ID: 1093700059

View in Genome Browser
Species Human (GRCh38)
Location 12:22210255-22210277
Sequence ACATATACATATGTGGTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 225}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093700059 Original CRISPR ACATATACATATGTGGTGCA TGG Intronic
902988223 1:20168752-20168774 GCACATACATGTGTGGTACAGGG - Intronic
903783750 1:25841867-25841889 TCATATAGAGATGTGGTTCATGG - Intronic
904152455 1:28453508-28453530 ATATATACATAGGTGGTGGCTGG + Intronic
910026028 1:82654336-82654358 ATATATGCATATATGGTGTATGG + Intergenic
910861077 1:91742809-91742831 TCAAATACAAATGTTGTGCATGG - Intronic
911730583 1:101288240-101288262 CCATACACATGTGTGGGGCATGG + Intergenic
916923158 1:169489970-169489992 ACATAAACATATATTGTACAAGG - Intergenic
917410572 1:174756448-174756470 ATATATATATATATGGTACAGGG - Intronic
919800564 1:201351629-201351651 AGATATACATATGCAGTGCCTGG - Intergenic
919899792 1:202035262-202035284 AAATATACATATGACGTGGAAGG + Intergenic
920014325 1:202894111-202894133 ACATATATAATGGTGGTGCATGG - Intronic
920603593 1:207355699-207355721 ACATTAACATATGTGGTTAATGG - Intronic
920727916 1:208454527-208454549 ACATATTTCTATTTGGTGCATGG - Intergenic
923522486 1:234746462-234746484 AAATATACACATGTTGTGAAAGG - Intergenic
924657284 1:245984394-245984416 ACAAATAGATTTGTGCTGCATGG - Intronic
1063925751 10:10975690-10975712 ACATTCACATATATGGTGGAAGG + Intergenic
1065520801 10:26569536-26569558 AGATATTTGTATGTGGTGCAGGG + Intergenic
1066211456 10:33243307-33243329 ACATATAAATATATGGAGTATGG - Intronic
1066279778 10:33905081-33905103 TCATATTTGTATGTGGTGCAAGG + Intergenic
1070949270 10:80418062-80418084 ACATATGCATATTTGTTACATGG + Intronic
1071065217 10:81624773-81624795 ACATATAGATATGTGCTACACGG + Intergenic
1071568532 10:86684107-86684129 AGAGAAACAGATGTGGTGCAAGG + Intronic
1071879376 10:89878427-89878449 ATATATACCTATGGGGTACATGG + Intergenic
1073024428 10:100476716-100476738 ACATATACACATGATCTGCAGGG - Intronic
1077605649 11:3609536-3609558 ACATAGACATTTCTGGAGCAAGG + Intergenic
1078966007 11:16343866-16343888 ACAAATACATATGTGTATCAAGG + Intronic
1079384171 11:19964269-19964291 TCACATACAAATCTGGTGCATGG - Intronic
1079733333 11:23962850-23962872 ACATATGCAGATGTGGAGCTGGG - Intergenic
1079970720 11:27032069-27032091 ACACATACACGTGTGGGGCAAGG - Intergenic
1080801427 11:35613772-35613794 ACATATTAATTTATGGTGCAAGG + Intergenic
1082758564 11:57103298-57103320 ACACAGACATATGTGGTGTGAGG - Intergenic
1085056347 11:73406354-73406376 GCATAAACAGATGTGGTCCAGGG - Exonic
1085820176 11:79783973-79783995 AAAAATACATGTATGGTGCAAGG - Intergenic
1085954672 11:81377437-81377459 ACCAATACATAGGTGGTGGAAGG + Intergenic
1086900380 11:92360966-92360988 ACAAATACATATGTGTAACAAGG - Intronic
1087298318 11:96403273-96403295 ACATATGCAGATTTGTTGCATGG - Intronic
1087746561 11:101954448-101954470 ATATATACATGTTTGCTGCAGGG - Intronic
1087834047 11:102852431-102852453 ATATATATATATGTTGGGCATGG - Intergenic
1088060793 11:105647167-105647189 TCATATACTTATGGGCTGCATGG - Intronic
1089345321 11:117787297-117787319 ACAAATACTTAGGTGGTGCCAGG - Intronic
1089712112 11:120323031-120323053 ATATATATATATGTAGTGCTTGG + Intergenic
1091974804 12:4815741-4815763 ACATAAATCTCTGTGGTGCAAGG + Intronic
1092691824 12:11120330-11120352 GCCTATACATGTGTGGTGTAGGG + Intronic
1093700059 12:22210255-22210277 ACATATACATATGTGGTGCATGG + Intronic
1094228040 12:28068462-28068484 AGATATAAATATCTGGTACAGGG + Intergenic
1095424191 12:42057498-42057520 ACACATACATATATTGTGAAGGG - Intergenic
1095557923 12:43529684-43529706 AAATCTACATATGAGGTGCAAGG + Intronic
1095563969 12:43598925-43598947 AAATGTACATTTGTGGTGTATGG - Intergenic
1096913567 12:55008940-55008962 ACAAATAGATATGTGTTGAATGG + Intergenic
1096924121 12:55123274-55123296 ACATATACATATATGATATATGG + Intergenic
1097552626 12:61095087-61095109 ACATATCTATATGCTGTGCATGG + Intergenic
1098914401 12:76242188-76242210 ATATATACATATATAGTGCTAGG + Intergenic
1101774559 12:107781867-107781889 ACATACACATTTGCGGTGGAGGG - Intergenic
1102286725 12:111663668-111663690 ACATAAACACATGTGGTTCAGGG - Intronic
1106031444 13:26009208-26009230 ACATATTTATGTGTGGTTCAAGG - Intronic
1106157893 13:27174005-27174027 AAAAATAAATACGTGGTGCATGG + Intergenic
1106955700 13:34936178-34936200 ACATGGACATATTTGGTGAAGGG + Intergenic
1107222880 13:38006675-38006697 ACAAATACATCTGTGGAGTAAGG - Intergenic
1107227942 13:38073390-38073412 ACATTTTCATATGTGGTAGATGG - Intergenic
1108235635 13:48401604-48401626 ACATACACATTTGTGGTCCTTGG + Intronic
1108877709 13:55068106-55068128 ACATATAAATAAATGGTGGAGGG - Intergenic
1110643038 13:77848631-77848653 ACATAGACATATGTGTTCCTCGG + Intergenic
1114372668 14:22107616-22107638 AAATGTAAATCTGTGGTGCATGG + Intergenic
1116023484 14:39488662-39488684 ACATCTAAGTATGTGGTGCTGGG + Intergenic
1116117064 14:40667682-40667704 ACATATACATAAGTTATCCATGG - Intergenic
1116242971 14:42370429-42370451 ACATATGAATTTGTGGTGAAGGG - Intergenic
1120485302 14:85105611-85105633 ACATATGCATATTTGTTACACGG + Intergenic
1120862574 14:89268102-89268124 ACATATACATATATGCTGCTTGG + Intronic
1121026216 14:90618162-90618184 ACATCCACATGTGTGGTCCAAGG + Intronic
1125098796 15:35885893-35885915 ACATATATATCTTTGGTGAAGGG - Intergenic
1126433592 15:48612768-48612790 TCATTTACATATGTTGTGCCTGG - Intronic
1126965905 15:54053521-54053543 ACATATATTTATGGGGTACATGG + Intronic
1126974088 15:54154643-54154665 ACATATAGATATGAGGAGGAGGG + Intronic
1126998349 15:54472892-54472914 ACATGTACAGATTTGTTGCATGG + Intronic
1127112935 15:55693758-55693780 ACATATACATATGTGTACCCAGG + Intronic
1128726049 15:69989380-69989402 AGATATACATATATGGAGGAAGG + Intergenic
1133698111 16:8284196-8284218 ACATAAACAGATTTGGTCCATGG - Intergenic
1139000309 16:62501913-62501935 ATAAATACATAGTTGGTGCAAGG - Intergenic
1140034664 16:71363252-71363274 ACATATACATATTTCTTACAAGG - Intronic
1143454532 17:7057717-7057739 ACATATACATTTGGGGGACAGGG + Intergenic
1145711039 17:26978069-26978091 ACATATACAAAAGTGGTCCCAGG + Intergenic
1146116472 17:30144882-30144904 AAATATATATATGTGCTGCTTGG + Intronic
1146710343 17:35035484-35035506 GAATATACATATGTGGGGAAGGG + Intronic
1147049272 17:37778974-37778996 ACATATACATCTTGGGTGCCTGG - Intergenic
1147328129 17:39679879-39679901 ACACATACATGTGTGGGGCAAGG - Intronic
1149677611 17:58479985-58480007 ACATGTACAGATGTGGTGCTGGG + Exonic
1149804883 17:59607081-59607103 ACAAATCCATATCTGATGCACGG + Exonic
1155360335 18:24993251-24993273 ACATATTCTTATTTGGTTCAGGG + Intergenic
1155824744 18:30425939-30425961 ACATGTGCAGATGTGTTGCATGG + Intergenic
1156601204 18:38609256-38609278 ACACATATATATATGGTGTATGG - Intergenic
1164760866 19:30727333-30727355 ACATATGAATTTGGGGTGCAAGG + Intergenic
1165225472 19:34351771-34351793 ACATAGCCACATGTGGTGAATGG - Intronic
1165659488 19:37563554-37563576 ATATATACATATATGGTATATGG + Exonic
1166424448 19:42663226-42663248 ATATATATATATATGGTGCCTGG - Intronic
1167201246 19:48066991-48067013 ACACATACATGAGTGGTGCAGGG + Intronic
1167559779 19:50219139-50219161 ACATATATATATGTATTCCATGG - Intronic
926482487 2:13417178-13417200 ATATATGCATATGTGGAGTATGG - Intergenic
926924979 2:17978142-17978164 ACATGTACAGATGTGTTACATGG + Intronic
930953152 2:57169239-57169261 AAATATAAATATGAGGTGGATGG + Intergenic
933265086 2:80172998-80173020 ACATATAAATTTGTGGGGAAGGG + Intronic
933398294 2:81759657-81759679 ACAAAAACATAAGTGGTGAAAGG + Intergenic
935964898 2:108463857-108463879 CCATATCCACAGGTGGTGCATGG + Intronic
937550226 2:123079319-123079341 ACATATGCATATTTGTTACATGG + Intergenic
939668296 2:144977790-144977812 ACTTATACAGCTGTGGTGCCAGG + Intergenic
939845374 2:147238329-147238351 ACATAAACATATCTGGTCCTGGG + Intergenic
940970126 2:159887134-159887156 ACATATATATATGTGGCTTATGG + Intronic
941605849 2:167595476-167595498 ACATACACACATGTGGAGGAAGG - Intergenic
942996570 2:182268461-182268483 ATATATACATATATAATGCATGG + Intronic
944044304 2:195390998-195391020 ACATTGACAAATGTGGTGCTTGG + Intergenic
944333892 2:198505673-198505695 ACATATACATGTTTGTTTCATGG - Intronic
945399653 2:209365626-209365648 ATATATATTTATGGGGTGCATGG + Intergenic
947481735 2:230506832-230506854 ACATATATATATGTAGTTCCTGG + Intronic
1169575001 20:6950004-6950026 ACTTTTACATATATGATGCAGGG + Intergenic
1175088455 20:56481566-56481588 ACATATACAGAAGTGGGACATGG - Intronic
1175335129 20:58190773-58190795 ACATATACTCATTTAGTGCATGG + Intergenic
1175705423 20:61173018-61173040 ACATATATATATGGGGTGGGTGG + Intergenic
1175741687 20:61424446-61424468 ATATATACATGTGTGCTGTATGG - Intronic
1175885686 20:62289194-62289216 AATTATACATCTGTGGAGCAAGG - Exonic
1177364753 21:20119538-20119560 ACATATACAGATTTGTTACATGG - Intergenic
1177397513 21:20556760-20556782 GCATATATTTATGTGGTACAAGG + Intergenic
1184710065 22:46244578-46244600 TCATATCCTTATGTGGTGCTTGG - Exonic
949386889 3:3512847-3512869 ACATTTACATATTTGTTACATGG - Intergenic
950178077 3:10890002-10890024 AAATAGACATATGTGGTTTATGG - Intronic
950510366 3:13421958-13421980 ACATATACATATGTCTTGCGAGG + Intergenic
951314455 3:21171506-21171528 ACATCTACATATGTCTTCCAAGG - Intergenic
952432827 3:33241556-33241578 ACAACATCATATGTGGTGCAAGG - Intergenic
957232382 3:77537083-77537105 ACATATACATATTTTGTGGGGGG + Intronic
957833921 3:85560851-85560873 ACATTTACATATTTGGAGCTGGG - Intronic
958116134 3:89220140-89220162 ACATATAAATATGTAGTGGAAGG + Intronic
959409392 3:106001277-106001299 ACATATACAGATTTGTTACATGG - Intergenic
959732733 3:109622578-109622600 ACATATATTTATGGGGTGCATGG - Intergenic
960016921 3:112901855-112901877 AAGTAAAAATATGTGGTGCATGG - Intergenic
961411378 3:126723397-126723419 ACATATACAGATCTGCTCCAAGG - Intronic
962230087 3:133657333-133657355 ACATATATATATTTGGGACAGGG - Intronic
962775238 3:138652850-138652872 AGATATATATATGGGGTACATGG - Exonic
965290987 3:166880195-166880217 ATATATACATATCTTTTGCAGGG - Intergenic
965290999 3:166880909-166880931 ATATATACATATCTTTTGCAGGG - Intergenic
966190071 3:177264469-177264491 ACATATACATATGTATTACTAGG - Intergenic
966289430 3:178338152-178338174 ACATGTACATATTTGTTACATGG + Intergenic
966414960 3:179679882-179679904 ACATATACATAAGATGGGCATGG + Intronic
967859141 3:194138411-194138433 ATATATACAAATATAGTGCATGG - Exonic
968242695 3:197105703-197105725 ATATATACATATATAGTGCAAGG + Intronic
969160335 4:5252198-5252220 ACATATTTATATGTGGGGAAGGG - Intronic
973156501 4:46961463-46961485 ACATTTACTTGTGTGGGGCAAGG - Intronic
974076851 4:57175004-57175026 ACATATACATATTTGAGACAGGG + Intergenic
975885091 4:78955659-78955681 AAATATACATTTGTGGTACTGGG + Intergenic
977437744 4:97021332-97021354 AAATATCATTATGTGGTGCAAGG + Intergenic
977978077 4:103290270-103290292 ACATATATGTCTGTGGTGCCTGG + Intergenic
978441179 4:108735567-108735589 ACATATACATGTGGTATGCAAGG - Intergenic
978882967 4:113730028-113730050 ACATATACCTAAGATGTGCACGG - Intronic
978922820 4:114205041-114205063 AAATATAAATATGGGGTACATGG - Intergenic
980195379 4:129581693-129581715 ATATATATATATATGGTACAAGG - Intergenic
980428815 4:132663473-132663495 ACATTTACATTTCTGGGGCACGG - Intergenic
981257737 4:142682956-142682978 ACACATATATATGTGCTGAATGG + Intronic
981624136 4:146737220-146737242 AGAAATGCCTATGTGGTGCATGG + Intronic
981960824 4:150536764-150536786 ACATAAACAAATGAGGTGAAAGG + Intronic
982739271 4:159040750-159040772 ACATAAAAATATGTGGTACTAGG - Intergenic
983687598 4:170429987-170430009 ACATATAGTGATGAGGTGCATGG - Intergenic
984470361 4:180163307-180163329 ACATATACCTGTGTCATGCATGG + Intergenic
986404114 5:7408303-7408325 ACATCAACATTTGTGGTGCGTGG - Intronic
987219429 5:15774390-15774412 ACATAGACATCTTTGGTGGAGGG + Intronic
987565404 5:19577792-19577814 CCATATTCATATTTGTTGCAGGG - Intronic
989527625 5:42471437-42471459 ACATATACACTTATGATGCAAGG + Intronic
991173271 5:63653802-63653824 ACTTCTATATATGTGGAGCAAGG + Intergenic
992278117 5:75142406-75142428 ATATATAGATATGTGCAGCAGGG - Intronic
992936060 5:81706441-81706463 ACATGTACAGATTTGTTGCATGG - Intronic
994210346 5:97081271-97081293 ATATATATATATGTGGTATATGG - Intergenic
995163154 5:109005426-109005448 ACACATACATATGCGGTTAATGG + Intronic
997428454 5:133820498-133820520 AAATATACATAAGTGGAGTAGGG - Intergenic
998636804 5:143964463-143964485 ATATATACATATATGTTTCATGG - Intergenic
999324622 5:150636184-150636206 AAATATGTATAGGTGGTGCATGG - Intronic
1004027461 6:11833153-11833175 ACATAGACATATGTGTCACATGG + Intergenic
1005705496 6:28447487-28447509 ACAGAAATATATGTGGTGCCAGG + Intergenic
1008287093 6:49667039-49667061 ACATTTACATATTTGGGGAAAGG + Intergenic
1010457763 6:76078284-76078306 ACATAGACATATGCTCTGCAGGG + Intergenic
1010886193 6:81244351-81244373 AGATAATCATATGTGGTGAACGG + Intergenic
1010973343 6:82286527-82286549 ACATATATATGTGTGGTGTGTGG - Intergenic
1011187833 6:84698591-84698613 ACAAATACATCTGCTGTGCAGGG + Intronic
1012849015 6:104424505-104424527 AGATATATATGTGTGTTGCAGGG - Intergenic
1013411449 6:109887632-109887654 ACAAATATATATGTGCTCCAAGG - Intergenic
1015856340 6:137628975-137628997 ACATATACATATATGGTCTGTGG + Intergenic
1016002434 6:139055855-139055877 ACATATACACATGTGGTATTGGG - Intergenic
1016641706 6:146356793-146356815 CCATATACATATATGGTGTGTGG + Intronic
1016931436 6:149414523-149414545 ACATATATATATCTGGAGCCAGG - Intergenic
1016968714 6:149742880-149742902 AAATATACATATCTGGCCCACGG + Intronic
1017982529 6:159413572-159413594 CCATCTTCAGATGTGGTGCAAGG + Intergenic
1018511448 6:164528581-164528603 ACATAGACATCTTTGGTGCAGGG + Intergenic
1019767079 7:2859394-2859416 ATATATATATATGTGGTGATTGG - Intergenic
1021255249 7:18384335-18384357 ACATATACATATGTACTAGAAGG + Intronic
1021578403 7:22126494-22126516 ACTTACACATATGTGCTGAATGG + Intronic
1021953168 7:25796079-25796101 ACATACACTTGTGTGGAGCAAGG + Intergenic
1023619454 7:42054986-42055008 ACATATATATATTTGAGGCAAGG - Intronic
1023647785 7:42337303-42337325 ACAGAATCATATGTGGGGCATGG - Intergenic
1024908330 7:54414820-54414842 ATATATATATATCTGGAGCAAGG + Intergenic
1026100548 7:67380961-67380983 ACATATGTACATGTGATGCATGG + Intergenic
1030750954 7:113232154-113232176 GCATATACCTTGGTGGTGCAAGG + Intergenic
1030964708 7:115976474-115976496 AAATAGACACATGTGGTTCATGG + Intronic
1031667392 7:124501642-124501664 ACATATAAATATTAGGTGGAGGG + Intergenic
1032544894 7:132733807-132733829 ACGTATAAATACGTGATGCATGG + Intergenic
1035011694 7:155723840-155723862 GCATATACACATGTTGTACAAGG - Intronic
1037035125 8:14157202-14157224 ACATATACATTGGTGGTCCCAGG - Intronic
1039436987 8:37566447-37566469 ACATATGCATATGTAATACATGG - Intergenic
1042606968 8:70555331-70555353 ACATATATATTTGGGGGGCATGG - Intergenic
1043692313 8:83169439-83169461 ACTTCTACATATGTGTTTCATGG - Intergenic
1044752127 8:95426463-95426485 ACATGGACACATGAGGTGCAGGG + Intergenic
1044901090 8:96945406-96945428 ACATACACAGATGTGCTTCAGGG + Intronic
1045138019 8:99244892-99244914 ATGTGTACATGTGTGGTGCATGG + Intronic
1045355887 8:101388756-101388778 ACATTTTTATTTGTGGTGCAGGG + Intergenic
1045575697 8:103417689-103417711 ACATACACATATGTTGAGAAGGG + Intronic
1047676058 8:127203932-127203954 ATACATACATATGATGTGCATGG - Intergenic
1047676059 8:127203969-127203991 ATACATACATATGATGTGCATGG - Intergenic
1047676060 8:127204006-127204028 ATACATACATATGATGTGCATGG - Intergenic
1047676061 8:127204043-127204065 ATACATACATATGATGTGCATGG - Intergenic
1047676062 8:127204080-127204102 ATACATACATATGATGTGCATGG - Intergenic
1047676063 8:127204117-127204139 ATACATACATATGATGTGCATGG - Intergenic
1048286970 8:133149414-133149436 AGACATACAGTTGTGGTGCAGGG + Intergenic
1051772364 9:20592601-20592623 ACATACGAATTTGTGGTGCATGG + Intronic
1052175538 9:25458098-25458120 ACATATACATGTGGTGTGCTAGG + Intergenic
1052396318 9:27942792-27942814 ATATATAAATATGTGGGGAAGGG - Intergenic
1052474440 9:28940453-28940475 AAAAAAACATATGGGGTGCATGG - Intergenic
1054979739 9:71191480-71191502 ACAAATACATAAGTGTTGGAAGG - Intronic
1055831927 9:80389982-80390004 ACATATATATATATGGAGGATGG + Intergenic
1056224139 9:84479020-84479042 ACATATACAGATGTGTAACATGG + Intergenic
1056722916 9:89086978-89087000 ACACATACATACGTGGCCCATGG + Intronic
1058165985 9:101619866-101619888 ACAAATACATATTGTGTGCAGGG - Intronic
1058234802 9:102476442-102476464 ATATATACATATTTTTTGCATGG - Intergenic
1058724146 9:107786052-107786074 ACATATACATTTGGGGGGCAAGG - Intergenic
1060885117 9:127146106-127146128 ACATGTACATATTTGTTACACGG + Intronic
1185944852 X:4363835-4363857 ACATATGTATACGTGGTGGAAGG + Intergenic
1187752494 X:22482608-22482630 ACATATGCATATTTGTTACATGG - Intergenic
1188948147 X:36334006-36334028 AAATATACAAATGTGCTGAAAGG + Intronic
1192311590 X:70020260-70020282 AAATGTACATATGTGGGGCCGGG + Intronic
1192465858 X:71355414-71355436 ACATATTAATAGGTGTTGCATGG - Intergenic
1194330320 X:92576051-92576073 ACATATATATAGGTGCTCCAGGG + Intronic
1195048584 X:101077091-101077113 ACAAATAAAAATGTGATGCATGG - Intergenic
1200639025 Y:5695122-5695144 ACATATATATAGGTGCTCCAGGG + Intronic
1201068761 Y:10125296-10125318 ACATATACATATATAGTGTGGGG - Intergenic
1201602018 Y:15741411-15741433 ACATATACATTTGTGGTGGCCGG + Intergenic
1201909900 Y:19123504-19123526 ACATATGCATACGTGTGGCATGG + Intergenic
1202133698 Y:21638318-21638340 ACATGTATATATGTGTTCCAAGG - Intergenic