGGG - Intergenic
1137681368 16:50348825-50348847 CAACCATGTGGAAGACAGTGTGG + Intronic
1138152607 16:54672599-54672621 AAACCATGGTGGAATCATTGTGG - Intergenic
1138282616 16:55783679-55783701 CGACCATGTAGGGGACAGTGTGG - Intergenic
1138286328 16:55812941-55812963 CGACCATGTAGGGGACAGTGTGG + Exonic
1138804291 16:60076017-60076039 CACCCATTGTGAAGACAGTGTGG - Intergenic
1139208067 16:65048311-65048333 CAACCTTCGTGAAAACAGTGTGG + Intronic
1139671085 16:68492884-68492906 CAACCCAGGTGGAGCCAGTGGGG + Intergenic
1139878219 16:70163497-70163519 CAGCAGTGGTGGGGACAGTGAGG - Intergenic
1140359344 16:74331315-74331337 CAGCAGTGGTGGGGACAGTGAGG + Intergenic
1141544320 16:84754156-84754178 CAGCTACTGTGGAGACAGTGTGG + Intronic
1141568060 16:84916674-84916696 CAACCCTGGAGGAGCGAGTGTGG + Intronic
1141838980 16:86562168-86562190 CAACCAAGGTGGGGTCAGAGGGG - Intergenic
1203106903 16_KI270728v1_random:1419907-1419929 CAGCCATGTTTGAGACAGTGGGG - Intergenic
1203155363 16_KI270728v1_random:1871552-1871574 CAGCCATGTTTGAGACAGTGGGG - Intergenic
1142605943 17:1081102-1081124 CAGACATGGTGCAGAGAGTGTGG - Intronic
1143597911 17:7926383-7926405 CAACTATGGTGGAGCCAGGAAGG + Intronic
1143625246 17:8106167-8106189 CAACTAGGGTGGTGACAGTAGGG + Intronic
1144002653 17:11070275-11070297 CAACCTTGGTGAAATCAGTGCGG + Intergenic
1144265147 17:13561736-13561758 CCACCAGGCTGGAGACACTGCGG + Intronic
1145788189 17:27607837-27607859 CAACCCTGGTGGAGCCCATGGGG - Intronic
1146904910 17:36612118-36612140 CCACCATGGAGGAGTCTGTGGGG - Intergenic
1148026217 17:44589602-44589624 CAAGGATGGGGCAGACAGTGGGG - Intergenic
1148402660 17:47380652-47380674 CAACCATTGTGGAAGAAGTGTGG - Intronic
1148698046 17:49572935-49572957 CAAGCAGAGTGGACACAGTGCGG - Intergenic
1149666969 17:58371641-58371663 CAAGCATGGTGTTGACAGAGAGG + Intronic
1150916872 17:69446465-69446487 CAACATTGGTGGAGAAACTGAGG - Intronic
1151266610 17:72961308-72961330 CAACCATCGTGGAGAAAGTGTGG + Intronic
1153407227 18:4754333-4754355 CAACCATGTGGAAGTCAGTGTGG - Intergenic
1155261125 18:24043519-24043541 GAACCAGGTTGGAGACACTGAGG + Intronic
1155883326 18:31177580-31177602 CAATCATGGTGGAGGCAAGGAGG - Intergenic
1156965794 18:43090438-43090460 CAGCCATGTGGAAGACAGTGTGG + Intronic
1157016766 18:43724579-43724601 CAACCATTATGAAGACAGTGTGG + Intergenic
1157271686 18:46281135-46281157 CGACCACAGCGGAGACAGTGTGG + Intergenic
1157736825 18:50057174-50057196 AAGCCATAGTGGAGAAAGTGAGG - Intronic
1157780719 18:50436679-50436701 CAACCATGTGGACGACAGTGTGG + Intergenic
1158347539 18:56531103-56531125 CAACCATGTGGAAGTCAGTGTGG + Intergenic
1158669746 18:59464092-59464114 GTCCCATGGTGGAGACAGTGGGG - Intronic
1159322448 18:66870076-66870098 AAACCCTGGTGAAGACATTGGGG - Intergenic
1159499551 18:69251847-69251869 CAACCTTGTGGAAGACAGTGTGG - Intergenic
1159564750 18:70036113-70036135 CAACCATTGGGAAGGCAGTGTGG + Intronic
1160020753 18:75178921-75178943 CAACCATGGAGGAGGCCGTGTGG - Intergenic
1160195055 18:76746731-76746753 CAACCACTATGGAAACAGTGTGG + Intergenic
1161359986 19:3842986-3843008 CAGCCATTGTGGAAACAGTCTGG + Intronic
1161500944 19:4615284-4615306 CAACCATAGTGAACACAGTTAGG + Intergenic
1163315439 19:16537682-16537704 GATCCATGGTGGTGACAGCGGGG - Intronic
1164395283 19:27858225-27858247 CAATCATGTGGAAGACAGTGTGG + Intergenic
1165523994 19:36337120-36337142 AAGCCATTTTGGAGACAGTGAGG - Exonic
1165600241 19:37049288-37049310 CAACCATTGTGAAGTCAGTGTGG - Intronic
1167227752 19:48259904-48259926 CAGCCCTGGTGGAGAGAGAGAGG + Intronic
1167582192 19:50351713-50351735 CAGCTATGGTGGCTACAGTGAGG - Intronic
1167690190 19:50980313-50980335 CATCCATGGTGAAGAAAGTCAGG - Exonic
1167860892 19:52283057-52283079 CAACCATGTGGAAGACAGTGCGG - Intronic
925095474 2:1195299-1195321 CAACCATTGTGAAGACAGTGTGG - Intronic
926174238 2:10574865-10574887 CTACCTTGGTGGAGAAAGTCTGG - Intronic
927653523 2:24926987-24927009 CAGCCCTGGTGGAGACATTGAGG + Intergenic
927719447 2:25373369-25373391 CCATGGTGGTGGAGACAGTGTGG + Intergenic
928244038 2:29611802-29611824 CAATCATGGTGGATACAAAGGGG - Intronic
928622785 2:33108091-33108113 CAACCACGAAGGAGAAAGTGAGG + Intronic
929250571 2:39750171-39750193 CAACCGTTGGGAAGACAGTGTGG - Intronic
929527288 2:42716899-42716921 CAACCATGTGGAAAACAGTGTGG - Intronic
929722457 2:44384047-44384069 CAACCACTATGGAAACAGTGTGG - Intronic
930104458 2:47629029-47629051 AAACCATGAAGGAGGCAGTGGGG - Intergenic
930624393 2:53680316-53680338 CAACCGTTGGGAAGACAGTGTGG - Intronic
931154422 2:59611646-59611668 CAACCATGTGGAAGACAGTGTGG - Intergenic
931378114 2:61726358-61726380 AACCCATGGAGGAGACAGAGAGG + Intergenic
931430995 2:62208943-62208965 CAACCTGGGTGGGGGCAGTGGGG + Intronic
931478637 2:62616982-62617004 CAACCTTGTGGAAGACAGTGTGG - Intergenic
931746763 2:65297806-65297828 AAAGCAAGGTGCAGACAGTGTGG - Intergenic
933395529 2:81726195-81726217 CAACCATGTGGAAGACAGTGTGG + Intergenic
934100387 2:88647698-88647720 CAACCATGTGGAAGACAGTGTGG + Intergenic
934592655 2:95570112-95570134 CAACCATGTCGAAGACAGTGTGG + Intergenic
934608104 2:95713376-95713398 CAAGTAGGGTGGGGACAGTGTGG - Intergenic
934923093 2:98361602-98361624 CAACCATGTGGAAGACAGTGTGG - Intronic
935369569 2:102331117-102331139 CTACCATAGTGAAAACAGTGTGG - Intronic
935414951 2:102805464-102805486 CAACCTTGTTGGAGACATTCTGG + Intronic
935465541 2:103393849-103393871 CAACTATGTGGAAGACAGTGTGG + Intergenic
936065210 2:109326075-109326097 TTACCATGGTGGAGAAAATGTGG - Intronic
936821088 2:116521983-116522005 CAACTATTGTGGAAGCAGTGTGG - Intergenic
937327914 2:121003128-121003150 GTACCATGGTGGAGACTCTGTGG - Intergenic
937893453 2:126958187-126958209 CAACCATGTGGAAGACAGTATGG - Intergenic
938145347 2:128830254-128830276 CAACCATGTGGAAGACAGTGTGG + Intergenic
938211166 2:129466657-129466679 CCACCATGGTGGGGAGGGTGAGG + Intergenic
938928503 2:136065835-136065857 AATGCATGGTGGAGACAGGGAGG + Intergenic
939535935 2:143428504-143428526 AAAACATGGATGAGACAGTGAGG + Intronic
940707717 2:157125624-157125646 CAAGCAAGGTGGAGTCAGTTAGG - Intergenic
941036761 2:160577368-160577390 CAACCATTGTGGAACCATTGTGG + Intergenic
941501985 2:166290489-166290511 CAACAATTTTGAAGACAGTGAGG - Intronic
941743474 2:169061438-169061460 CAACCATGTGGAATACAGTGTGG + Intergenic
943825392 2:192384741-192384763 CAACCATGTGAAAGACAGTGTGG - Intergenic
943887859 2:193245734-193245756 CAACCATTGTGGAAGAAGTGTGG - Intergenic
944164160 2:196699984-196700006 TAATCATGTTGGAGATAGTGAGG + Intronic
944195475 2:197048760-197048782 CAACCATGTGGAAGACAGTGTGG - Intronic
944254305 2:197609205-197609227 CAACCATGTGGAAGACAGTGTGG - Intronic
944393094 2:199240179-199240201 CAACCATGTGGAAGACAGTGTGG - Intergenic
944421330 2:199533888-199533910 CAACCATTGTGAAGTCAGTGTGG - Intergenic
945202360 2:207295389-207295411 CAAGGATTGTGGAGACAGTGTGG - Intergenic
945400361 2:209374571-209374593 CAACCATTGTGAAGACAGTGTGG + Intergenic
946429259 2:219615943-219615965 GAGCCAAGGTGGAGACAGTGAGG + Intronic
946474049 2:219990919-219990941 CAACCATGGTGGAGGCAAGGAGG - Intergenic
947104794 2:226657978-226658000 CATCCATGGGGGAGAAGGTGAGG + Intergenic
948712381 2:239833229-239833251 CAGCCACGGAGGAGAGAGTGGGG + Intergenic
1170387197 20:15832352-15832374 CAGCCAAGTGGGAGACAGTGAGG + Intronic
1170594131 20:17792737-17792759 CGAACATGGTGGAGATACTGAGG + Intergenic
1171162956 20:22945047-22945069 CCACCATGTGGGAGACACTGTGG + Intergenic
1171848073 20:30289950-30289972 TAACCATAGAGAAGACAGTGGGG + Intergenic
1172287799 20:33753312-33753334 CAACCCTGGTGGGAACGGTGTGG + Exonic
1173399927 20:42716323-42716345 CAACCATGTGGAAGACAGTATGG - Intronic
1174750998 20:53111640-53111662 CAACCCTGGTGGAGTCACTGAGG - Intronic
1174929619 20:54798670-54798692 CAACCATGTGGCAGACATTGTGG - Intergenic
1175552704 20:59827466-59827488 CAACAGTGATGGAGACAGTGCGG + Intronic
1178296648 21:31415841-31415863 GAGACATGGAGGAGACAGTGTGG - Intronic
1179484108 21:41698774-41698796 CAATCATGGTGAAGACAAAGGGG + Intergenic
1181472434 22:23149105-23149127 AATCCATGGTTGAGACACTGCGG + Intronic
1182875102 22:33684862-33684884 CAACCTTGGTTGAAAAAGTGGGG - Intronic
1183107206 22:35622936-35622958 CACCCATGCTGGAGCCAGAGTGG - Intronic
1184309614 22:43632760-43632782 GAACCATGCTGCAGACTGTGGGG + Intronic
949211073 3:1502089-1502111 CAACCACTATGGAAACAGTGTGG + Intergenic
949429132 3:3954030-3954052 CAGCCATTGTGGAAACAGTATGG - Intronic
949565911 3:5244695-5244717 TAACCATGTGGAAGACAGTGTGG + Intergenic
951052527 3:18110467-18110489 CAACCATTGTGGAAGAAGTGTGG + Intronic
951109736 3:18787820-18787842 CCACCATGGTGGAAAAAGTGTGG + Intergenic
951346725 3:21555785-21555807 CAACCATTGTGAAGACAGTGTGG - Intronic
951368796 3:21817743-21817765 CAACCATGTGGAAGGCAGTGTGG + Intronic
951548165 3:23849928-23849950 CACCATTGTTGGAGACAGTGTGG - Intronic
952575527 3:34769685-34769707 CAACCATGTGGAAGACGGTGTGG + Intergenic
952597228 3:35032619-35032641 CAACCCTTGTGGGGTCAGTGTGG - Intergenic
953167470 3:40477975-40477997 CAGCCATGCTCCAGACAGTGTGG + Exonic
954288659 3:49637310-49637332 CAGCCATGGAGGTGACCGTGAGG + Intronic
954486371 3:50856257-50856279 CAACCATTGTGAAGACAGTGTGG - Intronic
954589885 3:51774475-51774497 CAACCCAGGAGGAGAAAGTGGGG - Intergenic
955133400 3:56192238-56192260 CAACCTTGGGTGAGACACTGTGG - Intronic
956186629 3:66568775-66568797 CAACCATGTGGAAGACATTGTGG - Intergenic
956990655 3:74759460-74759482 CAACCACTATGGAAACAGTGTGG + Intergenic
958569944 3:95865943-95865965 CAACCATTCTGGAGTCAGTGTGG + Intergenic
958661869 3:97078930-97078952 CAGCCATTGTGAAGACAGTGTGG + Intronic
958775543 3:98478555-98478577 CAACCATTGTGGAAGCAGTGTGG - Intergenic
958782496 3:98559677-98559699 CAACCATGTGGAAGACAGTGTGG + Intronic
959213409 3:103418536-103418558 CAACCATTGTGGAAGCAGTGTGG + Intergenic
959233851 3:103692611-103692633 AAACAATTGTGGACACAGTGTGG + Intergenic
960459936 3:117921270-117921292 CACAAATGGTGGAAACAGTGTGG + Intergenic
960672786 3:120168441-120168463 CCACCATGGTGGAGAAGGTGTGG + Intronic
960786439 3:121377739-121377761 CAACCATTGTGGAAACAGTGTGG + Intronic
962173463 3:133127554-133127576 GAACAAGGGTGGAGATAGTGTGG - Intronic
962180581 3:133201872-133201894 CAACCATTTGGAAGACAGTGTGG - Intronic
962527729 3:136251434-136251456 CAACCATGAGGGAGGCACTGGGG + Intronic
962640312 3:137378845-137378867 CAACCATGTAGAAGACAGTGTGG + Intergenic
962934344 3:140065903-140065925 CAACCATGGTGGAAAGAGAAGGG + Intronic
963110387 3:141683375-141683397 CAGCCTCAGTGGAGACAGTGAGG - Intergenic
963373525 3:144434031-144434053 CAGCCATGTGGAAGACAGTGTGG + Intergenic
963612350 3:147485921-147485943 CAACCATTGGGAAGACAGTGTGG - Intronic
963976809 3:151489391-151489413 CAACCATTGGGAAGACAGTGTGG + Intergenic
964053696 3:152425768-152425790 CAACCATGTGGAAGACAGTGTGG + Intronic
964394744 3:156233703-156233725 GAAGTATAGTGGAGACAGTGAGG + Intronic
965154726 3:165034945-165034967 GAAAGATGGTGGTGACAGTGGGG + Intronic
965444456 3:168757696-168757718 CAACCATTGTGGAAACAGTGTGG - Intergenic
965622556 3:170655752-170655774 CAGCCAGTGTGGAAACAGTGTGG - Intronic
965653323 3:170956165-170956187 TAACCGTTGTGAAGACAGTGTGG - Intergenic
965975028 3:174610734-174610756 CAACCATTGTGCAATCAGTGTGG + Intronic
967681839 3:192372621-192372643 GAACAAAGGTGGAGGCAGTGCGG - Intronic
968953877 4:3708466-3708488 AAACCATCGTGGAGACAGAACGG + Intergenic
969026243 4:4175005-4175027 CAACCATCTTGGGGACCGTGGGG + Intergenic
969157131 4:5220816-5220838 CAACTAAGGTGGTGGCAGTGGGG + Intronic
969681421 4:8645428-8645450 CAGCCATGGTGGGGAGAATGAGG + Intergenic
971042503 4:22769466-22769488 CAACCATTGTGGAAACAGTGTGG - Intergenic
972842822 4:42951690-42951712 CAACCATTGTGGAAGAAGTGTGG - Intronic
973529863 4:51825489-51825511 CAACCATTGTGAAGACAGTGTGG - Intergenic
973929063 4:55771401-55771423 TAACTATGGTGGAGACGTTGTGG - Intergenic
974110529 4:57520475-57520497 CAACCATGTGGAAGACAGTGTGG + Intergenic
974678646 4:65132004-65132026 CAGCCATGGTGGAGGTAGTGGGG + Intergenic
974797417 4:66770635-66770657 CAACCATGTGGAAGCCAGTGTGG - Intergenic
975150666 4:71017348-71017370 CAACCATGTGTAAGACAGTGTGG + Intronic
976060244 4:81119490-81119512 CTACCATACTGAAGACAGTGTGG - Intronic
976624633 4:87166912-87166934 CAGCCATGGTGAGGAGAGTGAGG + Intronic
976994792 4:91417260-91417282 CAACCATTGTGGATACAGTGTGG + Intronic
977521471 4:98089625-98089647 CAACCATTGTGGAAACAGTGTGG - Intronic
979722645 4:123919935-123919957 CTACCATACAGGAGACAGTGTGG - Intergenic
980212633 4:129809373-129809395 CAACCACTTTGGAAACAGTGTGG - Intergenic
981095018 4:140770194-140770216 CAATCCTGGTGGAGAAAGTCTGG - Intergenic
981984659 4:150839306-150839328 CAACCATTGTGAAGACAGTGTGG + Intronic
982519718 4:156399184-156399206 CAACCATGTGGAAGACAGTGTGG + Intergenic
982778966 4:159470319-159470341 CAGTCATTGTGGAGGCAGTGTGG + Intergenic
983429675 4:167632705-167632727 CAACCATGTGGAAGACAGTGTGG + Intergenic
983706355 4:170664920-170664942 CAACCATGTGGAAGTCAGTGTGG - Intergenic
984788488 4:183591976-183591998 CCTCCATGGAGGAGACAGTCAGG + Intergenic
984807419 4:183764406-183764428 TCACCATGTTGGAGCCAGTGAGG - Intergenic
985085542 4:186308969-186308991 CAAAAATGGTGGATACTGTGTGG - Intergenic
985509794 5:306588-306610 CAAACATGGCTGAGACAGAGAGG - Exonic
985536002 5:466073-466095 CATCCCGGGTGGGGACAGTGGGG + Intronic
986289721 5:6390169-6390191 CATCCCTGGTGTAGACAGCGGGG - Intergenic
986394395 5:7314220-7314242 CAACCATTGTGGACATTGTGGGG - Intergenic
986484844 5:8225592-8225614 CAACCATGTGGAAGACGGTGTGG + Intergenic
986653704 5:9989890-9989912 CAACCTTGGTTGAGACACAGAGG + Intergenic
986866499 5:11995522-11995544 TAACCATGTGGAAGACAGTGTGG + Intergenic
987029676 5:13964293-13964315 CAACCGTGGAGGAGCCAGAGGGG - Intergenic
987227537 5:15859165-15859187 CAATCCTGGTGGACACAGTAGGG - Intronic
987649698 5:20724958-20724980 CAACCATGTGGAAGAGAGTGTGG - Intergenic
988745863 5:34136568-34136590 CAACCATGTGGAAGAGAGTGTGG + Intergenic
989656569 5:43751781-43751803 CAACCATGTGGAAGACAGTGTGG - Intergenic
989823099 5:45819413-45819435 CAACCATTGTGAAGACATTGTGG - Intergenic
990030779 5:51256176-51256198 CAACCATGTGGAAGTCAGTGTGG + Intergenic
990035188 5:51310051-51310073 CAACCATTGTGAAGTCAGTGTGG + Intergenic
990099334 5:52162259-52162281 CAACCATGTGGAAGACAGTGTGG + Intergenic
990121246 5:52455526-52455548 TAACTATAGTGGAGAGAGTGAGG - Intergenic
990630116 5:57659465-57659487 CAACAATGTTGAAGACAGTGTGG - Intergenic
992383342 5:76260018-76260040 CGACCATTGTGGAAGCAGTGTGG - Intronic
992406740 5:76465674-76465696 CAACCATGATGGACTCATTGTGG - Intronic
993467326 5:88265323-88265345 CACACATTGTGGAGGCAGTGTGG + Intronic
994053734 5:95391921-95391943 CAACCATGTGGAAGACAGTGAGG + Intronic
994802706 5:104399344-104399366 AAACCATTGTGGAAACAGTGTGG + Intergenic
995003505 5:107163359-107163381 CAACCATTGTGGAAACAGTATGG + Intergenic
995005106 5:107182918-107182940 CGACTATGGTGGTGACAGTAGGG + Intergenic
995664930 5:114531219-114531241 CAACCGTTGTGGAAACAGTGTGG - Intergenic
995665882 5:114541575-114541597 CAACCATTGTAGAAGCAGTGTGG - Intergenic
995895183 5:117003205-117003227 CAACCATGTGGAAGTCAGTGTGG - Intergenic
997341027 5:133144731-133144753 CAACCTTGGTCAACACAGTGAGG + Intergenic
997693120 5:135840991-135841013 CAGCCATGGTGGAAACAGTTTGG - Intronic
998220446 5:140273819-140273841 TAACCATGTTGGAGACAGAGGGG + Intronic
998224829 5:140318831-140318853 CAAACATTATTGAGACAGTGAGG + Intergenic
998604183 5:143616758-143616780 CAACCGTGTGGAAGACAGTGTGG + Intergenic
998718272 5:144911116-144911138 CAACCATGTGGAAGACAGTGTGG + Intergenic
999052617 5:148539789-148539811 CAACCATTGTGGAAACACTATGG + Intronic
999430826 5:151524058-151524080 CATCCAAGCTGGAGATAGTGGGG - Intronic
999475517 5:151894663-151894685 ACACCATGGTAGACACAGTGGGG - Intronic
1000446784 5:161331817-161331839 CAATCACTGTGGTGACAGTGTGG + Intronic
1000565427 5:162841078-162841100 CATCCATGGTGGGGAGAGGGAGG + Intergenic
1001016346 5:168144752-168144774 CAACCATGTGGAAGTCAGTGTGG - Intronic
1001772746 5:174308250-174308272 CAACCCTGGTGGGGAAACTGAGG + Intergenic
1002086749 5:176780638-176780660 CAACCCAGGTGGGGACAGAGTGG - Intergenic
1004289824 6:14356312-14356334 CAACCATGTGGAAGTCAGTGTGG - Intergenic
1005177583 6:23064385-23064407 CAACCATGTGGAAGTCAGTGTGG + Intergenic
1005544021 6:26844793-26844815 CAACCATGTGGAAGAGAGTGTGG + Intergenic
1005791699 6:29309455-29309477 CAACCATTGTGGAAACAGTGTGG - Intergenic
1006879644 6:37327792-37327814 CAACCATGGAGGGGAGAGTGGGG + Intronic
1007494711 6:42251969-42251991 CAAGCATGGGGGAGTCAGGGTGG - Intronic
1008249991 6:49227808-49227830 CAACCATGTGGAAGACAGTGTGG - Intergenic
1008610316 6:53179496-53179518 CAACCATGGGGGTGAGTGTGAGG - Intergenic
1008642693 6:53480807-53480829 CAACCATGTGGAAGACAGTGTGG - Intergenic
1008643598 6:53490325-53490347 CAACCATGTGGAAGTCAGTGTGG + Intergenic
1008661867 6:53677012-53677034 CAACCATGGTGGAGAAAGTTTGG + Intergenic
1008712907 6:54250278-54250300 CGACCATGTGGAAGACAGTGTGG + Intronic
1008801542 6:55374321-55374343 CGACCATTGTGAAGACAGTGTGG - Intronic
1009014803 6:57886461-57886483 CAACCATGTGGAAGAGAGTGTGG + Intergenic
1009298307 6:61982721-61982743 GAACTATAGTGGAGACACTGAGG + Intronic
1009725518 6:67531977-67531999 CAACCATTGTGAAGACAGTGTGG + Intergenic
1009794568 6:68450839-68450861 CAACCATTGTGGACACAGTGTGG - Intergenic
1009999177 6:70930753-70930775 CAACCATGTGGAAGACAGTGTGG + Intronic
1010036969 6:71337203-71337225 CAACCATTGTGAAAATAGTGTGG + Intergenic
1010624067 6:78114369-78114391 CAACCATGTAGAAGACACTGTGG + Intergenic
1010724716 6:79320208-79320230 CAACCATGTGGAAGACAGTGTGG - Intergenic
1010941346 6:81921466-81921488 CCACCAGGGTGGAGTCAGAGAGG + Intergenic
1011161624 6:84397194-84397216 CAACCATGTGGAAGACGGTGTGG - Intergenic
1011216482 6:85011492-85011514 GAACCATTTTGGAGAAAGTGGGG - Intergenic
1011896696 6:92236421-92236443 AAACCATGTGGAAGACAGTGTGG - Intergenic
1012232137 6:96772477-96772499 CAACCATTGTGGAAGTAGTGTGG + Intergenic
1012590554 6:100974949-100974971 CAACCATTGTGAAGACAGTGTGG + Intergenic
1012701369 6:102461053-102461075 CAACCATTGTGGAAGAAGTGTGG + Intergenic
1012814327 6:104003016-104003038 CAACCATGTGGAAGACAGTGTGG + Intergenic
1012821572 6:104090991-104091013 CAACCATGTGGAAGACAGTGTGG + Intergenic
1013319737 6:108975577-108975599 CAACCATTGGGAAGACAGTGTGG - Intergenic
1013854519 6:114555837-114555859 CAACCATGTGGAAGACAGTGTGG + Intergenic
1013943755 6:115697447-115697469 CAACCATGTAGAAGACAGTGTGG + Intergenic
1014904654 6:127011573-127011595 CCACCATGGTAGACACAGAGAGG - Intergenic
1015416007 6:132949319-132949341 AAACCATGCTGAGGACAGTGAGG - Intergenic
1015619000 6:135110114-135110136 CTGGCATGGTGCAGACAGTGTGG - Intergenic
1015958286 6:138621060-138621082 CAAGCATGGTGGTGCCACTGGGG - Intronic
1016198157 6:141371971-141371993 CAACTACAGTAGAGACAGTGAGG - Intergenic
1016412391 6:143796982-143797004 CAACCATTTGGAAGACAGTGTGG - Intronic
1016488778 6:144572969-144572991 CAACTATTGTGAAGACAGTGTGG - Intronic
1019172595 6:170142160-170142182 CAGCCATTGTGGAAACAGTCTGG - Intergenic
1019378133 7:706978-707000 CAGCCCTGGTGGAGAGGGTGAGG - Intronic
1019614447 7:1952789-1952811 CTACCATGTTGGACAGAGTGTGG - Intronic
1020357914 7:7297550-7297572 CAACCATGTGGAAGACAGTGTGG - Intergenic
1020366738 7:7388579-7388601 CAACCATGTGGAAGACAGTGTGG - Intronic
1020665031 7:11030486-11030508 CAGCCATGTTTGGGACAGTGGGG + Intronic
1021215326 7:17909270-17909292 CAACCATGTGGAAGACAGTGTGG + Intronic
1021427935 7:20524279-20524301 CAACCATTGTGAAAGCAGTGTGG + Intergenic
1022468176 7:30665309-30665331 CACCCATGGTGGCCACAGTTGGG + Intronic
1022655253 7:32313322-32313344 CAACCATGTGGAAGTCAGTGTGG + Intergenic
1022777499 7:33543033-33543055 CAACCACTATGGAAACAGTGTGG - Intronic
1023250704 7:38257621-38257643 CAACAATGGAGAAGACAATGGGG + Intergenic
1023748296 7:43343829-43343851 CAACCATTGTGGAGACAGTGTGG - Intronic
1024528037 7:50365701-50365723 CAACCATGTGGAAGACAGTGTGG + Intronic
1025030849 7:55555491-55555513 CTACCATGAGGGACACAGTGGGG + Intronic
1026451567 7:70533942-70533964 CAACCATTGTGTAGGCAGAGTGG - Intronic
1026955301 7:74372903-74372925 CACCCAGGGTGGACACGGTGGGG - Intronic
1027609195 7:80338250-80338272 CAACCATGTAGAAGACAGTATGG - Intergenic
1027674053 7:81137355-81137377 CTATCATGGTGGAAAGAGTGAGG + Intergenic
1028013199 7:85675517-85675539 CAACCATGTGGAAGACAGTGTGG - Intergenic
1028070509 7:86444216-86444238 CAATCATGGTGGAGGCAAGGAGG - Intergenic
1028627449 7:92893303-92893325 CAGCCATGTGGAAGACAGTGTGG - Intergenic
1028836916 7:95384766-95384788 CAACCTTGTGGAAGACAGTGTGG + Intronic
1028921695 7:96316874-96316896 CACACATGGTGGACAGAGTGAGG + Intronic
1030030228 7:105362615-105362637 CAACCATGTGGAAGACAGTGTGG + Intronic
1030393561 7:108957329-108957351 CAATCATGGTGAAGACAAAGGGG + Intergenic
1030624220 7:111826360-111826382 CAGGCATTGTGGAGACACTGAGG + Intronic
1031715454 7:125103782-125103804 CAACCATGTGGAAGACAGTGTGG + Intergenic
1032271212 7:130408650-130408672 GAACCATGCTGGAGAGAATGTGG + Intronic
1032884871 7:136126666-136126688 CAACTGTGGTGGAGACAGAAGGG + Intergenic
1033013946 7:137652546-137652568 CACCCAGAGTGCAGACAGTGTGG - Intronic
1033801816 7:144910665-144910687 CAAAAATGGTGGATACAGAGGGG - Intergenic
1035885726 8:3289398-3289420 CAACCATTGTGAAGTCAGTGTGG - Intronic
1037257460 8:16971387-16971409 CAACCATTGTGAAGTCAGTGTGG + Intergenic
1037556319 8:20027042-20027064 CAACCATGTGGAAGACAGTGTGG - Intergenic
1038704144 8:29878419-29878441 CAGACAAGGGGGAGACAGTGTGG - Intergenic
1039315611 8:36368398-36368420 CAGTCATGGTCGAGACAGAGTGG - Intergenic
1040084697 8:43327242-43327264 CAACCACGTCGAAGACAGTGTGG - Intergenic
1040345157 8:46485404-46485426 CAAACATGGTTGAGTCACTGTGG - Intergenic
1040568442 8:48587457-48587479 CAACCCTGGTGGGGGCTGTGAGG + Intergenic
1040917727 8:52580621-52580643 CAACCATGTGGAAGACAGTGTGG - Intergenic
1040961557 8:53038989-53039011 CAACCATTGTGGAAGCAGTATGG - Intergenic
1041193458 8:55376301-55376323 CAACCATGTGGAAGACAGTGTGG - Intronic
1041297719 8:56376049-56376071 CACCCAGGCTGGAGTCAGTGAGG - Intergenic
1041387705 8:57321521-57321543 CAACCATGTGGAAGTCAGTGTGG - Intergenic
1041886884 8:62820035-62820057 GAACCAAGGTGGGGACAGTGAGG + Intronic
1042455178 8:68993248-68993270 AAAACATGGAGGAGAAAGTGGGG + Intergenic
1043763396 8:84098168-84098190 CAACCATTGTGGAAACAGTGTGG - Intergenic
1044120769 8:88391980-88392002 CAACCATTTGGAAGACAGTGTGG - Intergenic
1044767732 8:95594460-95594482 AAACATTGTTGGAGACAGTGTGG - Intergenic
1045205496 8:100035528-100035550 CAACCTTGTGGGGGACAGTGTGG + Intronic
1045322196 8:101090786-101090808 TAGGCATGGTGGGGACAGTGGGG + Intergenic
1045427659 8:102083127-102083149 CATCCATGGGGAAGACACTGAGG - Intronic
1046464178 8:114580920-114580942 CAACCATGTGGAAGTCAGTGTGG - Intergenic
1047075062 8:121392003-121392025 CAACCATGAGGAAGACAGTGTGG + Intergenic
1048756056 8:137739309-137739331 CAATCATTGTGGAAACAGTGTGG - Intergenic
1049244220 8:141553040-141553062 CAGTGATGGTGAAGACAGTGAGG - Intergenic
1049416414 8:142497559-142497581 CAATCATGGTGCAGATACTGAGG - Intronic
1050300019 9:4248661-4248683 CAACCATGTGGAAGACAGTGTGG - Intronic
1050403486 9:5282198-5282220 CAACCATTGTGGAAGCAGAGTGG + Intergenic
1052884244 9:33628262-33628284 CAACCATGTGGAAGACAGTGTGG + Intergenic
1053087293 9:35236531-35236553 ACACCATGGTGGGGACTGTGTGG + Exonic
1053152975 9:35754577-35754599 CACCCCTGGTGGTGGCAGTGGGG - Exonic
1055674913 9:78648312-78648334 CAACCATGTGGAAGACAGTGTGG + Intergenic
1056680186 9:88710605-88710627 CCACCAGGGTGGAGACAGCTAGG + Intergenic
1057737252 9:97674967-97674989 CCACGATGGTGGAAACAGTGGGG - Exonic
1057853190 9:98581078-98581100 CACCGATGGTGGAGGCAGTGAGG + Intronic
1058029778 9:100182698-100182720 CAACCTTTGTGAAGACAGTGTGG + Intronic
1058244553 9:102606629-102606651 CAGCCATGTGGAAGACAGTGTGG + Intergenic
1058513482 9:105745159-105745181 CAACCATTGTGAAGACAGTGTGG - Intronic
1058516951 9:105785640-105785662 CAACCATTGTGAAGACAGTGTGG - Intergenic
1059219309 9:112597927-112597949 GAACCATGGATGAAACAGTGGGG + Intronic
1060291942 9:122311308-122311330 AAACCATGCTGGACACAGGGAGG - Intronic
1061025477 9:128046004-128046026 CAACCACATTGGAAACAGTGTGG + Intergenic
1061522644 9:131129359-131129381 CCACCATGGAGGGGACAGTGGGG - Exonic
1061589523 9:131589561-131589583 CAGCCATGGTGGAGGCTGTGTGG - Intronic
1062324465 9:136005481-136005503 CATTCCTGGTGGGGACAGTGTGG + Intergenic
1203776956 EBV:78449-78471 CATCCGCGGTGGATACAGTGGGG + Intergenic
1203398222 Un_KI270519v1:47952-47974 CAACGATTGTGAAGTCAGTGTGG + Intergenic
1185544322 X:930067-930089 CAAACATGTGGAAGACAGTGTGG - Intergenic
1185798135 X:2984468-2984490 TAATGATGGTGGACACAGTGAGG + Intergenic
1186249305 X:7648874-7648896 CAATCATGTTGGAGACAGAGTGG + Intergenic
1187009649 X:15266615-15266637 CAACCCTGGTGGGGTCAGGGTGG - Intronic
1188134402 X:26476895-26476917 CAACCATTGTGGAAGCAGTGTGG + Intergenic
1188270963 X:28139783-28139805 TAACCATGTTGGGGACAGGGAGG + Intergenic
1188319698 X:28721166-28721188 CAACCATTGTGGAAGCAGTGTGG - Intronic
1188393498 X:29651190-29651212 CAGCCATTATGGAGACAGTATGG + Intronic
1188509468 X:30919935-30919957 CAGCCATGTTGGAGTAAGTGGGG - Intronic
1188909330 X:35826387-35826409 GAAGCAAGGTGGAGACAGTTAGG - Intergenic
1189190664 X:39100332-39100354 CAACCATGTGGAAGAGAGTGTGG - Intergenic
1190519955 X:51267567-51267589 CAACCATGTGGAAGTCAGTGTGG + Intergenic
1190535866 X:51427395-51427417 CACACATGGTGGAAAAAGTGAGG - Intergenic
1190551593 X:51587557-51587579 CAACCACGTGGAAGACAGTGTGG - Intergenic
1191163210 X:57357754-57357776 CAACCATTGTGAAGACAGTGTGG + Intronic
1192501278 X:71654361-71654383 CAAACATGTGGAAGACAGTGTGG - Intergenic
1192686404 X:73310412-73310434 CGACCATTGTGGATACAGTGTGG + Intergenic
1193327428 X:80196029-80196051 CAAGCATTGTGAAGACAGTGTGG + Intergenic
1193403177 X:81070075-81070097 CAACCATTGTGGAGTCAGCGTGG + Intergenic
1193452798 X:81691284-81691306 CAACCATTGTGGAAGCAGTGTGG + Intergenic
1193565743 X:83074679-83074701 AAACCATGTGGAAGACAGTGTGG + Intergenic
1193844406 X:86450644-86450666 CAACCATGTGGAAGACAGCGTGG - Intronic
1193901066 X:87177950-87177972 CAACCATTGAGAAGACAGTGTGG + Intergenic
1194378097 X:93160911-93160933 CAACCAGTGTGGAAACAGTATGG + Intergenic
1194633542 X:96316142-96316164 CAACCACTATGGAAACAGTGTGG - Intergenic
1196095266 X:111791876-111791898 CAACCCTGTGGAAGACAGTGTGG + Intronic
1196260694 X:113577040-113577062 CAACCACTATGGAAACAGTGTGG - Intergenic
1196569832 X:117252861-117252883 CAACCTTGTGGAAGACAGTGTGG - Intergenic
1197249158 X:124196804-124196826 CAGTAATGGTAGAGACAGTGAGG - Intronic
1197260342 X:124310589-124310611 CAACCTTGTGGAAGACAGTGTGG - Intronic
1197767609 X:130069343-130069365 CGAGCATGGTGGAGGTAGTGGGG + Exonic
1197834003 X:130675190-130675212 CAACCATGTGGAAGTCAGTGTGG - Intronic
1198337770 X:135684202-135684224 CAACCATATGGAAGACAGTGTGG + Intergenic
1198361373 X:135898565-135898587 CAACCATGTGGATGACAGTGTGG - Intronic
1198652550 X:138878723-138878745 CAACCATTGTGAAGTCAGCGTGG - Intronic
1199224259 X:145354258-145354280 CAACCATGTGGAAGACATTGTGG + Intergenic
1200900642 Y:8428420-8428442 CAACCATGTAGAAGACAGTGTGG + Intergenic
1201013709 Y:9576185-9576207 CAACCATGTGGAAGTCAGTGTGG + Intergenic
1201936201 Y:19413232-19413254 CAACCATGTGGAAGTCAGTGTGG - Intergenic
1202015611 Y:20403095-20403117 CAACCATGTGGAAGACAGTATGG - Intergenic
1202171252 Y:22046492-22046514 CAACCATGTGGAAGACAGTGTGG + Intergenic
1202220110 Y:22539880-22539902 CAACCATGTGGAAGACAGTGTGG - Intergenic
1202323004 Y:23655782-23655804 CAACCATGTGGAAGACAGTGTGG + Intergenic
1202329537 Y:23732637-23732659 CAACCATTTGGAAGACAGTGTGG + Intergenic
1202541234 Y:25937417-25937439 CAACCATTTGGAAGACAGTGTGG - Intergenic
1202547768 Y:26014274-26014296 CAACCATGTGGAAGACAGTGTGG - Intergenic