ID: 1093699018

View in Genome Browser
Species Human (GRCh38)
Location 12:22196776-22196798
Sequence AAACTCGTGCTGTCTAAATG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 63}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093699018_1093699020 19 Left 1093699018 12:22196776-22196798 CCACATTTAGACAGCACGAGTTT 0: 1
1: 0
2: 2
3: 4
4: 63
Right 1093699020 12:22196818-22196840 TAAGGCAGTGTAAAATTTTGAGG 0: 1
1: 0
2: 1
3: 21
4: 303
1093699018_1093699019 1 Left 1093699018 12:22196776-22196798 CCACATTTAGACAGCACGAGTTT 0: 1
1: 0
2: 2
3: 4
4: 63
Right 1093699019 12:22196800-22196822 AGCAAAAACAAAACAGTTTAAGG 0: 1
1: 0
2: 3
3: 87
4: 982

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093699018 Original CRISPR AAACTCGTGCTGTCTAAATG TGG (reversed) Exonic
906791933 1:48666466-48666488 AAACACCTGCTGTTTAACTGGGG - Intronic
908816304 1:68038987-68039009 AAACTCGTACTGCCTTATTGGGG + Intergenic
919291178 1:195633137-195633159 AAATTCCTTCTGTCTAACTGAGG - Intergenic
920214712 1:204353891-204353913 AAACTGGGGCTGTCTCACTGGGG - Intronic
1065704807 10:28462754-28462776 AAGCTGGTGATGTATAAATGAGG - Intergenic
1069731207 10:70615545-70615567 AAACTGGTGCTGTCCTTATGGGG - Intergenic
1076277120 10:129210541-129210563 AATCGCAAGCTGTCTAAATGTGG + Intergenic
1088664613 11:112081652-112081674 AATATCATGCTGTCTACATGGGG - Intronic
1089135140 11:116242932-116242954 AATCTCCTGATTTCTAAATGTGG + Intergenic
1089623040 11:119733471-119733493 AAACACATGCTCTTTAAATGTGG - Intergenic
1092087190 12:5772882-5772904 AAACACGTGCTGTCAAGAAGGGG + Intronic
1093699018 12:22196776-22196798 AAACTCGTGCTGTCTAAATGTGG - Exonic
1097113105 12:56676943-56676965 AAAATAGTGCTGGCTAAGTGCGG + Intronic
1098541412 12:71662347-71662369 AACTTCGTGCTGACTAAATGAGG - Intronic
1101649227 12:106659816-106659838 TAACTCATCCTGTGTAAATGAGG - Intronic
1108258482 13:48633140-48633162 AACCTGGTGCTGTGTAAGTGTGG + Intergenic
1112423196 13:99272490-99272512 AAACTCGTGCTGTCATAGAGTGG + Intronic
1114962846 14:27916629-27916651 AAACTAGTGCTATCAAACTGTGG + Intergenic
1115872385 14:37819541-37819563 ACACTCGTGGTGACTAAATTGGG - Intronic
1125418675 15:39479931-39479953 AATCTCATGATGTCCAAATGGGG - Intergenic
1126952465 15:53896736-53896758 AAATTCTGGCTTTCTAAATGTGG + Intergenic
1127345514 15:58093716-58093738 AAACAATTGCTGTCCAAATGGGG + Intronic
1134169468 16:11956928-11956950 CAATTGGTGCTGCCTAAATGAGG - Intronic
1139970884 16:70774139-70774161 AAACTCGTGATGTTCAAATTAGG - Intronic
1151859275 17:76747720-76747742 AAACATGTGCTGGCTGAATGGGG - Intronic
1154936881 18:21068892-21068914 AAAATCATGCTGTCTAAATTGGG + Intronic
1155847433 18:30726924-30726946 ATACTGTTGCTGTCTATATGAGG + Intergenic
1157490178 18:48117794-48117816 AAATTGGTGCTGTCTATCTGGGG - Intronic
1160820748 19:1056597-1056619 ACACTCTTGCTTTATAAATGGGG + Intronic
1164738398 19:30559344-30559366 AAACTGGCCCTGCCTAAATGTGG - Intronic
929983578 2:46703326-46703348 AAACTTGTGATGGCTACATGTGG - Intronic
932082720 2:68730470-68730492 AAACTCGTTCTGTAGAGATGGGG - Intronic
932763468 2:74455709-74455731 AGACTCTTGCTGCCTAAATCTGG - Intronic
932974820 2:76586083-76586105 AAACTAGTGCTGTCTAACTGAGG - Intergenic
935861497 2:107336193-107336215 ATACTTGCGCTGTTTAAATGGGG - Intergenic
937108880 2:119346820-119346842 AAACTAGTGAAATCTAAATGAGG + Intronic
941034247 2:160550234-160550256 AAACTACTGATTTCTAAATGAGG + Intergenic
944349248 2:198707760-198707782 AAACCCATGCTGTCTATCTGTGG + Intergenic
1171112973 20:22501153-22501175 AAGCTCATGCTCTATAAATGGGG + Intergenic
949912086 3:8919885-8919907 ACACTCCTGCTGGCCAAATGTGG + Intronic
954848581 3:53581058-53581080 AGAATCTTGCTGTCTAAATGGGG + Intronic
955141974 3:56278518-56278540 AAACTGGTGAAGTTTAAATGAGG + Intronic
959916480 3:111822028-111822050 AAACTCTTCCTGTAGAAATGTGG - Intronic
970272482 4:14362104-14362126 CAACTCAGGCAGTCTAAATGTGG - Intergenic
971654241 4:29321667-29321689 AAACTCCTTCTGTATAAATAAGG + Intergenic
979197955 4:117942268-117942290 AAACACGTGCTGTTGAAAAGCGG - Intergenic
981446873 4:144850207-144850229 AAAGTCGTGTTGCCTGAATGGGG - Intergenic
982153150 4:152485778-152485800 AAACTGGTGCTATAAAAATGAGG + Intronic
986289804 5:6390711-6390733 AAACGCATTCTGTCTAAAGGTGG - Intergenic
987702630 5:21421443-21421465 AAACTCTTCCTGTATATATGAGG + Intergenic
996244126 5:121238699-121238721 ATACTCATGCTGTGTAAAAGAGG - Intergenic
1002168814 5:177363981-177364003 AATCTCTTGCTTTTTAAATGTGG + Intronic
1002271615 5:178076096-178076118 AACCTCGTTCTGTCCAACTGTGG + Intergenic
1011381529 6:86746886-86746908 AAATACATGCTGTCTACATGGGG - Intergenic
1018364636 6:163107012-163107034 AAAGTCATTCTGTCTAAATTAGG + Intronic
1018811012 6:167298249-167298271 ACACCCGTGCTGTCTAACAGAGG + Intronic
1019580009 7:1757067-1757089 AAACTTGTGCTGACTAAAGATGG - Intergenic
1023725174 7:43136144-43136166 AACCTCGTCCTGTCTCTATGTGG + Intronic
1023957308 7:44896765-44896787 ACACTCCTGCTGGCTAAATCTGG + Intergenic
1024184594 7:46937223-46937245 AGACTTATGCTCTCTAAATGTGG - Intergenic
1027926059 7:84465541-84465563 ATAGTCTTGCTTTCTAAATGTGG + Intronic
1030842058 7:114367332-114367354 ACACTTCTGCTGACTAAATGTGG + Intronic
1042651760 8:71050519-71050541 AAGCTCCTGCTGTCTTAATTCGG - Intergenic
1044705409 8:95003862-95003884 ACATTCATGCTGTCTAAATTGGG + Intronic
1046170898 8:110504323-110504345 AAATTCCTGCTGTCTAATTGAGG + Intergenic
1047679070 8:127235518-127235540 AAACTCGTGGTCTCCAAAAGAGG - Intergenic
1052059970 9:23947566-23947588 AAACTAGTGCTGTCTAAAAGAGG - Intergenic
1059576666 9:115496643-115496665 AGACTAGTGCAGTCCAAATGTGG - Intergenic
1061816480 9:133200232-133200254 AAACACGTGCTTTACAAATGGGG + Intergenic
1190754587 X:53390554-53390576 AAACTGGTGATGGCTATATGAGG + Intronic