ID: 1093662142

View in Genome Browser
Species Human (GRCh38)
Location 12:21769257-21769279
Sequence CTCTATAAGTAGAACTATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 151}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093662138_1093662142 12 Left 1093662138 12:21769222-21769244 CCCCAAAGTATTATGCTAAATTG 0: 1
1: 0
2: 1
3: 32
4: 339
Right 1093662142 12:21769257-21769279 CTCTATAAGTAGAACTATAAAGG 0: 1
1: 0
2: 2
3: 12
4: 151
1093662139_1093662142 11 Left 1093662139 12:21769223-21769245 CCCAAAGTATTATGCTAAATTGA 0: 1
1: 0
2: 16
3: 68
4: 682
Right 1093662142 12:21769257-21769279 CTCTATAAGTAGAACTATAAAGG 0: 1
1: 0
2: 2
3: 12
4: 151
1093662140_1093662142 10 Left 1093662140 12:21769224-21769246 CCAAAGTATTATGCTAAATTGAC 0: 1
1: 0
2: 3
3: 25
4: 196
Right 1093662142 12:21769257-21769279 CTCTATAAGTAGAACTATAAAGG 0: 1
1: 0
2: 2
3: 12
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093662142 Original CRISPR CTCTATAAGTAGAACTATAA AGG Intronic
908905998 1:69010032-69010054 GTCTATACTTAGATCTATAAAGG + Intergenic
909622698 1:77685047-77685069 CTCTATAAGTAGAAAGAGCAAGG - Intergenic
909979015 1:82076201-82076223 CTCTCTAATTAGAATTATATGGG - Intergenic
916028580 1:160856628-160856650 ATGTATAATTACAACTATAAGGG - Intronic
916999773 1:170344260-170344282 CACTATAAGTAAAATTAAAAGGG + Intergenic
917271881 1:173284706-173284728 CTCTATAAATGGAACAACAAAGG + Intergenic
917834359 1:178929509-178929531 CTCTAACAATAGAAGTATAAGGG - Intergenic
919225527 1:194694472-194694494 CCATTTAAGTAGAAATATAAGGG + Intergenic
920931154 1:210389525-210389547 CTCTATCAGGAGAACAATAAGGG - Intronic
921269544 1:213455160-213455182 CTCTTTAATTAGAACTTCAAAGG + Intergenic
922032548 1:221815799-221815821 CTCTATAAGTGGAACAACAAAGG + Intergenic
922451172 1:225738564-225738586 CTCTATATAAAGAACTACAATGG - Intergenic
1065301619 10:24327398-24327420 CCCTATAAGTATAAATTTAAGGG + Intronic
1066791680 10:39071897-39071919 CTCTTTTTGTAGAACTATGAAGG + Intergenic
1069259061 10:66371285-66371307 CTGTATATGTAAAAGTATAAAGG - Intronic
1071740240 10:88350134-88350156 CTTTTTAAGTAGAACAAAAAAGG - Intronic
1072477168 10:95773501-95773523 CTCTATAAATGGAACAAAAAAGG - Intronic
1076106697 10:127829021-127829043 CTCTGAAAGTAGAATTACAAAGG + Intergenic
1078499654 11:11858280-11858302 CTCGGTAAGAAAAACTATAAAGG + Intronic
1080325786 11:31071314-31071336 CATTCTAAGTAGTACTATAATGG + Intronic
1081071485 11:38615784-38615806 CTCTATAAGGGGAACAATAAAGG - Intergenic
1081256503 11:40903218-40903240 CTCTATAAATGGAACAACAAAGG + Intronic
1085766340 11:79286353-79286375 TTCTATAAGTAGAAATAGGATGG + Intronic
1087657741 11:100945757-100945779 CTCTACAAATGGAACAATAAAGG - Intronic
1089719367 11:120398963-120398985 CTTTCCAAGTAGAACTCTAATGG - Intronic
1090661362 11:128884337-128884359 ATCTATAAGTATTACTAGAAGGG + Intergenic
1091639408 12:2223683-2223705 CTCTATAAGAGGAAGGATAATGG - Intronic
1092334963 12:7624119-7624141 CCATATAAATAGAATTATAAAGG - Intergenic
1093662142 12:21769257-21769279 CTCTATAAGTAGAACTATAAAGG + Intronic
1095396514 12:41768363-41768385 CTCTAAATATAGAACTATCATGG - Intergenic
1095437352 12:42205240-42205262 AGGTATAAGTACAACTATAATGG - Intronic
1097018753 12:56005479-56005501 TTAGAAAAGTAGAACTATAAAGG - Exonic
1099079312 12:78156627-78156649 CACTATAAGGAGAATTAAAATGG + Intronic
1100826783 12:98482274-98482296 CTCTAAAAATAAAAATATAAAGG + Intergenic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1108743431 13:53363280-53363302 CTCTATAAGTAGAATTGCACTGG + Intergenic
1109843348 13:67949959-67949981 CTCTAGAAGTAGTAGTATGATGG - Intergenic
1109910218 13:68900350-68900372 GCCTATAAGTAAAACAATAAAGG - Intergenic
1110027960 13:70566285-70566307 TTCTATAGGTACAACTATAATGG - Intergenic
1110201837 13:72860068-72860090 CTCTATCAGTAGAAGTATTCAGG + Intronic
1110230871 13:73165999-73166021 CTTTATAAGGAGCACTATAAAGG - Intergenic
1110995756 13:82107125-82107147 CTCTATAAATGGAACAATAATGG - Intergenic
1111388747 13:87563181-87563203 TTCTATTAGTAAAACTAAAAAGG - Intergenic
1114144555 14:19959081-19959103 CTCTGTCAATAGAATTATAATGG + Intergenic
1114979041 14:28138738-28138760 CTTTAAAAGTACAACTGTAATGG - Intergenic
1116408764 14:44598652-44598674 ATTTATAATTAGAACAATAATGG - Intergenic
1116554831 14:46289829-46289851 CTGAATAAGTAGATCTATAAAGG + Intergenic
1117688827 14:58284030-58284052 TTCAATAGGTAGAACTATATAGG - Intronic
1118075374 14:62292548-62292570 CTCTACAAGGAAAACTATAAAGG - Intergenic
1118393125 14:65313086-65313108 CTCTATCAGGAGAACAGTAAGGG - Intergenic
1127555387 15:60082477-60082499 CTCTATGTGTAGATCTATAGAGG + Intergenic
1130365022 15:83227700-83227722 CACAATAAGTAGGCCTATAAAGG - Intergenic
1131878937 15:96841933-96841955 CTTTATAAATGGAACAATAAAGG + Intergenic
1131900278 15:97080267-97080289 CTCTATCAGGAGAACAATATAGG + Intergenic
1139254800 16:65530661-65530683 CACTATCAGTAGAACAGTAAAGG + Intergenic
1141983993 16:87567850-87567872 CTCTACCAGTAGAAATATATTGG - Intergenic
1144232685 17:13224059-13224081 CACAATAAGTACAACTTTAAAGG + Intergenic
1145087317 17:19952539-19952561 CCCTTTAAATAGAATTATAAAGG + Intronic
1145881948 17:28358520-28358542 CTCAATTATTAGAACTAGAAAGG + Intronic
1155312695 18:24539780-24539802 CTCTATATGTAGACCCAGAAGGG + Intergenic
1155929956 18:31696790-31696812 CTTTACTATTAGAACTATAAAGG - Intergenic
1157724405 18:49952780-49952802 CTCTATAAGCAGAAACTTAATGG - Intronic
1167092533 19:47354512-47354534 ATCTAGGAGGAGAACTATAAGGG + Intronic
926504057 2:13688845-13688867 CTCTATAAGAAGAATATTAAAGG - Intergenic
926665221 2:15514350-15514372 CTGAATAAATAGAAATATAAGGG + Intronic
928499847 2:31879313-31879335 CTCTCTAAGCAGAACTCTACTGG + Intronic
930362274 2:50396672-50396694 CTGTTTAAGTATAACCATAAAGG + Intronic
930993716 2:57690556-57690578 CTCTACAAGGAGAACTACAAAGG + Intergenic
931357595 2:61550719-61550741 ATCTATTAGAAAAACTATAAGGG - Intergenic
932469873 2:71947522-71947544 CTCTATAAATGGAACAACAAAGG - Intergenic
937743596 2:125385353-125385375 CTTTATAAGTAGAACACCAAAGG + Intergenic
937816715 2:126258755-126258777 TTTTATAAGTAGAAATACAAAGG + Intergenic
941581394 2:167300814-167300836 CTCTATAAACAGAAACATAATGG + Intergenic
941733090 2:168940879-168940901 TTCTATAAATAGAATAATAAAGG + Intronic
942403538 2:175628950-175628972 CTTTATAAGTAAAAGGATAAAGG - Intergenic
943112488 2:183622746-183622768 TTCTATAAGCAGAAATCTAAAGG + Intergenic
945085818 2:206131200-206131222 TTCTAAAAGTAGAACTATTGGGG - Intronic
947113154 2:226741864-226741886 ATCTATTACCAGAACTATAAAGG - Intronic
1168928307 20:1600577-1600599 CTCAATTAGCAGAACTCTAAGGG + Intronic
1170383273 20:15785579-15785601 TTCTGTAAGTAGATCTTTAAGGG + Intronic
1170420211 20:16185048-16185070 CTCTGTAAGAAGATCAATAAAGG - Intergenic
1170846731 20:19968272-19968294 CTCTATACGTAGATTTCTAAAGG - Intronic
1171797119 20:29575283-29575305 GTCTATAAATGGGACTATAAAGG + Intergenic
1171851133 20:30308879-30308901 GTCTATAAATGGGACTATAAAGG - Intergenic
1172381915 20:34501473-34501495 CTCTATAAGAAGTACTGGAAGGG + Intronic
1174668963 20:52288116-52288138 CTCTATAGTTAGCATTATAATGG - Intergenic
950991905 3:17448743-17448765 CTCTGTAAATAGAACAGTAAAGG - Intronic
957023010 3:75144889-75144911 CTGTATATGTTGAACTTTAATGG + Intergenic
957028336 3:75210816-75210838 TTGTATAAGTAAAAATATAAAGG - Intergenic
957710052 3:83844896-83844918 CTCTAAAGGTAGAACTCTAAAGG - Intergenic
958655455 3:96996722-96996744 CTCTATAAATGGAACAACAAAGG - Intronic
959882541 3:111461284-111461306 CTCTTTAAGTAGACCTTTGATGG - Intronic
960345764 3:116530360-116530382 CTGTATAGGTAGAAGTTTAAAGG + Intronic
960347701 3:116555138-116555160 CTTTTTAATTAGAACTAGAAGGG - Intronic
960765391 3:121123531-121123553 ATATATAAGTACAAATATAAAGG - Intronic
961491610 3:127260359-127260381 CTATAGAAGTAGAACAAAAATGG + Intergenic
961974052 3:131004026-131004048 TGCTAGAAGTAGAACGATAATGG + Intronic
964153148 3:153552930-153552952 CTCTTTAAGAAGAAGTGTAAGGG - Intergenic
967459535 3:189729311-189729333 CTAAATATGTAGAACTTTAATGG + Intronic
968791081 4:2662578-2662600 CTCCAAAAGTAGAAATATTAAGG - Intronic
969360339 4:6659178-6659200 CTTTAGCAGTAGAACAATAAAGG + Intergenic
975823165 4:78292119-78292141 CTCTATAGGTTGAAAAATAAAGG - Intronic
976987805 4:91325002-91325024 CACTATCACTAGAACAATAAGGG - Intronic
979604886 4:122627144-122627166 CTATATACATAGAACAATAAAGG + Intergenic
982433414 4:155351066-155351088 CTGTGAAAGAAGAACTATAAAGG + Intronic
982470747 4:155787081-155787103 CAACATAAGTAGAAGTATAAGGG + Intronic
984380059 4:178981594-178981616 CTATATAAGCAGAAATATATAGG - Intergenic
986043326 5:4013616-4013638 CTCTGTAAGCAGAACAATACTGG + Intergenic
988341981 5:29984582-29984604 CACTACAAGTAGAAAAATAAAGG - Intergenic
988433444 5:31146221-31146243 CTTTAAAACTAGAACTAGAAGGG + Intergenic
988853885 5:35207460-35207482 CTATATGAGTAAGACTATAAAGG + Intronic
992764579 5:79985462-79985484 CTCTATAAAAAAAACTAAAAGGG + Intronic
993655914 5:90577801-90577823 CTCTTCAAGGAGAACTACAAAGG - Intronic
993827328 5:92707762-92707784 TTCTATGAGTAGAACAATCAAGG - Intergenic
994912508 5:105930467-105930489 TTCTAAAAGTAGAATTACAATGG - Intergenic
995339465 5:111041593-111041615 CTCTATAAATGGAACAACAAAGG - Intergenic
997733630 5:136197935-136197957 CTCCATAAGTATAACCACAAAGG - Intergenic
998197969 5:140092540-140092562 ATATATAAGTAGAAATAAAAAGG - Intergenic
998729471 5:145058230-145058252 CTGTATAAGTAGTACTTTTAAGG - Intergenic
1002705256 5:181156779-181156801 TTCTCTAAAGAGAACTATAAAGG - Intergenic
1003305822 6:4927210-4927232 TTCTAAAGGTAGAATTATAAGGG + Intronic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1004881739 6:20015323-20015345 CTATATAAGCAGAAATAAAAAGG - Intergenic
1008043871 6:46832013-46832035 CTCTCTAAGTACAACTTCAAGGG - Intronic
1010906537 6:81498189-81498211 CTCTATAAGAAGAACTATATTGG - Intronic
1011653524 6:89528965-89528987 CTCTATAAATGGAACAACAAAGG - Intronic
1017537827 6:155367257-155367279 CTCTGAAAGTAGTAATATAAGGG + Intergenic
1020719084 7:11718726-11718748 CTCTATAAGTTCCACTTTAAAGG - Intronic
1020746662 7:12088008-12088030 ATCTATATGTAGATATATAATGG + Intergenic
1022958916 7:35406742-35406764 CTCTGTAAGTGGAACAATACAGG + Intergenic
1023710196 7:42984374-42984396 CTCTATAAATAGAACTACAAAGG - Intergenic
1028008049 7:85603537-85603559 TTCTATAATTATTACTATAAGGG - Intergenic
1028445678 7:90920618-90920640 ATCTATATGTATAAATATAAAGG - Intronic
1031756884 7:125656019-125656041 CTCTAAAAGTAGAACTTCATGGG + Intergenic
1034030216 7:147753830-147753852 CTCAATAATTAGAACTTTGAGGG + Intronic
1039240677 8:35552946-35552968 CTCAATTAGTACAACTAAAAAGG + Intronic
1039506366 8:38055296-38055318 CTCAATATGTACAACTATTATGG + Intronic
1040297688 8:46168499-46168521 CTCTTTATGTAGAACTGTGAAGG - Intergenic
1042690261 8:71490430-71490452 CGCAATAAACAGAACTATAAAGG + Intronic
1043295602 8:78658907-78658929 TTCTTTAAGAAGAACCATAAGGG + Intergenic
1044044008 8:87406955-87406977 TTTTATAATTAAAACTATAAAGG - Intronic
1044637274 8:94339309-94339331 CTCTCAAAGTAAATCTATAAAGG + Intergenic
1045030671 8:98132506-98132528 CTCAGTAACTAGAACTAAAAGGG - Intronic
1045603183 8:103742469-103742491 CTCTATAATTATATCTGTAAGGG + Intronic
1048318877 8:133383129-133383151 GTCTATAAATAAAGCTATAATGG + Intergenic
1052252884 9:26420873-26420895 CTCTGTATGTAGAAATAAAAAGG + Intergenic
1053469023 9:38332455-38332477 CACTATCAGGAGAACAATAAGGG + Intergenic
1053788903 9:41672161-41672183 GTCTATAAATGGGACTATAAAGG - Intergenic
1054156238 9:61642606-61642628 GTCTATAAATGGGACTATAAAGG + Intergenic
1054177183 9:61883506-61883528 GTCTATAAATGGGACTATAAAGG - Intergenic
1054476010 9:65573606-65573628 ATCTATAAATGGGACTATAAAGG + Intergenic
1054660350 9:67697299-67697321 GTCTATAAATGGGACTATAAAGG + Intergenic
1056046359 9:82721460-82721482 TTCTCCAAGTAAAACTATAAGGG + Intergenic
1056155302 9:83829134-83829156 CTCTATCAGCAAAAATATAAAGG + Intronic
1056355183 9:85793978-85794000 CTCTATCAGCAAAAATATAAAGG - Intergenic
1060001478 9:119962721-119962743 CTCTCTAAGAATGACTATAAAGG + Intergenic
1186537619 X:10366113-10366135 CTTTAGAAGTAGAACCAGAAAGG + Intergenic
1187572937 X:20523673-20523695 CTGAAAAAGCAGAACTATAAGGG + Intergenic
1188145056 X:26601825-26601847 CTGTATAGGTATAACTAAAATGG - Intergenic
1188946191 X:36305360-36305382 CTCTAAAAGTAGAGATATAAAGG - Intronic
1194432282 X:93823834-93823856 CTTTAGAAATAGAACTAAAATGG - Intergenic
1195084222 X:101399157-101399179 TTCTATAATCAGAACTAAAATGG + Intronic
1195529792 X:105940886-105940908 CTTTATATGCAGAACAATAATGG - Intronic
1197073605 X:122329315-122329337 CTCTACAAGGAGAAATAAAAAGG + Intergenic
1197197019 X:123712850-123712872 CTCTGTATGTTGAACTATCATGG + Exonic
1199106832 X:143878120-143878142 CTATATATGTAGAATTATAAAGG + Intergenic