ID: 1093679840

View in Genome Browser
Species Human (GRCh38)
Location 12:21989377-21989399
Sequence TATTATGACCCTAATGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093679840_1093679843 14 Left 1093679840 12:21989377-21989399 CCTACCTCATTAGGGTCATAATA No data
Right 1093679843 12:21989414-21989436 ATACATTTAAAGCCAAGGACAGG No data
1093679840_1093679842 9 Left 1093679840 12:21989377-21989399 CCTACCTCATTAGGGTCATAATA No data
Right 1093679842 12:21989409-21989431 TAACAATACATTTAAAGCCAAGG No data
1093679840_1093679845 28 Left 1093679840 12:21989377-21989399 CCTACCTCATTAGGGTCATAATA No data
Right 1093679845 12:21989428-21989450 AAGGACAGGCACTTAGTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093679840 Original CRISPR TATTATGACCCTAATGAGGT AGG (reversed) Intergenic
No off target data available for this crispr