ID: 1093664881

View in Genome Browser
Species Human (GRCh38)
Location 12:21800182-21800204
Sequence CACAGGCAAGTGACTTCATT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 179}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093664881_1093664884 5 Left 1093664881 12:21800182-21800204 CCAAATGAAGTCACTTGCCTGTG 0: 1
1: 0
2: 1
3: 19
4: 179
Right 1093664884 12:21800210-21800232 CTTGAGTAATGTGGCATGTTAGG 0: 1
1: 1
2: 1
3: 6
4: 129
1093664881_1093664883 -4 Left 1093664881 12:21800182-21800204 CCAAATGAAGTCACTTGCCTGTG 0: 1
1: 0
2: 1
3: 19
4: 179
Right 1093664883 12:21800201-21800223 TGTGTAAATCTTGAGTAATGTGG 0: 1
1: 0
2: 2
3: 15
4: 178
1093664881_1093664885 6 Left 1093664881 12:21800182-21800204 CCAAATGAAGTCACTTGCCTGTG 0: 1
1: 0
2: 1
3: 19
4: 179
Right 1093664885 12:21800211-21800233 TTGAGTAATGTGGCATGTTAGGG 0: 1
1: 2
2: 1
3: 12
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093664881 Original CRISPR CACAGGCAAGTGACTTCATT TGG (reversed) Exonic
901791864 1:11658068-11658090 CACAGGGAGGTGACTTCCCTGGG - Intronic
902877946 1:19352232-19352254 CACAGGCAAGTGCCTCTACTGGG + Intronic
907799285 1:57748816-57748838 TCCAGGCCAGTGACATCATTTGG + Intronic
912797375 1:112701229-112701251 CACAGGAAAGTGTCTGCAGTAGG - Exonic
915107494 1:153543441-153543463 CACAGGCAATAGAGTTCACTCGG - Intergenic
916716739 1:167452743-167452765 GACAGGCAAGTGATCTCCTTTGG + Intronic
916746993 1:167692172-167692194 CACAGGAAACTTACTTCGTTGGG + Intronic
918498849 1:185171201-185171223 CACAGTCAAAGGGCTTCATTCGG - Intronic
1065667444 10:28077280-28077302 CAGAGGCAAATGACTTTATTTGG + Intronic
1066027063 10:31369432-31369454 CACATGCAAGTGAGATCATATGG + Intronic
1066036349 10:31491096-31491118 CTCAGGAAAGTGACCTCATAAGG - Intronic
1067551542 10:47239935-47239957 CACAGGAAAGTGACTTCAGGTGG + Intergenic
1067735811 10:48849416-48849438 CACAAGCCAGTCACTTCATCTGG - Intronic
1069102112 10:64334937-64334959 AACAGGCAAGTGAGATCATGAGG + Intergenic
1069123331 10:64597235-64597257 CACATGCAAATGACTGCAGTTGG - Intergenic
1070412317 10:76153512-76153534 CACATGCAAAAGACTACATTTGG - Intronic
1073705199 10:105975316-105975338 CACATGCAAGTGACTTCCTTGGG + Intergenic
1073871506 10:107870210-107870232 CCCAAGCAAGTGACTTGCTTTGG - Intergenic
1074889549 10:117724031-117724053 CAGAGGAAAGTGGCTTCATATGG - Intergenic
1075996366 10:126879317-126879339 CAGAGGCAAGTGAGTTCACGTGG + Intergenic
1082009766 11:47442119-47442141 CAAAGAGAAGTGACTTGATTGGG + Intronic
1087302024 11:96447041-96447063 CACAGGCAAGTGTCATTACTTGG - Intronic
1091014056 11:132033612-132033634 TACAGGAAAGTGACAGCATTAGG - Intronic
1091917986 12:4282857-4282879 CACAGGCCAGGGACGTCACTGGG - Intronic
1092410219 12:8247072-8247094 CACAGGAATGTGACCTTATTTGG + Intergenic
1093664881 12:21800182-21800204 CACAGGCAAGTGACTTCATTTGG - Exonic
1094195281 12:27742999-27743021 CACAGGCAAGTGTCACCATGCGG + Intronic
1095689113 12:45067963-45067985 CTCAGTCATGTGACTTCATTTGG + Intergenic
1095743294 12:45630211-45630233 CACAGGAAAGTGCATTCTTTAGG - Intergenic
1099873652 12:88378365-88378387 AACAGGCATGTGACTTGTTTTGG + Intergenic
1100161785 12:91868894-91868916 CATAGGCAAGTTACTTCTCTGGG - Intergenic
1100428541 12:94509615-94509637 CACATGAAAGTGACTTTATAAGG - Intergenic
1104040787 12:125129140-125129162 CACAGGGAGGGGACTTCATCTGG + Intronic
1104523799 12:129499630-129499652 CACAGGCTGGTGACATCATTAGG + Intronic
1105799114 13:23888511-23888533 CGCAGGCTAGTGACTTCCTGGGG + Intronic
1107869593 13:44734745-44734767 CACAGGCAGGTGGCTTCATGGGG - Intergenic
1110327142 13:74229948-74229970 CACAGTTAAGTGACAGCATTAGG - Intergenic
1112253803 13:97809036-97809058 CACATGTAAGTGACATCATGTGG - Intergenic
1113066120 13:106375497-106375519 AAAAGGCAAATGAATTCATTAGG + Intergenic
1113497882 13:110747287-110747309 CACATGTAACTTACTTCATTAGG + Intergenic
1113715860 13:112506934-112506956 TACAGTCCAGTGACTTCAGTGGG - Intronic
1115053864 14:29098449-29098471 CATAGGCAAGTGCATTGATTTGG + Intergenic
1117004014 14:51400338-51400360 CACATGCAAGTGAGGTCATATGG + Intergenic
1117526059 14:56606253-56606275 AACAGGAAAATTACTTCATTAGG + Intronic
1118732200 14:68676370-68676392 CCAAGGCAAGTGGCTGCATTTGG + Intronic
1127271507 15:57406060-57406082 CACAGGCAAGGCACATCAGTGGG + Intronic
1127301172 15:57655237-57655259 CACAGGCTGGTGGCTCCATTAGG - Intronic
1127728829 15:61779281-61779303 CACAGGAAAGTTCCTACATTAGG - Intergenic
1127749861 15:62025064-62025086 ATCAGGCAGGAGACTTCATTAGG + Intronic
1128449897 15:67799414-67799436 CAGGGTCAGGTGACTTCATTTGG + Intronic
1128685015 15:69677567-69677589 CATCGGCATGTGACTTGATTTGG + Intergenic
1129178738 15:73858255-73858277 CCCAGCCATGTGACTTCTTTTGG + Intergenic
1131824594 15:96308395-96308417 AACAGCTAAGTGATTTCATTTGG + Intergenic
1132156283 15:99497734-99497756 AACAGGCAAATGAATTCAGTAGG - Intergenic
1133312523 16:4859319-4859341 CACGGGCACGTGTCCTCATTAGG - Intronic
1134294868 16:12936673-12936695 CACAAGCCAGTTACTTCATCTGG + Intronic
1136000137 16:27286264-27286286 CACTGGGAGGTGGCTTCATTTGG + Intronic
1140205567 16:72929842-72929864 CACATCCATGTGACTGCATTCGG - Intronic
1140651653 16:77094716-77094738 CACTGGCTAGAGACTTCAATGGG - Intergenic
1141447227 16:84068918-84068940 CATAGGAAAGTGAGCTCATTTGG - Intronic
1144199364 17:12925461-12925483 GACAGGAGAGTGTCTTCATTGGG - Intronic
1147022000 17:37542373-37542395 CAAAAGAAAGAGACTTCATTTGG - Exonic
1149201323 17:54189282-54189304 CACTTGCAAGTAACTTCCTTTGG - Intergenic
1155747999 18:29385226-29385248 CAGAGACAACTGACTTTATTTGG - Intergenic
1157084721 18:44568058-44568080 CATGGGCAAGAGACTTCTTTTGG + Intergenic
1159160317 18:64636431-64636453 CACAGGTCAGTGACTGCCTTGGG + Intergenic
926073473 2:9920934-9920956 CACAGGCTTTTGACTTCATCAGG + Intronic
926178844 2:10621879-10621901 CAGAGTCAAGTGAGATCATTAGG - Intronic
928596074 2:32860352-32860374 CACAGATAAGTGAGATCATTTGG + Intergenic
938671582 2:133591327-133591349 CTGAGGCACGTGACTTCAGTTGG - Intergenic
940515218 2:154676008-154676030 CACAGGCTAGTGACATCAGCTGG - Intergenic
941327713 2:164137858-164137880 TACAGCCATGTAACTTCATTTGG + Intergenic
941797427 2:169615543-169615565 CACATGTAAGTGAGTTCATATGG + Intronic
941872152 2:170397392-170397414 CTCAGGCAGGTAACTTGATTTGG - Intronic
943120500 2:183729036-183729058 GTCAGGCAAGTGACTTATTTAGG - Intergenic
943720041 2:191194333-191194355 CACAGGAAAGTCCCTTCAGTGGG + Intergenic
944976503 2:205059126-205059148 CACAGGCAAATGACTGAAGTTGG - Intronic
944992681 2:205255660-205255682 CTCAGGCAAATGACTTACTTAGG + Intronic
945129657 2:206556771-206556793 CAAAAGCAAATGGCTTCATTTGG + Intronic
945168390 2:206969991-206970013 CTCAGCCATGTGACTTCCTTTGG - Intergenic
947974467 2:234353493-234353515 AATAGGCAAATAACTTCATTTGG - Intergenic
948138124 2:235652426-235652448 CACAGACAGGTGACTTGCTTAGG - Intronic
948257771 2:236580385-236580407 AAGAGGAAAGTCACTTCATTAGG - Intronic
1168817938 20:753687-753709 CACAGGCCAGTGTCTTCTCTCGG - Intergenic
1169943533 20:10963993-10964015 CAGAGGCGAGTGGCTTCAGTGGG - Intergenic
1170232872 20:14069739-14069761 CACAGGGAAGTGACATTCTTTGG - Intronic
1171206088 20:23282667-23282689 CACATGGAAGTATCTTCATTGGG - Intergenic
1171966347 20:31533715-31533737 CACGGCCAAGTGCCTTCTTTGGG - Intronic
1172867171 20:38109196-38109218 CACAGGGAAGTGAAGTCACTTGG - Intronic
1172931918 20:38592380-38592402 CGCATGAAAGTGACTTTATTTGG - Intergenic
1173386208 20:42590290-42590312 CTCAGGTAGGTGGCTTCATTTGG - Intronic
1173574750 20:44105200-44105222 CTCAGGCATGGGACTTGATTTGG + Intergenic
1174067574 20:47876504-47876526 CAGAGACCAGTGACTGCATTTGG - Intergenic
1174516504 20:51096501-51096523 CTCAGGCAAGTGACTTAACCTGG + Intergenic
1175862108 20:62156124-62156146 CGCAAGCCACTGACTTCATTAGG - Intronic
1176191784 20:63814591-63814613 CCCAGGCAAGGGTCCTCATTTGG + Intronic
1179222825 21:39424772-39424794 CACATGCCAATTACTTCATTTGG - Intronic
1184210122 22:43030481-43030503 CACAGGCAAGTGCCTTTCCTGGG - Intergenic
1184652972 22:45927481-45927503 CCTCGGCAAGTGACTTTATTTGG + Intronic
1185081445 22:48711477-48711499 CACAGGCCAGTGATTCCATTAGG - Intronic
949743052 3:7258521-7258543 CACAGACAAATGGTTTCATTGGG + Intronic
950267448 3:11585133-11585155 CACAGTCAAGAGACTTCACTGGG + Intronic
951232882 3:20200187-20200209 CTTAGGGAAGTGATTTCATTGGG - Intergenic
951535977 3:23741261-23741283 CCCAGGGAAATGAGTTCATTTGG - Intergenic
955331265 3:58049615-58049637 CACAGGCAAGAGGCTCCATCAGG - Intronic
955772142 3:62395816-62395838 CAAAGGCAATCAACTTCATTTGG + Intergenic
956670213 3:71682119-71682141 CACAGGCACTTGCCTACATTGGG - Exonic
956674013 3:71717755-71717777 CTCAGGCAAGTTACTTCTCTGGG + Intronic
957144524 3:76406493-76406515 CACAGGTAAGTGATTTGATAAGG + Intronic
958139802 3:89547771-89547793 CACAGGCAAGAGACATGAATTGG + Intergenic
958877025 3:99628118-99628140 CACAGGCAAATAAATGCATTTGG + Intergenic
959109646 3:102106590-102106612 CACATGCAAGTGAGATCATGTGG + Intronic
959205825 3:103305025-103305047 CACAGGGTACTGACTGCATTTGG - Intergenic
961251843 3:125513726-125513748 CAAAGGGAAGTGATTTCAATAGG - Intronic
961787554 3:129356922-129356944 CACAGGAACGTGACTGCATGGGG - Intergenic
964423270 3:156527231-156527253 CACAGGCAAGTTACTTAACCTGG + Intronic
966796962 3:183724667-183724689 CACAGTCTAGAGACTTTATTAGG + Intronic
968260351 3:197317371-197317393 CTCAGGCAAGTCACTTCTCTGGG - Intergenic
968799747 4:2734018-2734040 CACAGGGAAGTGATGTCATCAGG - Intergenic
969046793 4:4342190-4342212 CACAGTCAAGGGACTGCATCTGG - Intergenic
971324596 4:25633700-25633722 CACAGGCACGTGTCTTCAGCTGG - Intergenic
973312660 4:48726332-48726354 CACAGTCATGTGACTTCTGTTGG + Intronic
974297471 4:60020588-60020610 CACTGGGAAGTGAGTTCACTGGG + Intergenic
974686528 4:65238570-65238592 CACAGATTATTGACTTCATTTGG - Intergenic
974732978 4:65894115-65894137 CTCAAGCATGTGACTACATTAGG - Intergenic
977990775 4:103438759-103438781 CACATGTAAGTGACATCATATGG + Intergenic
978682005 4:111392654-111392676 CACATGCTATTGACTACATTTGG - Intergenic
982993430 4:162309596-162309618 GGCAGGCAAGTGAACTCATTAGG + Intergenic
983405500 4:167324424-167324446 CACAGGCAAGAGAATGCATTTGG - Intergenic
991321917 5:65383622-65383644 CACAGGCACATGACTACAATTGG - Intronic
993870308 5:93245364-93245386 CTGAGGCAAGCGACTTCTTTTGG + Intergenic
996938966 5:128981071-128981093 CACATGCAATGTACTTCATTAGG - Intronic
1000517224 5:162252944-162252966 AAAAGGCATGAGACTTCATTGGG - Intergenic
1002310122 5:178309169-178309191 CACAGGCAGATGTCTTCATCTGG - Intronic
1002871516 6:1170752-1170774 CACAGACAAGTGAGGTAATTGGG - Intergenic
1003177882 6:3766864-3766886 CACAGGCAAGTGAAATCCATCGG - Intergenic
1005043896 6:21623683-21623705 TACATGCAAGTTAATTCATTAGG + Intergenic
1008207009 6:48672907-48672929 CACACACAAGTGACTTCAGGAGG + Intergenic
1009902207 6:69821280-69821302 CTCAGGAAAGTGACCTCATTTGG + Intergenic
1011195536 6:84775163-84775185 CAGAGGCCAGTGCCTTCTTTAGG - Intergenic
1012127082 6:95443651-95443673 CACAGCCATGTGACCTCTTTTGG + Intergenic
1012507419 6:99963959-99963981 AAATGGCAAGTGACTTCAATAGG + Intronic
1014229118 6:118882318-118882340 CACAAGAAACTGACTTTATTTGG + Intronic
1015762101 6:136674223-136674245 TAAAGGAAAGTGATTTCATTTGG + Intronic
1016629582 6:146212833-146212855 CACAGGGAAGTGATATCAGTTGG - Intronic
1016882771 6:148927282-148927304 TACAGGCTAGTGAGTTCATCAGG + Intronic
1017274116 6:152546083-152546105 CACAGTCAAATGACTTGATTTGG + Intronic
1017629720 6:156384642-156384664 GACAGGCAGGTGACATGATTTGG + Intergenic
1018334138 6:162766286-162766308 CACATGCAAGTGAGTGCATATGG + Intronic
1019446007 7:1071733-1071755 CTCAGTCAAGTGACCACATTCGG + Intronic
1021199156 7:17708485-17708507 CACAAGCAAATGAATGCATTTGG + Intergenic
1023226544 7:37975698-37975720 CTCAGCCATGTGACTTGATTTGG - Intronic
1023520298 7:41043712-41043734 AAAAGGCTACTGACTTCATTTGG - Intergenic
1026543186 7:71298761-71298783 CACAGGCTAGTGCCTTCTTTGGG + Intronic
1027770454 7:82399955-82399977 CACAGGCAAGCTACTCCATTAGG + Intronic
1028834930 7:95364449-95364471 CACAGCCATGTGACTTGCTTTGG + Intronic
1031327072 7:120415010-120415032 CACAGATAGTTGACTTCATTGGG - Intronic
1032665288 7:134029967-134029989 CTCAAGCAAGTGACTTCTTTAGG - Intronic
1033035450 7:137871888-137871910 CCTAGACAAGTGACATCATTAGG + Intergenic
1033486787 7:141797966-141797988 CACATGTAAGTGAGATCATTAGG + Intergenic
1033830406 7:145244827-145244849 CACAGCCATGTGACTTGATCTGG + Intergenic
1033842339 7:145389838-145389860 CACAGGCCAGTGCCTTTACTGGG + Intergenic
1034283024 7:149866612-149866634 CACCGGCCAGTGCCTTCCTTAGG + Exonic
1035742147 8:1936545-1936567 CACAGGAAAGTGTCTTCAGTTGG + Intronic
1035929184 8:3762545-3762567 CACAGGCGTGTAACTCCATTTGG + Intronic
1037783347 8:21886356-21886378 CAGAGGCAAGTGGCATCCTTCGG - Intergenic
1038662296 8:29507598-29507620 CATAGGCAAGTGCCTTTATTGGG + Intergenic
1038795059 8:30702645-30702667 CCCAGCCAAGAGATTTCATTTGG - Intronic
1040652797 8:49467725-49467747 CAAAGGAAAGTGTCTTCAATAGG + Intergenic
1041331911 8:56735830-56735852 AACAGGAAAGTGACTCCAGTAGG - Intergenic
1041374629 8:57201097-57201119 CACAGGCGAGTCACTGCATCTGG + Intergenic
1041433423 8:57809999-57810021 CACAGGGAAGTGAATTGAATGGG + Intergenic
1045425874 8:102065313-102065335 AACAGGCAAGCGGCTTCCTTGGG - Intronic
1045702400 8:104881796-104881818 CACATGCAAGTGACTTCAGGAGG + Intronic
1046184169 8:110691127-110691149 CACAACCAAGAGATTTCATTTGG - Intergenic
1046849670 8:118957927-118957949 GGCAGGCAATTGACTTCACTGGG - Intergenic
1048418346 8:134251653-134251675 CAAAGGCAAGAGAATTTATTTGG - Intergenic
1048759824 8:137781810-137781832 CAAAGTCAAGTGACTTCCCTCGG - Intergenic
1049359494 8:142205577-142205599 CACAGGCAAGCGCCCTCAGTGGG + Intergenic
1050261192 9:3842532-3842554 CACAGGCAAATTGCTTCCTTTGG + Intronic
1050811092 9:9748770-9748792 CACAGCAAAGTGATTTCATTTGG + Intronic
1051058762 9:13021150-13021172 CACATGTAAGTGACATCATGCGG - Intergenic
1053169054 9:35865328-35865350 TACAGGCGAGGGACTTTATTAGG + Intergenic
1055673604 9:78632305-78632327 GACAGACAAGTGACTGCAGTGGG - Intergenic
1055734961 9:79317139-79317161 CACAGCTAAGTGTCTACATTAGG - Intergenic
1057571128 9:96204768-96204790 CACAGCCAAGTGACTCCCTTGGG + Intergenic
1059833184 9:118121484-118121506 TTCAGGCAAGTGACATCAATTGG + Intergenic
1062151717 9:135022718-135022740 CACAGGCAAGTGAGCTCAGCTGG - Intergenic
1187220982 X:17325714-17325736 AACAGGCAATGGACTGCATTTGG - Intergenic
1187531109 X:20097802-20097824 CAAAGGCAAGTGATTTTTTTGGG - Intronic
1187619366 X:21032871-21032893 AACAGGCAAATGACTTGATTAGG + Intergenic
1191823006 X:65333761-65333783 CACAGACAATTGACTTGTTTTGG - Intergenic
1196027270 X:111054294-111054316 CACTGGAAAGTGGCTTCACTGGG - Intronic
1197313344 X:124932998-124933020 CACAGTCAAGTCACTACACTTGG + Intronic
1197724873 X:129769526-129769548 CAGAGGCAAGTGTCTTTGTTAGG - Exonic
1199870676 X:151895633-151895655 CAAAGAGAAGTGACTTCAGTGGG - Intergenic
1199901722 X:152179790-152179812 CACATGTAAGTGACATCATGTGG + Intronic
1200013217 X:153136618-153136640 CACAAGCAAGTGAATTCAAAGGG + Intergenic
1200026385 X:153263305-153263327 CACAAGCAAGTGAATTCAAAGGG - Intergenic
1200809851 Y:7472877-7472899 CACATCCAAGTGGCTACATTTGG - Intergenic