ID: 1093670042

View in Genome Browser
Species Human (GRCh38)
Location 12:21862756-21862778
Sequence CTGGAAGTTCCAGCCCATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 450
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 423}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093670042_1093670046 24 Left 1093670042 12:21862756-21862778 CCAAGATGGGCTGGAACTTCCAG 0: 1
1: 0
2: 2
3: 24
4: 423
Right 1093670046 12:21862803-21862825 TTCAAAAGACCTTGGTGATGAGG 0: 1
1: 0
2: 0
3: 15
4: 187
1093670042_1093670045 16 Left 1093670042 12:21862756-21862778 CCAAGATGGGCTGGAACTTCCAG 0: 1
1: 0
2: 2
3: 24
4: 423
Right 1093670045 12:21862795-21862817 AGAATTGATTCAAAAGACCTTGG 0: 1
1: 0
2: 2
3: 23
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093670042 Original CRISPR CTGGAAGTTCCAGCCCATCT TGG (reversed) Intronic
900136579 1:1120231-1120253 CTGGGAGTTCCAGACCAGCCGGG - Intergenic
900408147 1:2501415-2501437 CTGGGAGTCTGAGCCCATCTTGG + Intronic
901366569 1:8756083-8756105 CTAGAAGTTCAAGACCAGCTTGG + Intronic
902892847 1:19457045-19457067 CTGGAACTTCCTGCCTTTCTGGG - Intronic
903186163 1:21630463-21630485 CCGGAAGTTCCAGACCAGCCTGG - Intronic
903576835 1:24344579-24344601 CTGCAATTCCCAGCCCTTCTGGG + Intronic
903856644 1:26341852-26341874 CTGGAAATCACAGCCCTTCTTGG + Intronic
904806989 1:33139267-33139289 CTGTAAGTTCCCTCCCATCTTGG + Intergenic
905539821 1:38751362-38751384 CTGGGAGTTCCAGCCTCACTGGG + Intergenic
905718922 1:40179042-40179064 CTGGAAGTTCCAGACCAGCCTGG - Intronic
905817124 1:40960349-40960371 CTGGGAGTTCAAGACCATCCGGG - Intergenic
906127769 1:43438053-43438075 CTGGAGGCTCCAGACCCTCTGGG + Intronic
906715655 1:47966494-47966516 CTGGTGATTCCAGCCCACCTGGG + Intronic
909141780 1:71876389-71876411 CTGGTAGTCCCAGCTAATCTAGG + Intronic
910316729 1:85893850-85893872 CTGGGAGTTCAAGACCAGCTAGG - Intronic
910340618 1:86182837-86182859 CCGGAAGTTCGAGACCAGCTTGG - Intergenic
911060144 1:93740487-93740509 CTGGAAGTTCAGGCCCACCCAGG - Intronic
911264716 1:95729707-95729729 TTGGAAGTTCCAGACCAGCCTGG + Intergenic
913164218 1:116170081-116170103 CTGGGAGTTCCAGACCAGCCTGG - Intergenic
913508193 1:119538507-119538529 AAGGAAGTTCCAGCCCATCATGG - Intergenic
914377735 1:147087348-147087370 CAAGAAGTTCCAGACCAGCTTGG + Intergenic
916454825 1:164960002-164960024 CTGCAAGTTCCCTTCCATCTCGG + Intergenic
917508864 1:175653228-175653250 CTGGAAGTTGGAGTCAATCTAGG + Intronic
918593726 1:186268968-186268990 TTGGGTGTTCCAGCCCAACTAGG - Intergenic
918978535 1:191524664-191524686 CAGGGAGTTCAAGACCATCTTGG - Intergenic
919369013 1:196701798-196701820 TTGGAAGATGCAGCCCATCAGGG - Intronic
920154436 1:203937089-203937111 TTGGAAGTTCGAGACCACCTTGG + Intergenic
921442656 1:215206074-215206096 CTGGAATTTACAGCCCATGAAGG - Intronic
922766189 1:228157763-228157785 CAGGAAGCTCCAGCTCATGTTGG - Exonic
923120619 1:230986744-230986766 CCAGAAGTTCGAGCCCATCCTGG - Intronic
924299814 1:242625902-242625924 CTTGAAGTTCCTGCCCACCCTGG - Intergenic
924545957 1:245028097-245028119 CCGGAAGTTCAAGCCCAGCCTGG - Intronic
1062971333 10:1651530-1651552 CTGGAAGTTCCATCCAGTCAGGG - Intronic
1064637110 10:17379627-17379649 CTGGAAGTTCCCTCCCTGCTTGG + Intronic
1064988507 10:21235083-21235105 CTGGTAGTTCCAGACCAGCCTGG + Intergenic
1065202008 10:23321995-23322017 CTGGGAGTTCAAGACCAGCTTGG - Intronic
1065487661 10:26250223-26250245 CTAGGAGTTCAAGACCATCTTGG - Intronic
1065644430 10:27819527-27819549 CCAGAAGTTCAAGACCATCTTGG + Intronic
1066127920 10:32360682-32360704 CCGGAAGTTCGAGACCAGCTTGG + Intronic
1068631089 10:59298304-59298326 CTGGAATTTCAAGGCCATATAGG - Intronic
1069759424 10:70798390-70798412 CAGGGAGCTCCAGCCCAACTCGG + Intergenic
1069963163 10:72090686-72090708 CTAGGAGTTCCAGACCATCGTGG + Intergenic
1070598023 10:77846485-77846507 TTGGAAGTTCCAGACCAGCCTGG + Intronic
1070808452 10:79285005-79285027 CAGGAAGATGCAGCCCTTCTTGG + Intronic
1070911076 10:80118923-80118945 CTGGGAGTTCAAGACCAGCTTGG - Intergenic
1072264962 10:93718563-93718585 CTGGAAGTTCAAGGCCAGCCTGG - Intergenic
1072657644 10:97341473-97341495 CTGGAAGTTCAAGACCAGCCTGG - Intergenic
1072927232 10:99626722-99626744 ATGGAAATTTCAGCCCATGTGGG + Intergenic
1072957189 10:99897701-99897723 CTGAGAGTTCCAGACCAGCTTGG + Intronic
1074711370 10:116180759-116180781 TTGGACGTTCCATCCCCTCTGGG + Intronic
1075122878 10:119677006-119677028 CAGGAAGGTTCAGACCATCTTGG + Exonic
1075474764 10:122724528-122724550 CTGGAATTTCCAGCTGACCTTGG - Intergenic
1075533149 10:123247219-123247241 CTAGAAGTTCGAGACCATCCTGG - Intergenic
1076755269 10:132567353-132567375 CTAGGAGTTCAAGACCATCTTGG - Intronic
1078076424 11:8165996-8166018 CTGGGAGTTCGAGACCAGCTTGG - Intronic
1078340594 11:10495697-10495719 CTGGATGATCCAGCGCATGTTGG - Exonic
1078356566 11:10636384-10636406 CTGGAAGTTCAAGACCAGCCTGG - Intronic
1078367435 11:10718411-10718433 ATGGAAGTGCCAGCCGGTCTTGG - Intergenic
1079025001 11:16940116-16940138 CTGGAAGTTACAGCCCAGTAGGG - Intronic
1079686505 11:23365411-23365433 CTGGAAGTGATAGCCCATCTGGG - Intergenic
1080171662 11:29310942-29310964 GTGGATGTTCCAACACATCTTGG + Intergenic
1081972191 11:47207092-47207114 CAGGAAGTTCAAGACCATCCTGG + Intergenic
1081989830 11:47331923-47331945 CTGGAAGCTATTGCCCATCTGGG + Intronic
1083413523 11:62510252-62510274 CAGGAAGTTCCAGACCAGCCTGG - Intronic
1083646628 11:64175239-64175261 CTGGAAGTTCAAGACCAGCCTGG + Intergenic
1087406040 11:97732092-97732114 CTGGAAGTTCCATCCCAGGGGGG - Intergenic
1089189268 11:116642405-116642427 AGGGAAGTTCTAGTCCATCTTGG - Intergenic
1089931145 11:122313840-122313862 CTGGGAGTTCCAGACCAGCCTGG + Intergenic
1089948030 11:122497674-122497696 CTAGAAGTTCAAGCCCAGCCTGG + Intergenic
1090393847 11:126406474-126406496 CTGGAAGCTCCTGGCCATGTTGG + Exonic
1091158509 11:133397198-133397220 TTGGAAGATCCAGCCCAACTGGG - Intronic
1091432126 12:445281-445303 CTGGGAGTTCAAGACCAGCTTGG - Intergenic
1091975876 12:4824584-4824606 CTGGAAGTTCTCGCTGATCTCGG - Intronic
1093670042 12:21862756-21862778 CTGGAAGTTCCAGCCCATCTTGG - Intronic
1093976344 12:25426412-25426434 CTGGAAGTTCCAAACCAGCCTGG - Intronic
1094064484 12:26348776-26348798 CTGGGAGTTTGAGACCATCTTGG + Intronic
1095297761 12:40546432-40546454 CTGGAAGTTCCAGTACAGGTAGG + Exonic
1095623872 12:44290848-44290870 TTGGAAGTTCCAGACCACCCTGG - Intronic
1096410077 12:51370809-51370831 CTGGGAGTTCCAGACCAGCCTGG + Intronic
1096562058 12:52442803-52442825 CTGGAAATTCCAGCCCACATTGG - Intergenic
1098267394 12:68736624-68736646 CTAGAAGTTCAAGACCAGCTTGG - Intronic
1101295432 12:103418923-103418945 CTGGTAGTCTCAGCCCATCAGGG + Intronic
1101521161 12:105483715-105483737 TTGGAAGTTCAAGACCAGCTTGG + Intergenic
1101786106 12:107884906-107884928 CTGGGAGTTCCAGACCAGCCTGG - Intergenic
1101856503 12:108447985-108448007 CTGGGAGTTCCAGACCAGCCTGG - Intergenic
1102188740 12:110969872-110969894 CTGGGAGTTCAAGACCAGCTTGG + Intergenic
1102713667 12:114951516-114951538 CTGGAAGTTCAAGACCAGCCTGG - Intergenic
1102783118 12:115582755-115582777 CTGGGAGTTCGAGGCCAGCTTGG + Intergenic
1102978242 12:117221867-117221889 CTGGAAGTTCAAGACCAGCCTGG - Intronic
1103265432 12:119626260-119626282 CTGGAAGTTCGAGACCAGCCTGG + Intronic
1103564059 12:121806590-121806612 CTGGAAGTGGCAGCCAATCTGGG + Intronic
1103885288 12:124195830-124195852 CTGGAATTTCCAGCACCTCGTGG + Intronic
1103911102 12:124352869-124352891 CAGGGACTTCCTGCCCATCTTGG - Intronic
1103966288 12:124641922-124641944 AGGGAGGCTCCAGCCCATCTCGG + Intergenic
1104704258 12:130931450-130931472 CTGGAAGTTCGAGACCAGCCTGG + Intergenic
1105245087 13:18642532-18642554 CAGGTAGGTCCAGCCCATCCTGG + Intergenic
1105272228 13:18888149-18888171 CTGGGAGTTCCAGACCAGCCTGG + Intergenic
1105487545 13:20851497-20851519 CTGGAAGTTTGAGACCAGCTTGG + Intronic
1105509902 13:21042476-21042498 CTGGAAGTTCCAGTCCAGCCTGG + Intronic
1105625039 13:22104566-22104588 CAGGAAGTTCAAGACCAACTTGG - Intergenic
1106481767 13:30142350-30142372 CTGGAAGTTCAAGACCAGCCTGG - Intergenic
1108359380 13:49655144-49655166 CTGGAAGTTCAAGACCAGCCTGG - Intergenic
1108831521 13:54485197-54485219 CTGGAAGTTACTGAACATCTTGG - Intergenic
1109630277 13:65036057-65036079 TTGGGAGTTCCAGACCAGCTTGG - Intergenic
1112401986 13:99086024-99086046 CTGGGAGTTGCAGCCCCTCCAGG + Intronic
1113458249 13:110464224-110464246 CTGCCAGTCCCAGCCCAGCTGGG + Intronic
1113483912 13:110640960-110640982 CTGGCAGCTGCAGGCCATCTTGG - Intergenic
1115062050 14:29203983-29204005 CTGGAAGTTCAAGCTCAGTTAGG - Intergenic
1115267003 14:31510838-31510860 CTGGGAGTTCAAGCCCAGCCTGG + Intronic
1116468818 14:45264143-45264165 CTGGGAGTTCCAGACCAGCCCGG - Intergenic
1116865336 14:50027196-50027218 ATGGAAATTCCATCCCAACTGGG - Intergenic
1117975752 14:61295073-61295095 CTGGAAGTTCGAGACCAGCCTGG - Intronic
1119515120 14:75241912-75241934 CTGGGAGTTCCAGACCAGCCTGG + Intronic
1119990773 14:79194785-79194807 CTGTAAGGCCCAGCTCATCTAGG - Intronic
1120142226 14:80941791-80941813 CTGGGAGTTGTAGTCCATCTCGG + Intronic
1121122674 14:91385752-91385774 CTAGAAGTTCCAGACCAGCCTGG + Intronic
1121189860 14:92017330-92017352 CTAGAAGTTCCAGACCAGCCTGG + Intronic
1121376916 14:93419852-93419874 CCAGAAGTTCCAGACCAGCTTGG + Intronic
1121771718 14:96549941-96549963 CTGGGAGTTCAAGACCATCCTGG + Intronic
1121975883 14:98403800-98403822 CCAGAAGTTCAAGACCATCTTGG + Intergenic
1122102056 14:99420541-99420563 CAGAAAGCTCCAGCCCATGTGGG + Intronic
1122346139 14:101061736-101061758 CTTGGTGTTCCAGCCCCTCTAGG + Intergenic
1122814647 14:104306547-104306569 CTGGAGTTTTCAGCCCCTCTGGG + Intergenic
1123916297 15:25031801-25031823 CTGGGAGTTCAAGACCAGCTTGG - Intergenic
1124134421 15:27021629-27021651 CTGGAAGTTCAAGACCAGCCTGG + Intronic
1124838952 15:33224063-33224085 CTGGAAGTTCAAGACCAGCCTGG + Intergenic
1127430474 15:58902599-58902621 CTGGGAGTTCCAGACCAGCCCGG - Intronic
1129020645 15:72514494-72514516 CTGGGAGTTCGAGACCAGCTTGG + Intronic
1130534781 15:84776544-84776566 CTAGAAGTTTGAGACCATCTTGG + Intronic
1130770106 15:86915734-86915756 ATGGAAGTCCCACCACATCTTGG - Intronic
1132119303 15:99162868-99162890 CTGGAAGTTCAAGACCAGCTTGG + Intronic
1132358058 15:101187926-101187948 CAGGAACTTCTAGCCCAGCTGGG + Intronic
1133002655 16:2858833-2858855 CTGGGAGTCCCAGCCCTTCCCGG - Intergenic
1133161397 16:3914420-3914442 CTGTAAGTTCGAGACCATCCTGG - Intergenic
1133264921 16:4577319-4577341 CTGGAAGTTCGAGACCACCCTGG + Intronic
1133285474 16:4688696-4688718 CTGGATGGCCCAGCCCCTCTGGG + Intronic
1134153203 16:11821230-11821252 TTGGAAGTTCAAGACCAGCTTGG + Intergenic
1134398198 16:13884858-13884880 CTGGGAGTTCGAGGCCAGCTTGG - Intergenic
1134601202 16:15535138-15535160 CTAGAAGTTCAAGACCAGCTTGG + Intronic
1134604768 16:15561681-15561703 CTAGGAGTTCTAGACCATCTTGG + Intronic
1134880359 16:17740644-17740666 CTGGGAGTTCAAGCCCAGCCTGG - Intergenic
1135409331 16:22221275-22221297 CTGGAAGTTCAAGACCAGCCTGG + Intronic
1135418432 16:22287371-22287393 CAGGACATTCCAGCCCAACTGGG + Exonic
1136179422 16:28540720-28540742 CTGGGAGTTCAAGGCCAGCTTGG + Intergenic
1136471374 16:30483034-30483056 CTGGGAGTTCCAGACCATTCTGG - Intronic
1136582772 16:31163780-31163802 CTGGGAGTTCCAGACCAGCCTGG + Intergenic
1137324106 16:47415882-47415904 TTGGGAGTTCGAGCCCAGCTTGG + Intronic
1137329199 16:47473282-47473304 CTGGGAGTTCCAGACCAGCCTGG - Intronic
1137636455 16:49991168-49991190 CTGGGAGTTCCAGACCAGCCTGG + Intergenic
1137644916 16:50065767-50065789 CCAGAAGTTCGAGACCATCTTGG - Intergenic
1137682972 16:50367431-50367453 CTGGAAGTTCGAGACCAGCCTGG - Intronic
1137826285 16:51498779-51498801 CTGGGAGTTCCAGACCAGCTTGG + Intergenic
1137923780 16:52519746-52519768 CTGGGAGTTCAAGACCAACTTGG + Intronic
1137979877 16:53060546-53060568 CTAGAAGTTCCAGACCAGCCTGG + Intronic
1138435477 16:56997079-56997101 CTGGAAGTTCGAGACCAGCCAGG - Intronic
1138679003 16:58671776-58671798 CTGGGAGTTCAAGACCACCTGGG - Intronic
1139285626 16:65811018-65811040 AAGTAAGTTCCAGCCCATCATGG + Intergenic
1139597431 16:67966610-67966632 CTGGATGAGCAAGCCCATCTAGG + Intronic
1139916256 16:70430209-70430231 CTGGCAGTTCCTGCCCAGCCTGG - Intronic
1140218093 16:73024290-73024312 CTGGAAGTTTCTCCCCAGCTGGG - Intronic
1140971794 16:80020487-80020509 CTTGAAGTTCCAGCCAATCAGGG + Intergenic
1141721332 16:85757120-85757142 CTGGGAGTTCCAGACTAACTTGG + Intergenic
1141761531 16:86031955-86031977 CTGGGAGTTCGAGACCAGCTTGG - Intergenic
1142624650 17:1183999-1184021 CTGGGAGTTCGAGACCATCCTGG + Intronic
1143365174 17:6403377-6403399 CTGGGAGTTCAAGACCATCCTGG - Intronic
1144067388 17:11636917-11636939 CTTGAAATTCCAGACCACCTTGG + Intronic
1144277310 17:13685740-13685762 CTAGAAATTCAAGACCATCTTGG + Intergenic
1144302370 17:13933868-13933890 CTGGAACACACAGCCCATCTGGG + Intergenic
1144355604 17:14443219-14443241 CAGGAAGTTCCAGACCACCTAGG - Intergenic
1144536748 17:16097380-16097402 CTGAAAGTTCCAGCCCTTGCTGG - Intronic
1144895882 17:18531992-18532014 CTGGAAGCTCCAGCCCAGCAGGG - Intergenic
1145136335 17:20412240-20412262 CTGGAAGCTCCATCCCAGCAGGG + Intergenic
1146083206 17:29802069-29802091 CTAGAAGTTCAAGACCAGCTTGG - Intronic
1146197962 17:30829262-30829284 CAGGAAGTTCCAGACCAGCCTGG + Intergenic
1146362299 17:32186869-32186891 CTAGAAGTTCAAGACCACCTTGG - Intronic
1146424402 17:32722915-32722937 CTGTAAGTTCCAGCACATGACGG - Intronic
1147427484 17:40352867-40352889 CTGGAAGTTCAAGACCACCCTGG + Intronic
1148174407 17:45551007-45551029 CTAGAAGTTACAGCACTTCTAGG + Intergenic
1148274855 17:46294440-46294462 CTAGAAGTTACAGCACTTCTAGG - Intronic
1148296962 17:46512019-46512041 CTAGAAGTTACAGCACTTCTAGG - Intronic
1148361516 17:47016499-47016521 CTAGAAGTTACAGCACTTCTAGG - Intronic
1148527556 17:48355485-48355507 CTGGGAGTTCCAGACCAGCCTGG - Intronic
1148862764 17:50613140-50613162 CTGGAAGTTCGGGTCCAGCTCGG + Intronic
1149773971 17:59342914-59342936 CTGGAAGTCCCTGCCCGCCTGGG + Intronic
1150405626 17:64897929-64897951 CTAGAAGTTACAGCACTTCTAGG + Intronic
1150865792 17:68848407-68848429 CTGGAAGTTCAAGACCAGCCTGG + Intergenic
1151703116 17:75753772-75753794 CTGGAAGTTCGAGCCCCTGCTGG + Exonic
1152105623 17:78327033-78327055 TTGGAAGTTCAAGACCAGCTTGG - Intergenic
1152778102 17:82214398-82214420 CTGGGTGTCCCAGCCCGTCTCGG - Intergenic
1153170901 18:2314706-2314728 CTGGCAGCTCCAGCCCGTCAAGG + Intergenic
1153237246 18:2999977-2999999 CTGGAAGTTCAAGACCAACTTGG + Intronic
1154328291 18:13408162-13408184 CTGGGAGTTCGAGACCAGCTTGG + Intronic
1154339027 18:13488113-13488135 CTGGAAGTCCCTGCCAGTCTAGG - Intronic
1154443862 18:14417400-14417422 CAGGTAGGTCCAGCCCATCCTGG - Intergenic
1155152315 18:23133073-23133095 CTGGAAGTTCCAGACCGGCCCGG + Intergenic
1155211543 18:23606518-23606540 CTGGAAGTTCAAGACCAACCTGG - Intronic
1155411653 18:25552742-25552764 CTGGGAGTTCAAGACCAGCTAGG - Intergenic
1155501256 18:26489456-26489478 CTGGAAGTTCAACACCAGCTTGG - Intronic
1157678262 18:49583625-49583647 CTTGAAGATCCAGCTCACCTGGG + Exonic
1157701907 18:49766643-49766665 CTGGGGGTTCCAGACCCTCTTGG + Intergenic
1157941301 18:51931683-51931705 CTGGAGGTTCCAGCCTATGAGGG + Intergenic
1159352424 18:67293222-67293244 CTGGGAGTTCAAGACCAGCTTGG - Intergenic
1160273666 18:77410533-77410555 CCAGAAGTTCCAGACCAGCTTGG - Intergenic
1160905894 19:1451623-1451645 CTGGACTTCCCAGCCCCTCTGGG + Exonic
1160937568 19:1604418-1604440 CTGGGAGTTCAAGACCATCCTGG - Intronic
1161059108 19:2205904-2205926 CCAGAAGTTCCAGCCCAGCCTGG - Intronic
1161705052 19:5816108-5816130 CTGGAAGTTCGAGACCAGCCTGG - Intergenic
1162922123 19:13909440-13909462 CTGGGAGTTCCAGACCAGCCTGG - Intronic
1164599483 19:29551197-29551219 ATGGAAGTCCCAGCCCATATGGG + Intronic
1164626041 19:29728718-29728740 CTGGGAGCTCCAGACCTTCTCGG + Intergenic
1165177358 19:33940022-33940044 CTGGGAGTTCAAGCCCAGCCTGG - Intergenic
1165314146 19:35044706-35044728 CTGGCATTTCCAGCCCCACTAGG - Intronic
1165851081 19:38850688-38850710 CTGGGAGTTCCTGTCAATCTTGG - Intronic
1166535515 19:43571711-43571733 CTGGCAGTTCGAGACCAGCTTGG - Intronic
1166686591 19:44800270-44800292 CTGGGAGTCCCAGACCACCTGGG - Intronic
1166967457 19:46538132-46538154 TTGGGTGTTCCAGCTCATCTTGG + Intronic
1167004740 19:46768110-46768132 CTGGGAGTTCCAGACCAGCCTGG + Intronic
1167101942 19:47409098-47409120 CTGGTTGTTCCAGCACCTCTCGG - Exonic
1167173184 19:47847351-47847373 CTGGGAGTTCCAGACCAGCCTGG + Intergenic
1168420219 19:56197066-56197088 CTGGGAGTTCCAGGCCAGCCTGG + Intronic
924966356 2:80148-80170 CTGGAAGCTCCCTCCCAGCTTGG - Intergenic
925164056 2:1704676-1704698 CTGGAAGCTCCCTCCCCTCTTGG - Intronic
925912523 2:8582990-8583012 CTGGGAGTTCCTGCCCATGCTGG - Intergenic
927042104 2:19240198-19240220 CTAGAAGTTCCAGACCAGCCTGG - Intergenic
927102391 2:19798272-19798294 CTAGATCTTCCAGCCCATCGGGG + Intergenic
927698338 2:25252256-25252278 CTGGAAGTAGCTGCCCGTCTTGG + Intronic
927975168 2:27333053-27333075 CTGGGAGTTCAAGACCAGCTGGG - Intronic
928621052 2:33088240-33088262 TTGGAAGTTCGAGACCAGCTTGG + Intronic
929513589 2:42585681-42585703 TTGGAAGTTCAAGACCATCCTGG - Intronic
929655501 2:43727201-43727223 CAGGAAGATCGAGACCATCTTGG + Intronic
930244541 2:48969771-48969793 ATGGAACTTGCAGCCCATCAGGG - Intronic
930366935 2:50451176-50451198 CTGGGAGTTCCAGACCAGCCTGG - Intronic
932396818 2:71454301-71454323 CTGGAAGCTTCAGCCCAGGTTGG + Intronic
933145626 2:78848956-78848978 CCAGGAGTTCCAGACCATCTTGG - Intergenic
934775050 2:96932102-96932124 CGGGAGGTTCCAACCCACCTGGG - Intronic
937152745 2:119697068-119697090 CTGACAGTTCCAGCACACCTTGG + Intergenic
937836073 2:126471433-126471455 CTGGAAATGCCAGCTAATCTGGG - Intergenic
937917498 2:127106250-127106272 CTGGAAGCTCCCGCCCAGCCCGG - Intronic
937958217 2:127435371-127435393 CTGGAGGTTGCGGGCCATCTTGG - Intergenic
938079195 2:128360255-128360277 CTGGAAGCACCAGCCTAACTGGG - Intergenic
938224717 2:129606038-129606060 CTGGGATTTCCAGCCCATCTAGG + Intergenic
940368345 2:152873768-152873790 CTGGAAGTTCAAGACCAGCCTGG + Intergenic
940793277 2:158050586-158050608 CTGGAAGTTCCAGGCCAGTGTGG + Intronic
941090446 2:161168621-161168643 CTGGGAGTTCAAGACCATCCTGG + Intronic
941656704 2:168152097-168152119 CTGGAACCTTCAGCACATCTGGG - Intronic
941666945 2:168251518-168251540 CAGGAAGTTCAAGACCATCCTGG - Intergenic
941806963 2:169719056-169719078 GTGGAAGTTCCAAGCTATCTGGG - Intronic
942977759 2:182039592-182039614 CTGGGAGTTCAAGACCAGCTTGG - Intronic
943554874 2:189390246-189390268 CTGGAAGGACCAAACCATCTGGG - Intergenic
944098736 2:195998362-195998384 CAGGAAGATCGAGACCATCTTGG + Intronic
944580541 2:201128944-201128966 CTGGAAGTTACAGAGGATCTGGG - Intronic
945887286 2:215389517-215389539 CTGGGATTACAAGCCCATCTAGG - Intronic
946250389 2:218407838-218407860 CTAGAAGTTCCAGACCAGCCTGG - Intergenic
946278119 2:218645960-218645982 TTGGGAGTTCAAGGCCATCTGGG - Intronic
946580387 2:221121781-221121803 CCAGAAGTTCCAGACCAGCTTGG - Intergenic
947257663 2:228183086-228183108 GTGGAAGTTCAAGCTCTTCTTGG - Intergenic
948242068 2:236446388-236446410 CTGCAGGTGACAGCCCATCTGGG + Intronic
948369825 2:237481601-237481623 CTGGAAGCTTCAGCTCATGTTGG - Intergenic
1169475550 20:5928224-5928246 GTGGACGTTGCAGCCCAGCTGGG + Intergenic
1169614185 20:7420777-7420799 CTGGGAGTTCGAGCCCAGCCTGG - Intergenic
1170852834 20:20019793-20019815 CTGGGAGTTCCAGACCAGCCCGG - Intronic
1171843089 20:30239577-30239599 CTGGGAGTTCAAGACCATCCTGG - Intergenic
1172038406 20:32026664-32026686 CTGGGAGTTCCAAACCATCCTGG + Intronic
1172107594 20:32526098-32526120 CTGGAAGTTCAAGACCAACCTGG - Intronic
1173289479 20:41701869-41701891 CTGCATGTTTCATCCCATCTTGG - Intergenic
1175479342 20:59300524-59300546 GAGGCAGTTCCAGCCCCTCTGGG + Exonic
1176389971 21:6158374-6158396 GAGGAAGTGCCAGCCCTTCTGGG - Intergenic
1177720064 21:24894039-24894061 CTGGAAGTTCGAGACCAGCCTGG - Intergenic
1178582819 21:33850531-33850553 CTGGGAGTCCCAGGCCAACTTGG - Intronic
1178615803 21:34131878-34131900 CTGGAATATGCAGCCCAGCTGGG - Intronic
1179494395 21:41762500-41762522 TAGGAAGCTCCAGCCCTTCTGGG + Intronic
1179733495 21:43379866-43379888 GAGGAAGTGCCAGCCCTTCTGGG + Intergenic
1179839973 21:44065908-44065930 CCGGAAGTTCCAGACCAGCCTGG - Intronic
1180057138 21:45364837-45364859 CGGGGAATTCCAGTCCATCTTGG - Intergenic
1183640826 22:39091409-39091431 CTAGAAGTTCAAGACCAGCTGGG - Intergenic
1184179662 22:42811965-42811987 CTGGGAGTTCCAGACCAGCCTGG + Intronic
1184227888 22:43140698-43140720 CCAGGAGTTCCAGACCATCTTGG - Intronic
950533139 3:13564750-13564772 CTGGAAGGTCAAGGCCACCTGGG - Intronic
952459382 3:33508226-33508248 CTGGAAGTTCGAGACCAGCCTGG - Intronic
953977220 3:47391033-47391055 CTAGAAGTTCCAGACCAGCCTGG + Intronic
954744004 3:52776624-52776646 CCAGAAGTTCCAGCCCAGCCTGG - Intergenic
954830761 3:53419349-53419371 CCAGAAGTTCCAGACCAGCTTGG - Intergenic
956459874 3:69461347-69461369 CTGGGAGTTCGAGACCATCCTGG + Intronic
957186722 3:76950935-76950957 CTGGGAGTTCCAGACCAGCCTGG - Intronic
957392539 3:79595762-79595784 CCAGAAGTTCGAGACCATCTTGG - Intronic
958932233 3:100219886-100219908 CTGGGAGTTCAAGACCAGCTTGG + Intergenic
961071038 3:123927194-123927216 CTAGAAGTTCAAGACCAGCTGGG + Intronic
962216795 3:133529405-133529427 TTGGAAGTTCAAGACCAGCTTGG + Intergenic
962284968 3:134077824-134077846 CTGGCAGTTGCAGCCCAAGTGGG + Intronic
963455348 3:145539569-145539591 CTGGAAGTTCAAGACCAGCATGG - Intergenic
963455349 3:145539579-145539601 CTTGAACTTCCAGCCCACCTAGG + Intergenic
963780058 3:149478352-149478374 CTGGGAGTTCCAGACCAGCCTGG - Intronic
964311969 3:155403605-155403627 CTGGGAGTTCAAGACCAGCTTGG - Intronic
964585238 3:158290982-158291004 CTAGAAGTTCAAGACCAACTTGG + Intronic
966080334 3:175992455-175992477 CTGGAAGTTCAAGACCAGCCTGG + Intergenic
966595896 3:181724710-181724732 ATGGAAGTTCCAGCAGATGTGGG + Intergenic
968191740 3:196673194-196673216 CTAGAAGTTCAAGACCATCCTGG - Intronic
968202652 3:196768873-196768895 CTGGGAGTTCGAGGCCATCCTGG - Intronic
968323826 3:197794793-197794815 TCGGAAGTTCCAGACCAGCTTGG + Intronic
968670045 4:1844520-1844542 CTGGGAGTTCAAGACCAGCTTGG + Intronic
968918384 4:3508625-3508647 CTGGAAATGCCAGGTCATCTTGG + Exonic
968991507 4:3916355-3916377 CTGGAAGTTCGAGACCAGCCAGG + Intergenic
969208140 4:5664664-5664686 CTGGAAATTCCACCCCAGCCTGG - Intronic
969571299 4:8010205-8010227 CTGGAAATGTCAGCCCAGCTGGG - Intronic
970069586 4:12142426-12142448 CTGGAGGTTCAAGACCAACTTGG + Intergenic
970766301 4:19552922-19552944 CTGGAAATTCAAGACCAGCTGGG - Intergenic
973840373 4:54854834-54854856 CTGGGAGTTCAAGACCAGCTTGG + Intergenic
975144625 4:70954027-70954049 CTGAAAGGTTCAGGCCATCTTGG - Intronic
975508153 4:75162174-75162196 CTGGAAGTTCCTGAACATCAGGG + Intergenic
977423101 4:96828608-96828630 CTGGGAGTTCAAGACCAGCTTGG - Intergenic
977932837 4:102767321-102767343 CTAGGAGTTCAAGACCATCTTGG + Intergenic
978776049 4:112507907-112507929 CTGGGAGTTCGAGACCAGCTTGG - Intergenic
980982072 4:139663291-139663313 TTGGGAGTTCCAGACCATCCTGG - Intergenic
981167112 4:141573708-141573730 CTAGAAGTTCAAGACCAGCTTGG + Intergenic
981732466 4:147913941-147913963 CTGGGAGTTCGAGACCATCCTGG + Intronic
983966088 4:173812073-173812095 CTGGAAGTCCAAGCCAAACTGGG - Intergenic
984524691 4:180844336-180844358 CTGGAAGTTTGAGACCAGCTGGG - Intergenic
985900912 5:2790842-2790864 CTGGAAGAGCCAGCACAGCTAGG - Intergenic
986039273 5:3971965-3971987 CCAGAAGTTCCAGACCAGCTTGG - Intergenic
987603921 5:20108299-20108321 TCAGAAGTTCCAGCCCATCTTGG - Intronic
987885737 5:23809134-23809156 CTGGAAGTTCAAGACCAGCCTGG - Intergenic
988376573 5:30443119-30443141 CTGGAAGTTCGAGACCAGCCTGG - Intergenic
988483831 5:31651893-31651915 CTGGAACTTCCACCCTCTCTGGG + Intronic
988490941 5:31704949-31704971 CTGGAAGTTCGAGACCAACCTGG + Intronic
988986544 5:36624881-36624903 CTGTAAGCACCAGCACATCTTGG - Intronic
989264845 5:39461423-39461445 ATGGACATTCCAGCCCAACTAGG + Intronic
989707165 5:44348548-44348570 CTGGAAGTTCCACCTTATCTGGG - Intronic
990091511 5:52056835-52056857 CTGGAAGTTCCAGACCATCCAGG - Intronic
990207419 5:53444075-53444097 CTGGAAGTTTGAGACCAGCTGGG - Intergenic
990583374 5:57186185-57186207 CTGGAAGTTCAAGACCAGCCTGG + Intronic
990646293 5:57848353-57848375 CTGGAAGCTCCCTCCCACCTTGG + Intergenic
990754969 5:59058474-59058496 TTGGAAGTTCCAGGCCAATTAGG - Intronic
992090081 5:73309356-73309378 CTGGGAGTTCAAGACCAGCTTGG - Intergenic
992091589 5:73322597-73322619 CTGTAAGTCCCAGCCAAGCTTGG + Intergenic
992291075 5:75280810-75280832 CTGGGAGTTCAAGACCAGCTTGG + Intergenic
992564730 5:77986121-77986143 CTGGGAGTTCCAGACCAGCCTGG - Intergenic
993997039 5:94735484-94735506 CTGGAAGTTCAAGACCAGCCTGG - Intronic
995554924 5:113317832-113317854 CTGGAATTTCTGGGCCATCTGGG - Intronic
995882116 5:116854608-116854630 CTGGGAGTTCCAGACCAGCCTGG - Intergenic
996577352 5:124990355-124990377 CTAGGAGTTCCAGACCAGCTAGG + Intergenic
997277830 5:132612623-132612645 CTGGGAGTTCCAGACTATCCTGG + Intronic
997302491 5:132815405-132815427 CTGGAGGTGCAGGCCCATCTGGG - Exonic
997790036 5:136750636-136750658 CCGGAAGCACCAGCCCATCCAGG + Intergenic
998448321 5:142215498-142215520 CTGGGAGTTCAAGACCAGCTTGG + Intergenic
999696108 5:154190217-154190239 CTGTCACTTCCAGCCCACCTAGG - Intronic
1000261089 5:159589271-159589293 CTGGAAGATCCTTCCCTTCTAGG + Intergenic
1000405726 5:160886494-160886516 CAAGAAGTTAAAGCCCATCTGGG + Intergenic
1000988164 5:167883430-167883452 CAGCAATTTCCAGCCCAACTAGG + Intronic
1002076101 5:176709470-176709492 CTGGGAGTTCGAGACCAGCTTGG - Intergenic
1004148146 6:13089266-13089288 CTGGAAGCTCTTGGCCATCTGGG + Intronic
1004194349 6:13489789-13489811 CCGGAAGTTCTAGACCAGCTTGG + Intergenic
1004263667 6:14130513-14130535 CTGGGAGTTCAAGACCAGCTTGG + Intronic
1004414435 6:15412516-15412538 CTGGGAGTTCAAGGCCAGCTTGG - Intronic
1004486959 6:16075674-16075696 ATTGAAGTTCCAGCCTATGTAGG - Intergenic
1005811966 6:29523707-29523729 CTGGGAGTTCCAGACCAGCCTGG - Intergenic
1006759467 6:36446575-36446597 CCAGAAGTTCCAGACCATCCTGG + Intronic
1006971832 6:38053472-38053494 CTGGAAGTTCGAGACCAGCTTGG + Intronic
1010212693 6:73374629-73374651 CTAGGAGTTCCAGACCAGCTTGG - Intronic
1012606187 6:101160320-101160342 CTAAAAGTTCCAACCCACCTGGG - Intergenic
1013099592 6:106975232-106975254 CTGGAATTCGCAGCCCCTCTCGG - Intronic
1013248602 6:108312327-108312349 CTAGAAGTTCAAGACCAGCTTGG + Intronic
1013422628 6:109979720-109979742 CAGGCAGTTCCAGCCCAGCACGG - Exonic
1013644298 6:112120860-112120882 CTGGGAGTTCAAGACCAGCTTGG + Intronic
1013794052 6:113865255-113865277 CTGGAAGTTCGAGACCAGCCTGG - Intergenic
1014176947 6:118341909-118341931 CTGTAAGTTCCATCCCAGATGGG + Intergenic
1015357679 6:132298228-132298250 CTGGGAGTTCCAGACCAACCTGG - Intronic
1016039679 6:139420004-139420026 CCGGGAGTTCCAGACCAGCTTGG - Intergenic
1016819186 6:148331891-148331913 CTGGGAGTTCCAGACCAGCCTGG - Intronic
1017605669 6:156129717-156129739 CCAGAAGTTCCAGACCAGCTTGG - Intergenic
1017845524 6:158254860-158254882 CCGGAAGTTCCAGACCAGCCTGG + Intronic
1018447488 6:163870793-163870815 CTGGAAGTTTGAGACCATCCTGG + Intergenic
1019544017 7:1564603-1564625 CTGGGAGTTTGAGCCCAGCTTGG - Intergenic
1019664963 7:2247270-2247292 CTGGGAGTTAGGGCCCATCTTGG - Intronic
1020339291 7:7092189-7092211 CTGGGAGTTCCAGACCAGCCTGG + Intergenic
1020590976 7:10136706-10136728 CTGGAAGTTCTATGCCTTCTGGG + Intergenic
1021520944 7:21538502-21538524 CTGGAAGGTCCATCCCAGATGGG + Intergenic
1022230016 7:28405624-28405646 CTGGGAGTTCGAGACCAGCTTGG - Intronic
1022600313 7:31751886-31751908 CTGGAAGGTCGAGGCCATCCGGG + Exonic
1022826016 7:34014605-34014627 GTGGAATTTCCTCCCCATCTGGG + Intronic
1026244699 7:68608804-68608826 CAGGAAGATCCAGGGCATCTGGG - Intergenic
1026589811 7:71684872-71684894 TTGGGAGTTCCAGACCAACTTGG - Intronic
1027239246 7:76316607-76316629 CTGGGAGTTCCAGACCAGCCTGG - Intergenic
1027549752 7:79575661-79575683 CTTGAAGTATCAGCCAATCTAGG + Intergenic
1029209735 7:98897023-98897045 CTGGGAGTTCGAGACCAGCTTGG + Intronic
1029266895 7:99349493-99349515 TTGGAAGTTCAAGACCAACTTGG + Intronic
1029357500 7:100063102-100063124 CTGGGAGTTCAAGACCAGCTTGG - Intronic
1029368474 7:100132014-100132036 CTGGAAGTTCAAGACCAGCCTGG - Intergenic
1031042549 7:116854144-116854166 CTGGAAGTTCAAGGCCAGCTTGG + Intronic
1031084233 7:117286518-117286540 CTGGAAATTCCTGCCACTCTAGG + Intronic
1032339403 7:131057023-131057045 CTGGAAGTTCAAGACCAGCCTGG - Intergenic
1032565165 7:132934201-132934223 TGGGACTTTCCAGCCCATCTTGG - Intronic
1032884580 7:136123903-136123925 CTGGATCTTCCAGCCCCTCATGG - Intergenic
1033304473 7:140214356-140214378 TTTGGAGTTCCAGCCCTTCTAGG + Intergenic
1034098987 7:148435785-148435807 CAGGAAGGCCCAGCCCTTCTGGG + Intergenic
1035310396 7:157964203-157964225 CTGGGAGCTCCAGCCCAGGTCGG - Intronic
1038135742 8:24783669-24783691 TTGGTAGTTCAAGACCATCTTGG + Intergenic
1038183341 8:25249208-25249230 CCGGGAGTTCCAGACCAGCTAGG - Intronic
1039505868 8:38051933-38051955 CTGGGAGTTCCAGACCAGCTTGG - Intronic
1040314801 8:46255257-46255279 TTGGTAATTACAGCCCATCTGGG - Intergenic
1040506296 8:48051759-48051781 CTGGATGCACCAGCCAATCTGGG - Intronic
1041309457 8:56500561-56500583 GTGGAAATTCCACCACATCTAGG - Intergenic
1041410919 8:57553653-57553675 CCAGAAGTTCAAGCCCAACTTGG - Intergenic
1042942443 8:74121409-74121431 CTAGAAGTTCCAGACCAGCCTGG - Intergenic
1043299282 8:78706154-78706176 CTGGGAGTTCCATCCCAGGTAGG + Intronic
1043676428 8:82961605-82961627 CTGGGAGTTCAAGACCAACTTGG - Intergenic
1044488190 8:92778550-92778572 TTGGGAGTTCCAGACCATCCTGG + Intergenic
1044815421 8:96107719-96107741 CTGGAAGTTCCTGGCCCCCTGGG - Intergenic
1044962205 8:97542500-97542522 GTGGAAGTCCCACCCCTTCTGGG + Intergenic
1045828097 8:106425271-106425293 CCAGAAGTTCCAGACCAGCTTGG - Intronic
1046943666 8:119955065-119955087 TTGGAAGTTCAAGACCATCCTGG - Intronic
1047143130 8:122165077-122165099 CTAGGAGTTCCAGACCAGCTTGG + Intergenic
1049545115 8:143226999-143227021 CTGGGAGTTCCAGACCAGCCTGG + Intergenic
1049620352 8:143595575-143595597 CTGGATATTCCAGCCCCACTGGG + Intronic
1051124151 9:13785249-13785271 CTGGGAGTTCCAGACCAGCCTGG - Intergenic
1051350161 9:16191457-16191479 CTGGAAGATGCAGTCCATATGGG + Intergenic
1051589685 9:18764535-18764557 CTGGACCTTCAAGCACATCTTGG + Intronic
1054809597 9:69424561-69424583 CTGGAATTTCCAGACCCCCTGGG - Intergenic
1055209145 9:73767904-73767926 CTGGAAGTACAAGGTCATCTTGG - Intergenic
1055992594 9:82123676-82123698 CAGGAAGTTCAAGACCAGCTTGG - Intergenic
1056180836 9:84080631-84080653 CTGCCAGTTCCAGCCCAGCGTGG - Intergenic
1056340042 9:85620200-85620222 CAGGAAGTTCGAGACCATCCTGG + Intronic
1056856116 9:90131122-90131144 CCAGAAGTTCAAGCCCAGCTTGG + Intergenic
1056999827 9:91497375-91497397 CTGGAATTTCCAGCTCCTGTGGG + Intergenic
1059081607 9:111256035-111256057 CTGGAAGTTCAAGGCCAGCCTGG + Intergenic
1060500653 9:124151384-124151406 CTGGGATCTCCTGCCCATCTTGG + Intergenic
1060895500 9:127214619-127214641 CTGCATGTTCCAGCTCACCTGGG + Intronic
1061384996 9:130284558-130284580 CTAGGAGTCCCAGCCCATCTGGG + Intergenic
1061390154 9:130313172-130313194 ATGGAATTTCCTGCCTATCTGGG + Intronic
1061548223 9:131317019-131317041 CTGGGAGTTCCAGACCAGCCTGG - Intergenic
1061821892 9:133233593-133233615 CTGCAGGTACCAGCACATCTGGG - Intergenic
1062034790 9:134378184-134378206 CTGGAAGTGCCAGGCCACCCCGG + Intronic
1062201166 9:135303525-135303547 CAGGAAATTTCAGCCCATTTAGG - Intergenic
1062252835 9:135606825-135606847 CTGGAACTTGCAGCGCAGCTGGG - Intergenic
1186092344 X:6063263-6063285 CTAGGAGTTCCAGACCAGCTTGG + Intronic
1186163117 X:6798992-6799014 CTGGGAGTTCCAGGCCAGCCTGG - Intergenic
1186846702 X:13538114-13538136 CTAGGAGTTCCAGACCAGCTTGG + Intergenic
1187968273 X:24634126-24634148 CTAGGAGTTCCAGACCATCCTGG - Intronic
1189221092 X:39372679-39372701 CTGTAAGTTTCAGCCACTCTGGG - Intergenic
1190557674 X:51652696-51652718 CTAGGAGTTCGAGACCATCTGGG - Intergenic
1190602472 X:52106997-52107019 CTGGAAGTTCAAGACCAGCCTGG - Intergenic
1191701667 X:64048452-64048474 CTGGAAGCTCCATCCCATGTGGG - Intergenic
1192252425 X:69423579-69423601 CCGGAAGTTCCAGACCAGCCTGG + Intergenic
1192784227 X:74321838-74321860 CAGGAACTTGCAGCCCAGCTAGG - Intergenic
1194550289 X:95289998-95290020 CTGGAAGTTCAAGACCAGCCTGG + Intergenic
1195709309 X:107761283-107761305 CAGGAAGTTCTAGCCCTTGTGGG - Intronic
1196685397 X:118506041-118506063 CTGGGAGTTCCAGGCCAGCCTGG + Intronic
1197173730 X:123462652-123462674 CTGGAAGTTCCAGCCCCCCCTGG + Intronic
1198103128 X:133439148-133439170 CTGGGAGTTCCAGACCAACCTGG + Intergenic
1200311659 X:155084759-155084781 CTGGGAGTTCAAGTCCATCCTGG + Intronic
1202576538 Y:26332639-26332661 CTTGAAGTTCAAGACCAGCTTGG - Intergenic