ID: 1093665074

View in Genome Browser
Species Human (GRCh38)
Location 12:21802840-21802862
Sequence CACCCTATCTACATGGCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 110}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093665074 Original CRISPR CACCCTATCTACATGGCCCA GGG (reversed) Intronic
902625108 1:17671838-17671860 CATCCTATCCCCATGGCCCAAGG + Intronic
902638343 1:17750162-17750184 CACCCTGGCTACATGACCCTGGG - Intergenic
907312400 1:53546405-53546427 CACCCCATCCAGATGGCTCAGGG - Intronic
907981412 1:59485408-59485430 CAGCCAATCTACCTGACCCAGGG - Intronic
910429144 1:87144047-87144069 CAACCAATCCACATAGCCCAGGG + Intronic
912824882 1:112896270-112896292 AACACTCACTACATGGCCCAAGG - Intergenic
917189448 1:172399139-172399161 CAGACTCTTTACATGGCCCAGGG + Intronic
920436692 1:205951491-205951513 GACCCTGTCTTCATGACCCATGG - Intergenic
921799134 1:219381558-219381580 CACTCTATTTTCCTGGCCCAGGG - Intergenic
922030308 1:221791093-221791115 CATTCTATCTTCATGGCCCAAGG + Intergenic
1067471873 10:46543519-46543541 CATCCTATGAACATGGCCCCAGG - Intergenic
1069590464 10:69638595-69638617 CTCCCTTTCTCCAGGGCCCAAGG + Intergenic
1070955340 10:80459901-80459923 GACCCTGTCTGCCTGGCCCAGGG - Intronic
1071336961 10:84608225-84608247 CACCCTTTCTTCATGTCCCAAGG - Intergenic
1078913083 11:15751456-15751478 CAACCTTTCTACATGCCCCCAGG + Intergenic
1082794157 11:57368109-57368131 CACCCCATCTGCCTGGCCCATGG - Intronic
1083191477 11:61055530-61055552 CACCCTGTCTTCCTGTCCCAGGG - Intergenic
1083209520 11:61174451-61174473 CAGCTTATCTACATGGCCCTGGG - Intergenic
1087180740 11:95140049-95140071 CTCCCAAACTACCTGGCCCAGGG - Intergenic
1087324645 11:96706749-96706771 CAGCATAACCACATGGCCCAGGG + Intergenic
1088819404 11:113444632-113444654 CACCATTTATAGATGGCCCATGG - Intronic
1093665074 12:21802840-21802862 CACCCTATCTACATGGCCCAGGG - Intronic
1102245927 12:111355739-111355761 TACCCTCTCTTCATGGTCCAGGG - Intergenic
1102587069 12:113930890-113930912 CAACCTAGCTGCATGGCCCTGGG + Intronic
1103556029 12:121766927-121766949 CCCACTGTCTAGATGGCCCAAGG + Intronic
1103802593 12:123549034-123549056 AACACTAACCACATGGCCCAAGG + Intergenic
1108082750 13:46754133-46754155 GACACTCTGTACATGGCCCATGG + Intergenic
1108181149 13:47841219-47841241 CACCCCACCTACATGGCAGAAGG + Intergenic
1111871380 13:93837324-93837346 AACCCTATCTAAATGTACCATGG + Intronic
1115333827 14:32225605-32225627 CACCATAACTGCATGCCCCAAGG - Intergenic
1120884703 14:89442660-89442682 CAGCCCATGTCCATGGCCCACGG + Intronic
1121999598 14:98635928-98635950 CACCCTTTCTACAGGGGCCAGGG + Intergenic
1122562854 14:102629171-102629193 CTCCCCATCCACATAGCCCATGG + Intronic
1122898266 14:104771260-104771282 CACCCTGCCTCCATGGCTCAGGG + Intronic
1122952584 14:105053736-105053758 TGCCATATCTACATGTCCCAAGG - Intronic
1127693968 15:61425866-61425888 CACCCTGTCTACATTGCCGATGG + Intergenic
1127821386 15:62659139-62659161 CTCCCTTTCTCCATAGCCCAGGG + Intronic
1128092096 15:64926151-64926173 CACCTTGTCTACGTGGTCCAGGG - Exonic
1133310102 16:4839940-4839962 GACCCTATCCACCTGGGCCAGGG + Intronic
1136655059 16:31704545-31704567 CTCTCTAACTTCATGGCCCAGGG + Intergenic
1137576649 16:49604427-49604449 AACCCCATCTAGTTGGCCCACGG + Intronic
1141146750 16:81536313-81536335 CACCCTCCCTGCATGGCGCAAGG - Intronic
1142851223 17:2705793-2705815 CACCCAATCCACATGCTCCAGGG + Intronic
1143526966 17:7478807-7478829 CTTTCTATCTCCATGGCCCAGGG + Intronic
1143840363 17:9726830-9726852 CACACAACCTACATGGCGCAAGG - Intronic
1146552436 17:33792932-33792954 CACCCTCTCCAAATGGCCAAGGG + Intronic
1146820862 17:35982825-35982847 AAACCTATCTTCAGGGCCCAAGG - Intergenic
1148229865 17:45925208-45925230 CGCCCATTCTACCTGGCCCATGG - Intronic
1148237166 17:45976572-45976594 CACCCCAACTGGATGGCCCATGG - Intronic
1152456331 17:80418679-80418701 CACCCCAACTCCAAGGCCCAAGG - Intronic
1163326174 19:16604760-16604782 CACCCTAGCTACAGGGGGCAGGG + Intronic
1164850408 19:31478479-31478501 CACACTCCCTACATTGCCCAGGG - Intergenic
1165258556 19:34594740-34594762 CACCCCAACAGCATGGCCCAGGG - Exonic
1167690029 19:50979728-50979750 TACCCTGTCTGCATGCCCCAGGG - Intronic
1167710772 19:51109115-51109137 CACCCTCCCCACAAGGCCCAAGG + Intergenic
925742412 2:7017792-7017814 CACCCTGTGAACATGGCCCCAGG - Intronic
926785167 2:16511142-16511164 TTCTCTATCTAGATGGCCCAGGG - Intergenic
926852515 2:17215150-17215172 CACCCAATCCACATGTGCCATGG - Intergenic
928767092 2:34660220-34660242 CTTCCTAACTCCATGGCCCAGGG + Intergenic
932737322 2:74263563-74263585 CACTCTCTCTAAATGGCCCCAGG + Intronic
937817965 2:126274689-126274711 TACACTTTATACATGGCCCATGG - Intergenic
946797611 2:223372421-223372443 CACTCTATATACCTGGGCCAAGG + Intergenic
947731689 2:232434893-232434915 CACCCTTTCTGCAGGGACCATGG + Intergenic
948632291 2:239309913-239309935 CACCCTCCCTTCATGCCCCATGG - Intronic
1168787107 20:549213-549235 CACCCAATGTACAAGGCCAAAGG - Intergenic
1174547860 20:51339454-51339476 CACTCTTTCTAGATGGCACAAGG + Intergenic
1175479760 20:59302464-59302486 CACTCTCTCCACATGGCCCCAGG - Intronic
1175595863 20:60232217-60232239 AACCATATCTACATGACCCTCGG + Intergenic
1177045268 21:16161053-16161075 CACCTTATATACATAGCCTAAGG + Intergenic
1181495996 22:23287865-23287887 CACCCGAACTACATGGGTCAGGG - Intronic
1183355710 22:37358177-37358199 GATCCTATTCACATGGCCCACGG + Intergenic
1183698316 22:39435756-39435778 CACCCCCTCTTCATGGCCAAAGG - Intronic
1185224866 22:49646677-49646699 CACCCCAGCCACATGGCCCTAGG + Intronic
950535248 3:13574684-13574706 CTCCCTTTCTGCAGGGCCCAGGG + Intronic
953742830 3:45551955-45551977 CACCCTGTATACAGGGGCCATGG + Intergenic
968068560 3:195772251-195772273 CACCCTCTCTCCATCGCTCAGGG + Intronic
968068578 3:195772340-195772362 CACCCTCTCTCCATCGCTCAGGG + Intronic
968068606 3:195772460-195772482 CACCCTCTCTCCATCGCTCAGGG + Intronic
968068633 3:195772580-195772602 CACCCTCTCTCCATCGCTCAGGG + Intronic
968068687 3:195772819-195772841 CACCCTCTCTCCATCGCTCAGGG + Intronic
968068709 3:195772919-195772941 CACCCTCTCTCCATCGCTCAGGG + Intronic
968068721 3:195772979-195773001 CACCCTCTCTCCATCGCTCAGGG + Intronic
968068728 3:195773009-195773031 CACCCTCTCTCCATCGCTCAGGG + Intronic
968068760 3:195773156-195773178 CACCCTCTCTCCATCGCTCAGGG + Intronic
970764553 4:19531912-19531934 CACCCTTTCTTCATGGGGCATGG + Intergenic
970962491 4:21889263-21889285 CACATTATATACATAGCCCAAGG - Intronic
978114465 4:105002898-105002920 CAGCCTGACTGCATGGCCCAAGG - Intergenic
979111320 4:116761461-116761483 CACCCTATGTCCATGTCCCCTGG - Intergenic
983284503 4:165722118-165722140 CACTCTAACTACTTGACCCATGG + Intergenic
984231756 4:177108923-177108945 CACACTATTTAGATGGCTCATGG + Intergenic
992907051 5:81356963-81356985 AAGCCTCTCGACATGGCCCAGGG + Intronic
998152208 5:139763992-139764014 CACCCTGACTACATGGCCTCTGG + Intergenic
1001016722 5:168148576-168148598 CATCCCATCCACGTGGCCCAGGG - Intronic
1001867381 5:175117231-175117253 CTCCCTCTCTCCATGGCTCATGG + Intergenic
1002124128 5:177029044-177029066 CACCCTATTAACATGTACCAAGG - Intronic
1007839355 6:44702992-44703014 CATCCTGTGTACCTGGCCCAAGG - Intergenic
1012122226 6:95383791-95383813 CAGCCACTCTACATGGGCCATGG - Intergenic
1016653760 6:146494159-146494181 CACCCTGTCTTCATAGACCATGG + Intergenic
1026583690 7:71638519-71638541 CACCCTCTTTTCAAGGCCCAGGG - Intronic
1030668849 7:112312048-112312070 CACCCTGTCTATAATGCCCAGGG + Intronic
1034459337 7:151189919-151189941 CACACTGTGTACATGGTCCATGG + Intergenic
1034815908 7:154171692-154171714 CACCCTGTCCACGTGGCCCTGGG - Intronic
1035746223 8:1963576-1963598 CACCCTGTGTAGATGGCACATGG + Intergenic
1038388180 8:27169007-27169029 CATCCCAGCTACATGGCCTAAGG - Intergenic
1039010252 8:33085960-33085982 GACCATAGCTCCATGGCCCAGGG + Intergenic
1039153570 8:34530213-34530235 CTCCCTCTCCCCATGGCCCACGG - Intergenic
1042390867 8:68232102-68232124 CACCCAGTATTCATGGCCCAAGG - Exonic
1047520857 8:125594408-125594430 CACCCCATCCACATGTCACAAGG + Intergenic
1047718201 8:127615212-127615234 TCCCCTAAGTACATGGCCCAAGG + Intergenic
1049270153 8:141691319-141691341 CTCCTCACCTACATGGCCCATGG + Intergenic
1053200311 9:36147672-36147694 CAGCCTGTCCACATGGCCTAAGG + Intronic
1187972992 X:24677098-24677120 CACCCTGTCTCCTTGGCCCATGG - Intergenic
1188319634 X:28720672-28720694 CAGCATACCCACATGGCCCATGG - Intronic
1191152518 X:57235027-57235049 GACTCTGTCTCCATGGCCCAGGG + Intergenic
1197610491 X:128632965-128632987 CACCCTCTCTACATGCATCATGG + Intergenic
1197640872 X:128966682-128966704 CACCCTAGCTCCTTGTCCCATGG - Intergenic
1198957114 X:142145545-142145567 TTCATTATCTACATGGCCCACGG + Intergenic
1200172006 X:154083792-154083814 CACCCTATCCACTGGGCCCCTGG - Intronic
1200894600 Y:8361472-8361494 CACCCTGTCTACAGGGAACATGG - Intergenic