ID: 1093687107

View in Genome Browser
Species Human (GRCh38)
Location 12:22069705-22069727
Sequence TAACTTGTAGGAACGACGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 26
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 24}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093687107 Original CRISPR TAACTTGTAGGAACGACGGC TGG (reversed) Intronic