ID: 1093687414

View in Genome Browser
Species Human (GRCh38)
Location 12:22072376-22072398
Sequence GTCTTGCATTTCCCTACACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 133}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093687414 Original CRISPR GTCTTGCATTTCCCTACACA GGG Intronic
900327617 1:2116762-2116784 TTTTTACATTTCCATACACATGG + Intronic
901990949 1:13113516-13113538 CTCTTTCTTTTCCCTACACATGG - Intergenic
902070397 1:13730085-13730107 GTGTTTCATTTCACTGCACAGGG - Intronic
904498293 1:30899980-30900002 CTCTTTCTTTTCCCCACACAAGG - Intronic
904614635 1:31743174-31743196 GTCTTGCACATCCCTTCAAAGGG - Intronic
908371743 1:63488210-63488232 GTCTTGCAGTTCTCTCCACCTGG - Intronic
909576314 1:77180675-77180697 GTCCTGCCTTTCCCTACCCACGG - Intronic
912586990 1:110776169-110776191 GTCTTGCCTTTCCCAACAAATGG + Intergenic
912693552 1:111822951-111822973 GTCTTGAATTTCCCATCATATGG - Intronic
912981596 1:114378986-114379008 GTCTTGCATTCCCACACAGAGGG - Intergenic
914853812 1:151335402-151335424 GTCCTTCATTTCCTTCCACATGG + Intergenic
917743151 1:177981324-177981346 GTCTTGCATCTCCCTGGCCATGG + Intronic
920607811 1:207407096-207407118 GTCTTGAATTCCCCTCCTCAAGG - Intergenic
923767513 1:236906085-236906107 GACATCCATTTCCCTACAGAAGG - Intergenic
1066125448 10:32337353-32337375 CTCTTGCTTTTCCCTAGACTTGG + Intronic
1067164230 10:43852500-43852522 GGCCTGCCTTTCCTTACACACGG - Intergenic
1067272815 10:44806696-44806718 GCCTTACACTTCCCTACACATGG + Intergenic
1070448667 10:76535053-76535075 GCCTTGCATATCCTCACACAGGG + Intronic
1070655139 10:78266314-78266336 GCCTTGAATTTCCCTGGACATGG + Intergenic
1073837056 10:107456391-107456413 ATCTTGCATTTACTGACACAAGG - Intergenic
1074559683 10:114523986-114524008 ATCTTGCATTTCTCTCCACCTGG - Intronic
1074711969 10:116184882-116184904 GTCCTGCACTGCCCTACAGATGG - Intronic
1075770979 10:124935526-124935548 GTCTTCCATTGCCTTCCACAAGG + Intergenic
1080172264 11:29319108-29319130 GCCATGCATTGCCCTTCACATGG - Intergenic
1084337756 11:68470823-68470845 GTCTTCCCTTTCCTTATACATGG - Intronic
1088470550 11:110184399-110184421 GACCTGGATTTCCCTACACCAGG - Intronic
1090039684 11:123279698-123279720 CTCTTTCTTTTCCCTACACTGGG - Intergenic
1090196358 11:124820359-124820381 GGCTTGAACTTCCCTACACTTGG + Intergenic
1091003087 11:131927267-131927289 GTCTGACATTTCCCTGCACCTGG + Intronic
1093538705 12:20254345-20254367 CTCTTGCATTTCACTAGACTGGG + Intergenic
1093651514 12:21651056-21651078 TGCTTGCATTTCCCTTCACCTGG - Intronic
1093687414 12:22072376-22072398 GTCTTGCATTTCCCTACACAGGG + Intronic
1093897490 12:24591124-24591146 GTTTTGAATTTCCTTACTCAAGG + Intergenic
1095553262 12:43470617-43470639 TTCTTGTATTTCCAAACACAGGG - Intronic
1095939054 12:47713858-47713880 CTCTTGCAGTTCCCTCTACATGG - Intronic
1097158059 12:57026986-57027008 ATCCTGCATTTCCCTTCACAGGG - Intronic
1098621399 12:72604016-72604038 GTCTTGAATTTACTTACACTTGG + Intronic
1101988014 12:109462384-109462406 GTATTGCATTTCCCCCCACTTGG - Intronic
1102156019 12:110728636-110728658 GCCTTGCATTTCACTACCTAAGG + Intronic
1104461053 12:128956283-128956305 GACTTGCATTTGCCTACAGTTGG + Intronic
1107413387 13:40178178-40178200 GTCTTCCATTTCCCCTCACAAGG + Intergenic
1108258288 13:48631443-48631465 GTTTTGTATCTCCCTAGACAGGG - Intergenic
1109228823 13:59730392-59730414 GTGTAGCATTTGACTACACAAGG + Intronic
1114154402 14:20084582-20084604 CTCTTTCTTTTCCCCACACAGGG - Intergenic
1114383382 14:22232194-22232216 GTCTGGCTTTTCCAGACACAGGG + Intergenic
1115622585 14:35154648-35154670 GTCTTGCAGTTTCCCACAGATGG - Intronic
1120995647 14:90416812-90416834 GTCTGGCTTTTCCCTACAGCAGG + Intergenic
1124621524 15:31276755-31276777 GACTTGCATTTCCATGCACAGGG - Intergenic
1127715195 15:61643001-61643023 CTCTTCCATTTCCCTATCCATGG + Intergenic
1128064726 15:64757379-64757401 CTCCTGCATTTACCTGCACAAGG + Intronic
1130388683 15:83435611-83435633 GTCTTGCATTTCTCTGGTCAGGG + Intergenic
1131962057 15:97800309-97800331 GACTTGCATTTCTCTACCCAGGG + Intergenic
1132132457 15:99295272-99295294 GTATTGCTTTTCCCTACACCTGG + Intronic
1138069054 16:53972490-53972512 GTCTTGGATTTCAATACTCAAGG - Intronic
1142978229 17:3657546-3657568 GCCTTGCCTTTCCCTGAACACGG - Intronic
1149275179 17:55026276-55026298 CTTTTGCATTTCCATACAAATGG - Intronic
1149899306 17:60459245-60459267 GTCTTGCATTTTCTCTCACAAGG + Intronic
1155241841 18:23871421-23871443 GTCTGAAGTTTCCCTACACATGG - Exonic
1158206357 18:54997507-54997529 GTCCAGCATTTCCCTTCACTTGG + Intergenic
1164048982 19:21567937-21567959 CTCTTGCTTTTCCCCACACTGGG - Intergenic
1164684344 19:30157121-30157143 GGCTTCCATTGCTCTACACAAGG - Intergenic
1165400826 19:35598857-35598879 GTCTTGCATTCCCATATAGAAGG + Intergenic
934774548 2:96928797-96928819 GTTCTGTAATTCCCTACACATGG + Intronic
934951016 2:98575617-98575639 GTTTTGCCTTTCCCTAGACGAGG + Intronic
935019050 2:99213062-99213084 GTCTTGCATTGCCCAAACCAGGG - Intronic
935705812 2:105856216-105856238 GTCTTGCCTTTACATGCACACGG + Intronic
938758197 2:134399902-134399924 GTCTGCCTTTCCCCTACACATGG - Intronic
939390101 2:141557400-141557422 TTCTTGCATTTCACCACCCAAGG - Intronic
941381312 2:164796069-164796091 ATCTTGCTTTTCCATATACAAGG + Intronic
945240743 2:207674595-207674617 GTATTGCCTTTACCTCCACATGG + Intergenic
946700065 2:222403537-222403559 CACTTGCATTTCCCTACATGAGG + Intergenic
947098552 2:226593489-226593511 GTCTTGCATCTCCATTCTCAGGG - Intergenic
949039184 2:241838684-241838706 GTCATGCATTGCCCTGCTCAAGG - Intergenic
1169543479 20:6627328-6627350 GTCCTGCATTTCTCTTCAAATGG + Intergenic
1173143606 20:40506229-40506251 GTCTTGGATTTAGCTACACTTGG + Intergenic
1175647682 20:60688852-60688874 GTCTTGTATCTTCCTACTCATGG + Intergenic
1177249161 21:18569627-18569649 CTCTTGCTTTTCCCCACACCTGG + Intergenic
1180067372 21:45419145-45419167 GAATTGCATGTCACTACACACGG - Intronic
1180837683 22:18938669-18938691 CTCTTGCTTTTCCCCACACTGGG - Intergenic
1181025961 22:20127844-20127866 GACTGGCCTTTCCCTCCACAGGG - Intergenic
1181965406 22:26653093-26653115 ATCTTCCATTTCCCTACGGAGGG - Intergenic
1203287776 22_KI270734v1_random:163968-163990 CTCTTGCTTTTCCCCACACTGGG - Intergenic
950777479 3:15363063-15363085 TTCTTTCCTTTCTCTACACATGG - Intergenic
951895620 3:27607100-27607122 GCCTTGCATTTCCCTAGGTAAGG - Intergenic
951916043 3:27801776-27801798 GTCTTGCAGCTCCATAAACAGGG + Intergenic
953362803 3:42313567-42313589 GCCATGCATTTCCCTGTACAAGG - Intergenic
955325903 3:58009137-58009159 TTGTTGCATTTCTCTACACCTGG + Intronic
956176250 3:66475972-66475994 TTCTTCCATTTCCATACACAGGG + Intronic
957294462 3:78319371-78319393 GACATCCCTTTCCCTACACATGG - Intergenic
958533806 3:95368959-95368981 GTATTTCATTTACTTACACATGG + Intergenic
958663105 3:97097650-97097672 GGCATGCATTTCCATACAAAAGG - Intronic
958904618 3:99928190-99928212 GCCTAGGATTTTCCTACACAGGG - Intronic
961984132 3:131114532-131114554 CTCTTGCTTTTCCCTCCACCAGG - Intronic
964640613 3:158906401-158906423 GTCTCTCATTTCCCTACACCTGG + Intergenic
965564198 3:170094225-170094247 GTCTTACACATGCCTACACAAGG + Exonic
970734406 4:19149178-19149200 CTCTTGCTTTTCCCAACACAGGG - Intergenic
971917901 4:32897806-32897828 GTCTTGAATCTTCCTATACATGG + Intergenic
972980453 4:44693910-44693932 AGCTTGCATCTCCCTTCACAGGG - Intronic
977595323 4:98873232-98873254 GTCCTGCATGTCTCCACACATGG - Intronic
984156831 4:176204607-176204629 GTCTTTCATTTCCTTAGACAGGG + Intergenic
984423475 4:179554123-179554145 CTCTTGCTTTTCCCCACACCAGG + Intergenic
984832712 4:183990504-183990526 TCCTAGCAGTTCCCTACACATGG + Intronic
986108045 5:4679476-4679498 ATCTTGCATTTACCAGCACAAGG + Intergenic
990069269 5:51758825-51758847 GGCATGCATTTTCCTACACAGGG + Intergenic
990112702 5:52347641-52347663 AAGTTGCATTTCCCAACACAAGG + Intergenic
993997425 5:94739462-94739484 GTATTGAACTTCCCTACACAAGG + Intronic
996688043 5:126306092-126306114 GTCTTGCTGTTCCCTATACCTGG + Intergenic
1000278725 5:159763765-159763787 GTCATTCATTTCCCTTTACAAGG + Intergenic
1001563684 5:172686291-172686313 GGTTTGCATTTCCTTACCCAGGG - Exonic
1001736346 5:174006822-174006844 TTCTTGGATTTCCCACCACAGGG + Intergenic
1003347226 6:5281792-5281814 GTCTACCATTTCCCAATACAAGG - Intronic
1006600580 6:35222796-35222818 GTGCTGCATTTCCCCACACCAGG + Intronic
1006755792 6:36414199-36414221 TTCTGGGACTTCCCTACACATGG - Intronic
1007366254 6:41396129-41396151 GTTTTGCATTTGTCTTCACAAGG - Intergenic
1008574810 6:52849818-52849840 GTCTTGTGTCTTCCTACACAGGG + Intronic
1008971925 6:57378424-57378446 GTCTTTTATTTCTGTACACATGG + Intronic
1015394830 6:132721757-132721779 CTCTTTCTTTTCCCTACACAGGG + Intergenic
1015457709 6:133446626-133446648 GTCCTGCATTTCCATAGACCTGG - Exonic
1016607366 6:145946417-145946439 GTTTTGCATTTCCATAAAGAAGG - Intronic
1016883203 6:148931892-148931914 GTCTTCCTTTTGCATACACAAGG - Intronic
1017207434 6:151818665-151818687 TTCTTGCCTTTCTCTACACAGGG + Intronic
1018567913 6:165176255-165176277 CTCTTTCATTACCCTATACATGG - Intergenic
1021125408 7:16846409-16846431 TTCTTGCATTTCCCTCCAGGAGG - Intergenic
1021560670 7:21965902-21965924 GTCTAGCCTGTCTCTACACAGGG - Intergenic
1022477055 7:30718113-30718135 CTCTTTCTTTTCCCTACAGATGG - Intronic
1022608039 7:31835591-31835613 GCCTTGCATTTCCTAACAAAAGG + Intronic
1024197806 7:47076670-47076692 GTCTTGCCTTTCCCTCCTCCTGG - Intergenic
1026162469 7:67881627-67881649 CTCTTTCTTTTCCCCACACATGG + Intergenic
1032160301 7:129504402-129504424 GTCTTGGAATTCCCTACTCTCGG + Intronic
1034540885 7:151757147-151757169 GTCTTGCATTTCCATCCCAAGGG - Intronic
1036292662 8:7507320-7507342 CTCTTGCTTTTCCCCACAAAAGG + Intronic
1037036958 8:14180135-14180157 TTGTTGCATTGCCCTATACATGG - Intronic
1041770157 8:61464643-61464665 GTATTGCATTTCATTACATACGG + Intronic
1043220258 8:77653694-77653716 CTCTTTCATTTCCTTAAACAAGG + Intergenic
1048938487 8:139376622-139376644 GTCTTGTATTTCCAAACACATGG - Intergenic
1049679656 8:143912351-143912373 GCCTTGCATTTCCTAACACCAGG + Intergenic
1050542232 9:6680757-6680779 GTTTCCCATTTCCCTAAACATGG + Intergenic
1052279435 9:26716161-26716183 CTCTTGCTTTTCCCCACACCAGG + Intergenic
1052469823 9:28880200-28880222 CTCTTTCTTTTCCCTACACCTGG - Intergenic
1053736195 9:41104535-41104557 CTCTTTCTTTTCCCTACAGATGG - Intergenic
1054692179 9:68326865-68326887 CTCTTTCTTTTCCCTACAGATGG + Intergenic
1055279264 9:74656000-74656022 GACTTGTATTTCCCACCACAAGG + Intronic
1059008497 9:110430565-110430587 CTCATGCATTTCCCTTCACGAGG - Intronic
1185701392 X:2233272-2233294 AACTTTCATTTCCCTGCACAAGG - Intronic
1186230840 X:7451798-7451820 TTCATCCATTTCCCTACAAAGGG + Intergenic
1187182423 X:16955602-16955624 TTCCTGCAGTTCCCTCCACATGG + Intronic
1189042636 X:37558656-37558678 GTCTTTTATTTCCCTCCCCAGGG + Intronic
1192307453 X:69977188-69977210 GTCTGCCATTTCCCTGCAAAAGG - Intronic
1196493134 X:116291868-116291890 GTCTTTGATTTCCATACTCAAGG - Intergenic
1198913725 X:141642309-141642331 TTCTGGCATTTCCCTACAGTAGG - Intronic
1200846012 Y:7832898-7832920 GTCGTAGGTTTCCCTACACAAGG - Intergenic
1202625050 Y:56848543-56848565 GTCTTGGCTTTTCCTACACGGGG + Intergenic