ID: 1093693312

View in Genome Browser
Species Human (GRCh38)
Location 12:22132083-22132105
Sequence TTTCCAGAAGAGCAGGCATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 243}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093693312_1093693315 4 Left 1093693312 12:22132083-22132105 CCCTATGCCTGCTCTTCTGGAAA 0: 1
1: 0
2: 2
3: 20
4: 243
Right 1093693315 12:22132110-22132132 AAACAAGATATTACATAACTTGG 0: 1
1: 0
2: 1
3: 26
4: 331

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093693312 Original CRISPR TTTCCAGAAGAGCAGGCATA GGG (reversed) Intronic
900265855 1:1756867-1756889 TCTTCAGAAGAGCAGGCGTGGGG - Intronic
902097300 1:13957321-13957343 GTCCCAGAAGAGCAGGGATCTGG - Intergenic
902447565 1:16476693-16476715 CATCCAGAACAGCAGGGATACGG + Intergenic
902467463 1:16626908-16626930 CATCCAGAACAGCAGGGATACGG + Intergenic
902507118 1:16945821-16945843 CATCCAGAAGAGCAGGGATACGG - Intronic
903281331 1:22251633-22251655 CTTCCAGAAGAGCAAGCAGGAGG + Intergenic
903407362 1:23109066-23109088 TTTCCAAAACAGCAAGCATAGGG - Exonic
904430391 1:30460445-30460467 TTGCAAGAAGAGCATGCACATGG - Intergenic
904805365 1:33127556-33127578 TTTCCAGCTGAGCAGAGATAAGG - Intergenic
905096428 1:35475381-35475403 TTTCTAGAAGGGAAGGCAAATGG + Intronic
906108299 1:43307521-43307543 GATCCACAAGAGCAGCCATAGGG - Exonic
911252299 1:95590838-95590860 TTTCAAGAAGAGCAGGAAAAAGG + Intergenic
915084146 1:153373626-153373648 CTGCCAGAAGAGCAGGGGTAAGG + Intergenic
918396781 1:184121501-184121523 TTTAAAGGAGAGCAGGCATCTGG - Intergenic
918447720 1:184631610-184631632 ATTTCAGAAGAGCAGGAAGAAGG + Intergenic
919016535 1:192044816-192044838 TTTCCAGGAGAGGAGGCAGTGGG - Intergenic
921056334 1:211545302-211545324 TTTCCAGAAGAGCAGAGTGAAGG - Intergenic
923622798 1:235591729-235591751 TTTCCAGAAGATGAGGCAAGGGG + Intronic
923650018 1:235865567-235865589 TTTGAAGAAGAGAGGGCATAAGG - Intronic
1063571336 10:7216740-7216762 ATTCCAGGTGAGGAGGCATAGGG - Intronic
1064005200 10:11693776-11693798 CTTCTAAAAAAGCAGGCATATGG - Intergenic
1065250069 10:23801896-23801918 TCTCCAGAAGAATATGCATACGG + Intronic
1065741980 10:28805237-28805259 TGTCCAGAAGAGCTGGGACAAGG + Intergenic
1069268301 10:66491608-66491630 TTACCAAAAGAGCAGGCAAAAGG - Intronic
1070261273 10:74858148-74858170 TTTCCAGGAGAGCAGGAACGGGG + Intronic
1070401212 10:76055262-76055284 TTTCCAGGACACCAGGCATGGGG + Intronic
1070985081 10:80681776-80681798 TTTCCTGGACAGCAGGCAGAAGG + Intergenic
1071522805 10:86341423-86341445 TTTCCAGAAGGGCCCGCTTAGGG + Intronic
1075280348 10:121133497-121133519 CTGCCAGAAGGGCAGGCACATGG - Intergenic
1076257562 10:129040306-129040328 TTTCCTGGAGAGCAGCAATAGGG - Intergenic
1076611964 10:131731761-131731783 TTTCCAGAGGAGAAAGCAGAGGG - Intergenic
1076661137 10:132056853-132056875 TTTCCAGAATACCAGGCACTCGG + Intergenic
1078290860 11:10008416-10008438 TTTTGAGAACATCAGGCATAGGG - Intronic
1083120116 11:60503895-60503917 TTTCCACTAGAGCTGGTATACGG - Intronic
1085833388 11:79927326-79927348 GGTCTAGAAGAGCAGGCATTTGG + Intergenic
1088213520 11:107482395-107482417 TTTCCAGATGAGCAGGTAGCAGG + Intergenic
1090387894 11:126367125-126367147 TTCCCAGAAGGGCTGGCACACGG - Intronic
1090390532 11:126384571-126384593 TTCCCAGAAGGGCTGGCACACGG - Intronic
1090949723 11:131463112-131463134 TTTCCAGAAGAGAAAGCTGAAGG - Intronic
1091179424 11:133590031-133590053 TTGTGAGAAGAGCAGGAATAAGG - Intergenic
1091819004 12:3460398-3460420 TTTTCAGAAGACCAGGCAGCTGG + Intronic
1093161971 12:15757932-15757954 TTTCCAGTTGAGTAGGCATGAGG - Intronic
1093538086 12:20247215-20247237 TTTCCCCAGCAGCAGGCATATGG + Intergenic
1093693312 12:22132083-22132105 TTTCCAGAAGAGCAGGCATAGGG - Intronic
1093903738 12:24664827-24664849 AATCCAAAAGAGCAGGCATGAGG - Intergenic
1094660968 12:32470292-32470314 AATCCAAAGGAGCAGGCATAAGG + Intronic
1095874870 12:47069043-47069065 GTTCCTGCAGATCAGGCATAGGG + Intergenic
1095914060 12:47458286-47458308 TTTCCAATAGAGCAAGAATACGG - Intergenic
1096334792 12:50745878-50745900 TTTTCAGAAGAGAAGTTATATGG - Exonic
1097705231 12:62861617-62861639 ATTCCAGAACAGAAGCCATATGG + Intronic
1099586529 12:84523975-84523997 TTTCTAGAAAAGCAGTCATAGGG + Intergenic
1099739324 12:86611272-86611294 ATTCCAGAACAGCAGGCTTCAGG - Intronic
1101592057 12:106133376-106133398 GTGCCAGAAGAGCAGCCATGGGG - Intronic
1102581945 12:113894938-113894960 TGGCCAGAAGAGCAGGCTTGGGG - Intronic
1103241354 12:119416035-119416057 TTTCCAGGAAAACAGGAATAAGG + Intronic
1103246456 12:119462050-119462072 TTTCCAGAAGATCTGGCAGCTGG + Intronic
1104455219 12:128905481-128905503 TTTCCACAAGAGCAGCCCTGGGG - Intronic
1105604871 13:21919025-21919047 TTTCCAGAAGAGCAGTGAGCTGG + Intergenic
1105885563 13:24638337-24638359 TTTCCAGGGGCGCAGGCAGATGG - Intergenic
1106888264 13:34214100-34214122 ATTCCAGAAGAGGAGTCATCAGG + Intergenic
1106950793 13:34881363-34881385 TATCCAGAATAGCTGGAATAAGG - Intergenic
1109021112 13:57094285-57094307 TTTCCAGAAAAACAGGGGTAGGG - Intergenic
1109876476 13:68410882-68410904 ATTCCATAATAGCAGGCATGGGG + Intergenic
1109929133 13:69190050-69190072 TATCCAGAAGAGCAAAAATAAGG - Intergenic
1110517081 13:76426306-76426328 TTTCCAGAAGCCAAGGCAGATGG - Intergenic
1111989942 13:95106514-95106536 TTTAAAGAAGAGCAAGCAGAAGG + Intronic
1113403645 13:110018541-110018563 ATTCCAGAAGGACAGGCATTAGG - Intergenic
1113704473 13:112418337-112418359 TTTTCAGAAGATGAGGCCTAGGG + Intronic
1114629613 14:24150739-24150761 TTTTCCAAAGAGCTGGCATAGGG - Exonic
1115860667 14:37682748-37682770 TTTCCAACAGAGCGTGCATAAGG + Intronic
1116268645 14:42730127-42730149 TTTCTAGAAAAGCAAGCATGTGG + Intergenic
1116647993 14:47554255-47554277 TTTCCAGAAAAGCAAATATATGG + Intronic
1118005613 14:61562194-61562216 CTTCCAGAAGAGCCTGTATATGG - Intronic
1121013640 14:90535526-90535548 TTTCCAGCAGGGCAGGCGTGAGG - Exonic
1122903486 14:104791590-104791612 CTCACAGAAGAGCAGGCCTAAGG - Intronic
1123679204 15:22745562-22745584 ATTCCAGAACTGCAGGAATATGG + Intergenic
1124331424 15:28820012-28820034 ATTCCAGAACTGCAGGAATATGG + Intergenic
1124955825 15:34359720-34359742 TTTGCTGAAGAGCAAGCAGAGGG - Exonic
1125889690 15:43256406-43256428 TTGCCCGAGGAGCAGCCATAGGG - Intronic
1127074414 15:55311622-55311644 TTTGTAGAAAAGAAGGCATAAGG - Intronic
1127227513 15:56948336-56948358 TTTACAGAAAAGCCTGCATAAGG + Intronic
1127595558 15:60478824-60478846 GTTCCAGAAAAGCAGGTAAAAGG + Intronic
1128665863 15:69538051-69538073 CTTCCAGAAGAGAAGGCCTCAGG + Intergenic
1128758860 15:70201325-70201347 TTTCCAGAAGAGCTGTAATCGGG - Intergenic
1130916437 15:88308787-88308809 TTCCCAGAACAGCTGGCAGATGG + Intergenic
1131372321 15:91893103-91893125 CTTGCAGAAGAGCAGAGATAAGG - Intronic
1132649772 16:1015230-1015252 TTTCCAGAAGAGCCGACAAGAGG + Intergenic
1132787185 16:1663908-1663930 TTTCCACACGGGCAGGTATATGG + Intronic
1134047514 16:11111726-11111748 TTATCAAAAGAGCAGGCATTAGG + Intronic
1134223124 16:12370919-12370941 TTTCCAGAAGAACAGGTCAAAGG - Intronic
1135857638 16:26026576-26026598 TCTCCAGAAGAACAAGAATATGG + Intronic
1136317391 16:29462300-29462322 CTTCCAGAAGAACAGGTACATGG - Intronic
1136367360 16:29814895-29814917 TTTCCAGAAGTGCAGGGATAGGG - Intronic
1136431966 16:30201644-30201666 CTTCCAGAAGAACAGGTACATGG - Intronic
1137380267 16:47992008-47992030 TTTCTATAACAGCAGCCATATGG + Intergenic
1137842102 16:51650223-51650245 TTGCCAGAAGACCAGGGCTAAGG + Intergenic
1138757436 16:59505459-59505481 CTTCAAAAAGAGCAGGCATTGGG - Intergenic
1140095183 16:71869091-71869113 TTTCCAGGAGACCAGGCATAAGG + Intronic
1140653741 16:77117932-77117954 ATTTCAGAAGTGCAGGCATGAGG - Intergenic
1140933637 16:79651273-79651295 TTTCCAGATGGGCAGGGTTATGG + Intergenic
1143305594 17:5944127-5944149 TTGCCAGGAGACCAGGCAGAAGG - Intronic
1144703071 17:17351157-17351179 TGTCAAGAAGAGCTGGCCTAGGG - Intergenic
1146282073 17:31551014-31551036 TTATCAGAAGAGAAGGTATAGGG + Intergenic
1146584706 17:34072112-34072134 TTTGCAGCAGGGCAGGCATCGGG + Intronic
1147455361 17:40534646-40534668 TTTCCAGCAGAGCAGGGGTAGGG - Intergenic
1148188478 17:45661782-45661804 TCTGGAGAAGAGCAGGCAGAAGG + Intergenic
1149482575 17:57015778-57015800 TTTCCAGAAAGCCAGGCACATGG - Intergenic
1152411262 17:80124505-80124527 GATCAGGAAGAGCAGGCATAAGG - Intergenic
1153230288 18:2928590-2928612 ATTCCAGAAGAGCTTGCCTAAGG - Exonic
1153313930 18:3703728-3703750 TTTCCAGAAAAGAGGGCATTTGG - Intronic
1155319970 18:24609390-24609412 CTTCCAGCAGAGGAGGCAGACGG - Intergenic
1156113462 18:33756933-33756955 TTTCCAGAACAGCTTGCATATGG + Intergenic
1156147869 18:34208014-34208036 TGTCCAGAGGACCAGGAATAGGG - Intronic
1156765708 18:40652456-40652478 TTTTCAGAAAAGGAGGCATATGG - Intergenic
1160973817 19:1782550-1782572 GTTCCGGAAGAGCTGGCAAAAGG - Exonic
1163190575 19:15673773-15673795 CTTCCAGAGGAGCAGGAATGGGG + Intronic
1168463081 19:56577896-56577918 TTTCCGGCAGAGCACGCATCTGG + Exonic
1168643533 19:58045449-58045471 TTTCCAGAAGATCCGGGAGACGG + Intronic
926963232 2:18381605-18381627 GTTCCAGAAGAGCTTGCATGGGG + Intergenic
927416634 2:22887087-22887109 TTTCCAGAAGCACAGGCCTCAGG + Intergenic
927478499 2:23432507-23432529 TTTCCAGAAGTGCAAGGACAGGG - Intronic
927519475 2:23690301-23690323 TTTGCAGAAGAGGAGGCTGAGGG + Intronic
931014400 2:57959867-57959889 TGTCCTGAAGAGCAGGCAATAGG + Intronic
931977887 2:67663529-67663551 TTTCCATAACAGCAAGCAAAGGG + Intergenic
933097558 2:78205855-78205877 TTGCCATATGAACAGGCATATGG - Intergenic
933589516 2:84216446-84216468 TTTCCAGAAGAGGACTCAAAGGG - Intergenic
935793844 2:106620186-106620208 TTTCCAGAACAGAAAGCATCAGG - Intergenic
939174329 2:138731948-138731970 TTGGCAGAAGTGCATGCATATGG - Intronic
939214666 2:139220394-139220416 CTTCCAGAAGAGAAGTAATAAGG + Intergenic
939569509 2:143824148-143824170 TTTCCAAAAGCCCAGGCAGAGGG + Intergenic
942063603 2:172250064-172250086 TTTCAGGAAGAGCAGGCAAGTGG - Intergenic
943279186 2:185909913-185909935 TTTCCAGATGATCAGTGATATGG + Intergenic
945043282 2:205760434-205760456 TCTCCAGACGAGCAGGCCTCTGG - Intronic
946066791 2:216994782-216994804 TTTCCAGAAGAGAGGCAATACGG - Intergenic
946592533 2:221266510-221266532 ATTCCAGTTTAGCAGGCATAGGG + Intergenic
948685481 2:239667069-239667091 GATCCAAAAGAGCAGGCAGAGGG + Intergenic
1169055658 20:2618699-2618721 TTTTCAGAAGGTCAGGCATTTGG - Intronic
1169249632 20:4050427-4050449 TTTCCAGCAGAGGAGGAACATGG - Intergenic
1169503243 20:6181893-6181915 GTTCCAGAAGATCAAGCAGAGGG - Intergenic
1169739505 20:8876789-8876811 TTGCCAGAAGAGGAGACACATGG - Intronic
1173283116 20:41646956-41646978 ATTACAGAAGAGAAGGCAGAAGG + Intergenic
1173331457 20:42079242-42079264 TTCCCAGAAGAACTGGCATCAGG + Exonic
1174723927 20:52841364-52841386 GTTCCACAAGAGCAGGGATTTGG + Intergenic
1175693441 20:61083124-61083146 GTTCCAGAAGAGCACCCAAACGG + Intergenic
1178749679 21:35289275-35289297 ATTACAGAAGAACAGGGATAGGG + Intronic
1179104116 21:38383414-38383436 TGCCCAGATGAGAAGGCATATGG + Exonic
1182391602 22:30001862-30001884 TTTCCAGAAGAGGAGACTTCTGG - Intronic
1182881973 22:33741599-33741621 TTGCGAGAAGAGCAGGCTTCTGG + Intronic
1183362388 22:37389475-37389497 TTCTCAGAGGAGGAGGCATAAGG - Intronic
1185195145 22:49464653-49464675 TTTCCAGAAGGGCATGGAAATGG + Intronic
949099300 3:124868-124890 TTTCAAGAAGTGAAGGGATAAGG + Intergenic
950786892 3:15444457-15444479 ATTCCAGTAAAGCAGGCATTGGG + Intronic
952047582 3:29342168-29342190 TTTCCAGAAGTGGAGGCTTCAGG + Intronic
952489727 3:33856275-33856297 ATTCCAGAACTGCAGGAATATGG + Intronic
953204634 3:40813833-40813855 TTTTCGGAAGAGCAGACTTATGG + Intergenic
953611147 3:44448584-44448606 TCAACAGAAGAGCAGGCAGAAGG - Exonic
958451725 3:94281334-94281356 CTGTCAGATGAGCAGGCATATGG - Intergenic
958911531 3:99999695-99999717 TTGCCAGAAGTTCAGGCAAAAGG + Intronic
959729783 3:109588738-109588760 TCTTCAGAATAGCAGGCATATGG - Intergenic
964712029 3:159681268-159681290 TTTCCAGAAGAGGAGAAATGGGG + Intronic
964742865 3:159985905-159985927 TTTGCAACAGATCAGGCATATGG - Intergenic
965203928 3:165696289-165696311 TTAACAGAAGAAAAGGCATACGG - Intergenic
969180117 4:5433936-5433958 CTTCCAGAAAAGCAGGAACATGG - Intronic
970520559 4:16879763-16879785 TCTCCAGAAAAGCAGATATAGGG - Intronic
970792975 4:19880958-19880980 TTTCCAGAAGCGGAGGCTGAGGG - Intergenic
972159854 4:36210441-36210463 GCTCCATAAAAGCAGGCATAGGG + Exonic
972824285 4:42738365-42738387 TTTCCAGATGAGCAGCATTAAGG + Intergenic
973173358 4:47173421-47173443 TTTCCAGCACAACAGACATAGGG + Intronic
973262462 4:48178684-48178706 TTTCCACCAGAGCAGGGAGAAGG + Intronic
984575045 4:181438284-181438306 AATCCAGGGGAGCAGGCATATGG - Intergenic
985200253 4:187477241-187477263 TTTCCCAAATAGGAGGCATATGG + Intergenic
986265347 5:6185675-6185697 CTACCTGAAGAGAAGGCATAAGG + Intergenic
986671532 5:10146951-10146973 TTTCCAGACCAGCAGCCATGGGG + Intergenic
986819916 5:11454913-11454935 TTTCCAGAAGAGAAATCATTTGG + Intronic
987805621 5:22761670-22761692 TTTCCAGATGAGCAAGCACTTGG - Intronic
988459991 5:31426319-31426341 TTTCCAGAAGAGCCAGCTAAAGG - Intronic
991504452 5:67309483-67309505 TGCCCAGAAGAGCAAGCACATGG - Intergenic
997407927 5:133667073-133667095 TTTGCAGAAGATCAGGAATTAGG - Intergenic
998661947 5:144248558-144248580 TTTTCAAAAGAGCAGCCAGAGGG - Intronic
1002104546 5:176873623-176873645 GTCCCAGAAGAGCAGGCAGCAGG + Intronic
1002802309 6:536090-536112 TCTCCAGAAGATCAGGAATAAGG + Intronic
1002846336 6:948505-948527 TTTCCAGGAGAGGAGGAAGAAGG + Intergenic
1004629271 6:17406202-17406224 TTTCCAGAAGAACAGGAAAAAGG - Intronic
1004802504 6:19165722-19165744 TTTCCAGAATATCAGGCAGTTGG - Intergenic
1005244799 6:23870505-23870527 TCTCCATATGAGCAGGCATATGG - Intergenic
1007087239 6:39157325-39157347 TTTCGAGAAGATGAGGCATCAGG - Intergenic
1007363937 6:41376756-41376778 TTTCCTGAAGAGCAGTGGTATGG - Intergenic
1007721485 6:43887823-43887845 GTGCCAGACGAGCAGGCACAGGG + Intergenic
1008322617 6:50135504-50135526 TTTGCAGCACAGCAGGCCTAGGG - Intergenic
1009027498 6:58017387-58017409 TTCCCAGATGAGGAGGCATCAGG + Intergenic
1009203031 6:60768863-60768885 TTCCCAGATGAGGAGGCATCAGG + Intergenic
1009966705 6:70585938-70585960 TTAACAGAAGAAAAGGCATACGG - Intronic
1011060511 6:83261244-83261266 TTTTCAAAAGAACATGCATACGG - Intronic
1011326696 6:86156336-86156358 TTTCCAGAAGTTCTGGTATAGGG - Intergenic
1012508678 6:99977915-99977937 TTTCCAGAAAAGCAGTGATATGG - Intronic
1012789019 6:103668628-103668650 TTTCCAAAATAGCATGCATTTGG - Intergenic
1013396970 6:109751259-109751281 TTTATAGAACAGCTGGCATATGG - Intronic
1015604800 6:134943712-134943734 TTGCCAGAGGAGCAGGCACATGG + Intronic
1016760454 6:147730511-147730533 TTTCCAGAGGAGCAGGTTTGGGG + Intronic
1017398887 6:154036565-154036587 ATTCTAGAAGAAAAGGCATATGG + Intronic
1017682511 6:156878326-156878348 TTGCCAGAAGGGCAGGAACAAGG + Intronic
1017912793 6:158808673-158808695 TTTACAGATGAGGAGGCAGAGGG + Intronic
1018566375 6:165158731-165158753 TCTCCAGAAGTTCAGGCAGATGG - Intergenic
1019886566 7:3910972-3910994 TGCCCAGAAGAGCAGGCAGCGGG - Intronic
1020192549 7:6011156-6011178 TATACAGAGGAGCAGGCATGGGG + Intronic
1020288641 7:6706100-6706122 ATTCCACAAGAGCAGACCTAAGG + Intronic
1022104133 7:27186161-27186183 GCTCCAGAAGACCAGGCAGATGG - Intergenic
1026305099 7:69133832-69133854 TTTCTAGAGAAGCAGGCAGAGGG + Intergenic
1026448477 7:70506327-70506349 TCTCCAGAAGCGCTGCCATAAGG - Intronic
1028370536 7:90087120-90087142 TTCCCACAAGAGCATGTATACGG + Intergenic
1029820454 7:103141711-103141733 CTGCCGGAAGGGCAGGCATATGG - Intronic
1030081528 7:105782705-105782727 TTTCTAAAAGAGCTGCCATAGGG + Intronic
1030255649 7:107506701-107506723 TTTCCCGCAGGGAAGGCATATGG - Intronic
1032982444 7:137299706-137299728 CTTTCACAAGGGCAGGCATAGGG - Intronic
1033223388 7:139543327-139543349 CTTCCAGAAAAGCAGGGAGAGGG - Intronic
1035703136 8:1652550-1652572 TTTCCAGGAGAGCAGAGACAAGG + Intronic
1035712332 8:1728165-1728187 TTTCCAGAAGGTCATGCAGATGG - Intergenic
1038075075 8:24063707-24063729 TTTCCACTAGATCAGGCAAATGG - Intergenic
1038208285 8:25490434-25490456 TTTCTAGAAGACCAAGCAGATGG + Intronic
1038247439 8:25872046-25872068 TTTCCTTAAGAGGAGGCACAGGG + Intronic
1038449756 8:27632637-27632659 CTCCCAGAAGATCAGGCTTAAGG - Intergenic
1038500223 8:28037560-28037582 TCTCCAGAAGAGAAGGACTAGGG - Intronic
1039289263 8:36076506-36076528 TTTCAAGAGCAGCAGGCATAAGG + Intergenic
1039651887 8:39350557-39350579 CTTCCAGAAGAGAAAGCATCAGG + Intergenic
1041157734 8:55005410-55005432 GCTCCAGAAGAGCAGGCAGGGGG - Intergenic
1043093381 8:75932837-75932859 TTTCCAGAAGAATAAGCAGAAGG + Intergenic
1043420011 8:80088421-80088443 TTTCCAGAGGAGTGAGCATAAGG + Intronic
1044147480 8:88735456-88735478 TTTGCAGAAGAGCAGGATGAAGG + Intergenic
1044545414 8:93453937-93453959 TTTCCAGAAGGGAAGGAAAAGGG + Intergenic
1045448475 8:102292969-102292991 TTTCCAGAAAAGGAGGAAAAGGG + Intronic
1045501473 8:102747415-102747437 TGTCCTGGAGAGCAGGCACAAGG - Intergenic
1045530718 8:102982774-102982796 TTTCCAGAAGACTAGGGATAAGG + Intergenic
1047223383 8:122937071-122937093 TTGCCAGAAGAGGAGGAAAAGGG + Intronic
1047480413 8:125276842-125276864 TTTCCAGAAGAGATGGCATTTGG - Intronic
1047566073 8:126046008-126046030 TTTCCAGATGAGAAGGAATAGGG - Intergenic
1048872371 8:138810237-138810259 TTGGAAGAAGAGCAGGCATTGGG + Intronic
1049375942 8:142289255-142289277 TTTCCAGAAAAGAAGGCTCAGGG - Intronic
1050305142 9:4299068-4299090 TTTCAAGTAGAGCGGGCAGAGGG - Intronic
1050401647 9:5262361-5262383 TGTCTTGAAGAGCAGGCTTATGG + Intergenic
1050618868 9:7431983-7432005 TTTCCAGACAAGCAAGCATGAGG - Intergenic
1052034395 9:23663403-23663425 TTTTCAGTAGAGCAGGTATGAGG - Intergenic
1053391784 9:37741133-37741155 TTCCCAGAAGAGGGGGCAAATGG + Intronic
1053703262 9:40723103-40723125 TTTCCAGAATTCCAAGCATACGG + Intergenic
1055087746 9:72331561-72331583 TTTTCAGAAGAACAGTCACAGGG - Intergenic
1056944079 9:90978922-90978944 TTTCCAGAATATCATGCTTAAGG - Intergenic
1056944870 9:90985628-90985650 TTTCCAGAATAGCACGCTTAAGG - Intergenic
1057458803 9:95240037-95240059 TCTCCTGAAGGGTAGGCATAAGG - Intronic
1059733931 9:117083147-117083169 TTTGCTGAAGACCAGGAATATGG - Intronic
1059799741 9:117738173-117738195 TTTCCAGGAGGGCAGACACAGGG + Intergenic
1059825725 9:118026713-118026735 TATCCAGGAAAGGAGGCATATGG - Intergenic
1061222072 9:129258120-129258142 TTTCCATAGGAGCAGGAAAAAGG + Intergenic
1061952666 9:133945005-133945027 TTTCCAGAAGGCCAGGCACTGGG + Intronic
1185962776 X:4563911-4563933 GCTCCAGAAGAGTAGCCATAGGG - Intergenic
1186642447 X:11470459-11470481 TTTGCTGAAGATCAGGCAAATGG - Intronic
1186831746 X:13397198-13397220 CTTTCAGAAGAGCAGCCTTAAGG + Intergenic
1187345134 X:18456893-18456915 TTTCCAGAAGCACAGGGTTAGGG - Intronic
1188330041 X:28858897-28858919 TTTTCCAAAGACCAGGCATAGGG - Intronic
1191703031 X:64063713-64063735 TCTCCTTAAGAGCAGGGATAAGG - Intergenic
1192381842 X:70625420-70625442 TTTCCATTAGAGCAAGAATATGG - Intronic
1194404862 X:93483890-93483912 TTTGCAGGAGAGCAGGGATTAGG - Intergenic
1194765355 X:97842378-97842400 TTTGCAGAAGACAAGGCAAATGG + Intergenic
1194858740 X:98967773-98967795 TTTGCATATGAGCAGGCAGATGG - Intergenic
1196815117 X:119659258-119659280 TTTCCATATGAGCAGGAATCTGG + Intronic
1198231236 X:134691637-134691659 TTTCCAGAAGGGCCGTCCTAAGG - Intronic
1199031481 X:143005424-143005446 TTTACCAAAGAGTAGGCATATGG + Intergenic
1199534261 X:148884483-148884505 TTTCCAGAAGAGAAGCCAGAAGG - Intronic