ID: 1093687107

View in Genome Browser
Species Human (GRCh38)
Location 12:22069705-22069727
Sequence TAACTTGTAGGAACGACGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 26
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 24}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093687107 Original CRISPR TAACTTGTAGGAACGACGGC TGG (reversed) Intronic
911641068 1:100289499-100289521 TAAATTGTAGGAAAGACTGATGG + Intronic
1090034592 11:123237746-123237768 TATCTTGTAGGAAAGATTGCTGG + Intergenic
1093687107 12:22069705-22069727 TAACTTGTAGGAACGACGGCTGG - Intronic
1097227162 12:57484393-57484415 TAACTAGGAGGTACGATGGCAGG + Intronic
1104697913 12:130878583-130878605 TAACTGGTAGGACCGACTTCAGG - Intergenic
1124551178 15:30682638-30682660 TAGCTAGTAGGAAGGACTGCTGG + Intronic
1124680066 15:31723016-31723038 TAGCTAGTAGGAAGGACTGCTGG - Intronic
1126105580 15:45144906-45144928 TAACTTGGAGGAAGAGCGGCAGG + Exonic
1127709369 15:61580278-61580300 TCACTTGTAGGGACTAGGGCTGG + Intergenic
1167781109 19:51599504-51599526 TACCTTGTAGGAGCTAAGGCTGG + Intergenic
939501068 2:142985163-142985185 TACCTTGTAGGAACACCAGCAGG - Exonic
939523736 2:143264993-143265015 TAACTTCTAGGAAGGATGCCAGG + Intronic
1170907046 20:20525760-20525782 TAACTGGTAGGAAAGAGGGGCGG - Intronic
952035616 3:29196671-29196693 TATCTTGTAGGAAATACCGCAGG - Intergenic
956248184 3:67207596-67207618 TAATTTGTTGGAAGGACAGCTGG + Intergenic
956373325 3:68587507-68587529 TAACCTGAAGGACCGAAGGCTGG + Intergenic
966235352 3:177695490-177695512 GAGCTTGTAGGAAGGCCGGCTGG + Intergenic
999496925 5:152108190-152108212 TAGATTGTAGGAAGGAAGGCTGG + Intergenic
999864375 5:155684685-155684707 TATCTTGTAGGAAGGACTGCAGG + Intergenic
1005498212 6:26407320-26407342 TAACTTGCAGGAAGGAAGCCAGG - Intronic
1007903316 6:45432407-45432429 TAAGTTGTAGCAAGGACAGCTGG + Intronic
1008070832 6:47097271-47097293 GAACATGCAGGAAGGACGGCGGG + Intergenic
1186113684 X:6282695-6282717 TATCTTGTAGGATGGACGACTGG - Intergenic
1188928352 X:36073971-36073993 TAACTTGCTGCAACCACGGCAGG + Intronic
1197858616 X:130946392-130946414 AAACTTGTATGAACCACAGCAGG + Intergenic
1198980021 X:142384755-142384777 TAATTTGTATGAATTACGGCTGG + Intergenic