ID: 1093714485

View in Genome Browser
Species Human (GRCh38)
Location 12:22366136-22366158
Sequence GGGCATGGGATCCACTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 202}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093714485_1093714490 6 Left 1093714485 12:22366136-22366158 CCAGCACAGTGGATCCCATGCCC 0: 1
1: 0
2: 2
3: 21
4: 202
Right 1093714490 12:22366165-22366187 CACAGCAAGCTAAGATCCACAGG 0: 11
1: 585
2: 700
3: 452
4: 348

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093714485 Original CRISPR GGGCATGGGATCCACTGTGC TGG (reversed) Intronic
900600732 1:3501693-3501715 GGGCCTGGGATCCGCAGGGCTGG + Intronic
902711730 1:18244513-18244535 GTGCAAGGGATCCATTGTTCCGG - Intronic
902748007 1:18486201-18486223 GGACATGGGATCCTGAGTGCCGG + Intergenic
903329144 1:22588335-22588357 GGGCATGGGAGCCTCTGTCTGGG - Intronic
904272402 1:29358752-29358774 GGACATGGGACCCTCTTTGCTGG - Intergenic
904278251 1:29398183-29398205 GGGCCTGGGTTCCAGCGTGCTGG + Intergenic
905915497 1:41681706-41681728 GGGCAAGTGATCCAGTGGGCTGG + Intronic
906078332 1:43068184-43068206 GGGGAGGGGATCCAGTTTGCAGG + Intergenic
911013492 1:93306814-93306836 GGGCATGGGATCCAGAGCCCTGG - Intergenic
914839932 1:151240071-151240093 GGGTAAGGGAGCCACTGGGCAGG - Intronic
914889761 1:151612274-151612296 GGGTCTGGGCTCCACTGCGCCGG + Exonic
915163037 1:153933072-153933094 GGGCATGGGCTCCAGAGTGCTGG - Intronic
918906814 1:190506322-190506344 GGGGGTGGGATCCGCTGAGCTGG + Intergenic
919207699 1:194437907-194437929 AGGTTTGGAATCCACTGTGCTGG - Intergenic
919598979 1:199599665-199599687 GGGGTTGGGATCCACTGAGCTGG - Intergenic
920444625 1:206006555-206006577 GCCCATGGGATGCACTGTGAAGG - Intergenic
920536788 1:206742697-206742719 GGGCAGGGGCTCCTCTCTGCGGG - Intergenic
921106144 1:211980715-211980737 AGGCATGAGAGCCACTGTCCTGG + Intronic
924412378 1:243819611-243819633 GCGGAGGGGATGCACTGTGCTGG - Intronic
1063651151 10:7938292-7938314 GGACATGGGCCCCACTGCGCAGG + Intronic
1064307993 10:14185975-14185997 GGCCAGAGGATCAACTGTGCAGG + Intronic
1067575551 10:47406317-47406339 GGCCATGGGATCCCCTGCCCAGG + Intergenic
1069626139 10:69868765-69868787 GGCCATGGGATCCTCAGTGTGGG - Intronic
1069832901 10:71291813-71291835 GGGCAGGGGCTCACCTGTGCCGG - Exonic
1070311513 10:75276724-75276746 GGGGCTGGGAGCAACTGTGCTGG + Intergenic
1071437711 10:85662511-85662533 GAGCTGGGGATCCAGTGTGCAGG - Intronic
1073627646 10:105116275-105116297 GAACAGGGGATCCACAGTGCAGG - Intronic
1074295421 10:112183456-112183478 GGGCATGGGTTCCCCTGGGTTGG - Intronic
1074839694 10:117337766-117337788 GGGCAAGGGAGCTACTTTGCTGG - Intronic
1075800205 10:125149073-125149095 GGGCAGAAGATCCACTGAGCTGG - Intronic
1077184830 11:1231338-1231360 GGGCAGGGCATCCAGTGGGCCGG - Intronic
1077210536 11:1369190-1369212 GGGCATGGGATCCCCTCCTCTGG - Intergenic
1081960558 11:47133519-47133541 GGGCTGGGGGACCACTGTGCTGG - Intronic
1083755683 11:64790447-64790469 GAGCCTGGGATCCCCTCTGCAGG + Exonic
1084594509 11:70108987-70109009 GGGCAAGGGACCCACTGTGGGGG - Intronic
1085312882 11:75526293-75526315 GGGCATGGGGACTGCTGTGCGGG + Intergenic
1085402356 11:76242479-76242501 GGGCTGGGGATCCACTCTGAGGG + Intergenic
1087374565 11:97325726-97325748 AGGCTTGGAGTCCACTGTGCTGG + Intergenic
1089092246 11:115887831-115887853 AGGGAGGGGAGCCACTGTGCAGG - Intergenic
1093179283 12:15949478-15949500 GGGCGTGGGACCCTCTGAGCCGG + Intronic
1093714485 12:22366136-22366158 GGGCATGGGATCCACTGTGCTGG - Intronic
1096172324 12:49482236-49482258 GGGCATGGGAGGCACTGAGATGG - Intronic
1096530812 12:52241722-52241744 GGGCCTGGGTCCCACTGTTCTGG + Intronic
1100279581 12:93105828-93105850 GGGCATGGGATCCACAAGGAGGG - Intergenic
1102613366 12:114131968-114131990 GGGCATGGGATCCTATGAGAGGG - Intergenic
1103587816 12:121969145-121969167 TGGCAGGGGGTACACTGTGCTGG - Intronic
1103867656 12:124065611-124065633 TGCCATGGGATCCAATGGGCTGG - Intronic
1104404559 12:128506706-128506728 GAGCATGGGAGCCACTGGGATGG - Intronic
1104987771 12:132606647-132606669 GGGCATCGGATCGGCTTTGCAGG - Intronic
1105889776 13:24674268-24674290 CGGCCTGGGTTCCCCTGTGCTGG - Intergenic
1107818564 13:44266191-44266213 GTGCATGGGAAGCTCTGTGCTGG - Intergenic
1111870131 13:93821480-93821502 GGGCCTGGGATGCACAGTTCAGG + Intronic
1113143458 13:107179922-107179944 GGGCCTGGGATCCAATATGCTGG - Intronic
1113943812 13:114032891-114032913 GGGCATGGTATCAAGTGTGGGGG - Intronic
1113943857 13:114033069-114033091 GGGCATGGTATCAAGTGTGGGGG - Intronic
1114579518 14:23744704-23744726 GGGCATGGGACTCTCTGAGCTGG + Intergenic
1115010637 14:28540583-28540605 GGTCAGTGGATCCACTGTTCTGG - Intergenic
1117576737 14:57106290-57106312 AGGCATGGGATACAATCTGCTGG + Intergenic
1117884336 14:60343851-60343873 GGGCATGGAATCCACAGATCTGG - Intergenic
1118613874 14:67562234-67562256 GGGCCTGGGAGCCACTGTCCTGG - Exonic
1121961627 14:98265533-98265555 GGGCAATGGATCCACTGTTGAGG + Intergenic
1122308292 14:100779199-100779221 GAGCAGCGGAGCCACTGTGCTGG - Intergenic
1122370422 14:101226296-101226318 GGTCACGGGATCCACTGAGAAGG + Intergenic
1122459320 14:101882322-101882344 TGGCCTGGGATCCACAGAGCGGG + Intronic
1122481116 14:102048105-102048127 GACCATTGGTTCCACTGTGCCGG + Intronic
1124413693 15:29457455-29457477 GGGAAGGGGCTGCACTGTGCAGG + Intronic
1124610792 15:31207013-31207035 GGGCATGTGATGCAGTGAGCAGG - Intergenic
1124890371 15:33726577-33726599 GGGCCTGGGGGCCACTGTGCTGG - Intronic
1127625954 15:60780346-60780368 AGGCCTGGGAACCACTGGGCTGG + Intronic
1128422130 15:67503008-67503030 GGGCTGGGGATGTACTGTGCTGG + Intergenic
1129603038 15:77011367-77011389 TGGGCTGGGCTCCACTGTGCTGG - Intronic
1129970140 15:79771032-79771054 GGGTATGGGATCCACTTCACAGG + Intergenic
1130126131 15:81095579-81095601 GGGCACCAGAACCACTGTGCAGG - Intronic
1130938821 15:88491201-88491223 GAGCATGGCAGTCACTGTGCTGG + Intergenic
1132652734 16:1028909-1028931 GGTCCTGGGATGCTCTGTGCGGG + Intergenic
1136030026 16:27495992-27496014 TGGCATGTGATCCTCGGTGCTGG + Intronic
1136479652 16:30533552-30533574 GGGCATAGGAACCATAGTGCAGG + Intronic
1137573261 16:49580222-49580244 CGTCATGGGAGCCACTGTCCCGG + Intronic
1137674372 16:50297037-50297059 GGGCAAGGGACCCTCTGTGTGGG - Intronic
1137675423 16:50301614-50301636 TGGCCTGGGAGCCACTGGGCAGG + Intronic
1137932804 16:52604619-52604641 GGGGCTGGTGTCCACTGTGCAGG + Intergenic
1141712418 16:85707810-85707832 GGGCCTGGGAAACACTGTTCTGG + Exonic
1141756759 16:85996617-85996639 GGGCAGGAGAGCCACTGTGGGGG - Intergenic
1142180279 16:88665377-88665399 TGGCAGGTGACCCACTGTGCTGG - Intergenic
1143419223 17:6776081-6776103 GCACATGGGATCCACTGACCAGG + Intergenic
1144369658 17:14577933-14577955 ATGGATGGGATCTACTGTGCAGG - Intergenic
1144371387 17:14594819-14594841 AGGCAGAGGATCCACTGAGCTGG + Intergenic
1144764404 17:17724912-17724934 GGGCAGGGGGGCCACTGGGCAGG - Intronic
1146265354 17:31449239-31449261 GGGGCTGGGATCCAGTGTTCAGG - Intronic
1147141757 17:38464440-38464462 GGCCCTGGGAGCCGCTGTGCTGG + Intronic
1147911785 17:43860406-43860428 GGCCATGGGATTCACTGTCCAGG + Intronic
1148106470 17:45121409-45121431 GGGCAGGGGAGCCTCTGGGCAGG - Intronic
1148667926 17:49388519-49388541 GGGCAGGGGTGCCAGTGTGCTGG + Intronic
1149561319 17:57609722-57609744 GGGCTTCGGATCCACTGGGGAGG + Intronic
1150762863 17:67978260-67978282 GGGGCTGTGAACCACTGTGCTGG + Intronic
1152353342 17:79795238-79795260 GGGCTTGTCATCCACTCTGCTGG + Exonic
1152632940 17:81418693-81418715 GGGCATGGGAGCCACACAGCTGG - Intronic
1153059395 18:980036-980058 GGAGGTGGGATCCACTGAGCTGG + Intergenic
1153229870 18:2925293-2925315 GGGGATGGGGTCCACTGTGATGG + Exonic
1156355535 18:36337300-36337322 GGGGATCGTATTCACTGTGCAGG - Intronic
1157862717 18:51155260-51155282 GGGCCTGAGATCCACTTGGCTGG - Intergenic
1160913869 19:1487671-1487693 AGGCACGGGACCCGCTGTGCTGG - Exonic
1161124431 19:2547796-2547818 GGGCCTGGGAGCCTCTGTCCTGG - Intronic
1163062100 19:14768270-14768292 TGGCCTGGGACCCACTGTCCAGG - Intronic
1164085640 19:21899758-21899780 GGGCGTGGGACCCATTGAGCTGG + Intergenic
1165093105 19:33396786-33396808 GGGCATGGGGCCCTCAGTGCTGG + Intronic
1166894895 19:46016927-46016949 GGGCCTGGGAAGCACTGGGCGGG + Intronic
1167597146 19:50433736-50433758 GGGGATGGCATCCTCTGGGCAGG + Intronic
1168676220 19:58279596-58279618 GGGCAGGGGCTCCGCGGTGCTGG - Exonic
925826064 2:7849675-7849697 GAGCATGGGAGCCACTCTGAGGG + Intergenic
926061817 2:9809237-9809259 GGGCATGTCAGCCACTCTGCTGG - Intergenic
926116798 2:10218437-10218459 GGGCCTGGTGTCTACTGTGCTGG + Intergenic
926297749 2:11580894-11580916 GGGCATGGGAGCTGCTGGGCTGG + Intronic
926698742 2:15788603-15788625 GGGCATGGGGGCCACTGACCCGG - Intergenic
927953057 2:27186975-27186997 GGGCAGGGCATCCATTTTGCTGG + Intergenic
927961433 2:27242724-27242746 GCGCATGCCACCCACTGTGCGGG + Exonic
927979832 2:27368057-27368079 GGGCATTGGAGCCACTGACCAGG + Exonic
929687809 2:44049464-44049486 GGACATGGGAGCCATTTTGCTGG + Intergenic
934219094 2:90065093-90065115 GTCCATGGGAGCCACTCTGCTGG + Intergenic
934527004 2:95058262-95058284 GGGCCCGGGAGCCACTCTGCTGG - Intergenic
934612579 2:95752104-95752126 GGGCAGGGGCTCCACTGGGTTGG - Intergenic
934648335 2:96072319-96072341 GGGCAGGGGCTCCACTGGGTTGG + Intergenic
934841568 2:97627340-97627362 GGGCAGGGGCTCCACTGGGTTGG + Intergenic
935225454 2:101048289-101048311 GGGCATGGCACACACTGTACTGG + Intronic
937457683 2:122056983-122057005 AAGCATGAGAACCACTGTGCTGG + Intergenic
937866806 2:126758533-126758555 GGGCATGGGATCAGCTGGGCAGG - Intergenic
938403881 2:131016459-131016481 GGGCATGGGGGGCACTGGGCAGG - Intronic
938480562 2:131658534-131658556 TGGCAGGGGCTCCTCTGTGCAGG + Intergenic
938802640 2:134777113-134777135 GGGCATAGGATGCACTGGGTGGG + Intergenic
939319633 2:140601584-140601606 GAGCCTGGGATACACTGTACTGG - Exonic
942953708 2:181750480-181750502 GGGGGTGGGATCCGCTGAGCTGG + Intergenic
943866520 2:192930947-192930969 GGGCATGGGAGCCACTGAGCTGG + Intergenic
948775237 2:240284563-240284585 GGGGATGGGAACCACTCTACGGG - Intergenic
1168732029 20:92774-92796 GGGCATGGGATAAACTGAGGGGG - Intronic
1169283913 20:4291113-4291135 GAGCATGTGATCCTCTGAGCAGG + Intergenic
1170472918 20:16685977-16685999 GGGCAAGGGATCCTCTTTGCTGG + Intergenic
1170623501 20:18013215-18013237 GGGCATGGGAGCCACTTGGGAGG + Intronic
1171329536 20:24325553-24325575 GGGCCTGGGGTCCACAGAGCAGG - Intergenic
1172636069 20:36410789-36410811 TGGAATGGGATCCCCTGTGTTGG - Intronic
1173750150 20:45470001-45470023 GGGTGTGGGGTCCAATGTGCTGG + Intronic
1176045775 20:63091940-63091962 GGGCCTGGGATCCGGTCTGCAGG - Intergenic
1176307568 21:5131963-5131985 GGGCACAGGACCCTCTGTGCAGG + Intronic
1176447343 21:6831534-6831556 GGTCATGGGATCCGCACTGCCGG + Intergenic
1176825511 21:13696560-13696582 GGTCATGGGATCCGCACTGCCGG + Intergenic
1178544008 21:33478864-33478886 TGTCAAGGGATCCACAGTGCAGG + Intronic
1178551514 21:33543291-33543313 GGGCCTGGGATCCATTTTCCGGG + Intronic
1178955033 21:37014357-37014379 GTGCACGGCACCCACTGTGCTGG - Intronic
1179445380 21:41426853-41426875 AGGCATGGCATCCACTGGGGCGG - Intronic
1179849492 21:44130067-44130089 GGGCACAGGACCCTCTGTGCAGG - Intronic
1180999925 22:19983270-19983292 AGGCAAGGGACCCATTGTGCAGG - Intronic
1181270923 22:21658020-21658042 GGGCATGGGACCGGCTGGGCGGG + Intronic
1182319151 22:29467035-29467057 GGGGATGGGATCTAGTGAGCAGG + Intergenic
1182550613 22:31098982-31099004 GGGCCTGGGATCCACTGGGTGGG + Intronic
1183023116 22:35043222-35043244 GGCCACAGCATCCACTGTGCTGG + Intergenic
1184409779 22:44319823-44319845 AGGAGTGGGATGCACTGTGCCGG + Intergenic
949342509 3:3044998-3045020 GGGCATGGGACCCTCTGAGCCGG - Intronic
951606407 3:24439420-24439442 TGGCATGGGATCCTCTGTCTGGG + Intronic
953848139 3:46445077-46445099 GGGCATGGGAAGTGCTGTGCAGG + Intronic
954218051 3:49135313-49135335 TGGCCTGGTAGCCACTGTGCAGG - Intergenic
954402810 3:50327927-50327949 GGGCATGGGTTCCACCCTGGCGG - Intronic
958882214 3:99685506-99685528 GGGCATAGTATAGACTGTGCAGG - Intronic
960725324 3:120664126-120664148 GGGTAGGGGATCTACAGTGCAGG + Intronic
961530503 3:127537293-127537315 AGGCATGGGATGGACTCTGCGGG + Intergenic
962713185 3:138104302-138104324 GAACATGGGTCCCACTGTGCAGG + Intronic
967267724 3:187705404-187705426 GAGCATGGGATAGATTGTGCTGG + Intronic
968065117 3:195754212-195754234 GGGGATGGGCGGCACTGTGCGGG - Exonic
968619825 4:1599068-1599090 GGCCAGGGGATCCAGGGTGCCGG + Intergenic
968619846 4:1599134-1599156 GGCCAGGGGATCCAGGGTGCTGG + Intergenic
968619868 4:1599200-1599222 GGCCAGGGGATCCAGGGTGCCGG + Intergenic
968619887 4:1599266-1599288 GGCCAGGGGATCCAGGGTGCCGG + Intergenic
970793041 4:19881601-19881623 GACTATGGGTTCCACTGTGCAGG - Intergenic
971382369 4:26110734-26110756 GGGCATGGCCTCCACGGTGCTGG + Intergenic
972224161 4:36992826-36992848 AGGCATGGTGTCCTCTGTGCAGG - Intergenic
985675508 5:1229559-1229581 AGATATGGGATCCACTGTCCAGG - Intronic
985791395 5:1930502-1930524 GCGGTTGGGATCCCCTGTGCTGG + Intergenic
990234316 5:53750834-53750856 GGGCATGGGACCCACTGAGCTGG - Intergenic
992038892 5:72808970-72808992 GGGGGTGGGATCCACTGAGCTGG + Intergenic
999133316 5:149300706-149300728 GGGCATGGGAGCAGCTGAGCTGG + Intronic
999805767 5:155079850-155079872 GGGCTGGGCATGCACTGTGCTGG + Intergenic
1000945418 5:167417293-167417315 GGGCCAGGGATGGACTGTGCTGG - Intronic
1003971005 6:11299195-11299217 GGGCGTGGGACCCACTGAGCCGG - Intronic
1006026181 6:31148565-31148587 GGGCAAGGGAGCCCCTGTTCCGG - Intronic
1006969979 6:38032756-38032778 AGACATGGCATCTACTGTGCAGG - Intronic
1007930414 6:45685949-45685971 GGGAAGGGGATCCACAGTTCTGG + Intergenic
1008332405 6:50260373-50260395 GGCCATGGGGCCCACTCTGCTGG + Intergenic
1010039164 6:71361262-71361284 GGGGGTGGGATCCGCTGAGCTGG + Intergenic
1013476143 6:110508961-110508983 AGGCAGAGGATCCACTGAGCTGG + Intergenic
1014739787 6:125135671-125135693 TGTCATGGGATTCACTCTGCAGG - Intronic
1018108701 6:160513887-160513909 GGGGGTGGGATCCACTGAGCTGG - Intergenic
1018711727 6:166502059-166502081 GGGCTGGGGAGCTACTGTGCAGG + Intronic
1019388023 7:769438-769460 GGGCGTAGGATGCACAGTGCAGG + Intronic
1024427164 7:49239742-49239764 AGGCTTGGAGTCCACTGTGCTGG + Intergenic
1028083114 7:86601223-86601245 GGGTTTGGAGTCCACTGTGCTGG - Intergenic
1033470108 7:141639477-141639499 GGGCGTGGGATCCAGAGTACTGG + Intronic
1033612952 7:142983878-142983900 AGGCATGGCATGCAGTGTGCTGG + Intergenic
1034192317 7:149222050-149222072 AGGCATGAGAACCACTGGGCTGG + Intronic
1034371075 7:150597449-150597471 GGGCATAGGATCCTCTGAGCCGG - Intergenic
1034390961 7:150787413-150787435 GAGCACGGGATTCTCTGTGCAGG - Intergenic
1034481393 7:151322447-151322469 AGGCATGGGATCCAGGCTGCTGG + Intergenic
1035685752 8:1522438-1522460 GAGCACGGGATCCACAGTGCTGG + Intronic
1038040083 8:23716978-23717000 GGGCATGTGAGTTACTGTGCAGG + Intergenic
1038532400 8:28328988-28329010 GGGCCTGTGATTCACTTTGCAGG - Intronic
1038584554 8:28777298-28777320 GGGCCACGGAACCACTGTGCTGG - Intronic
1038681110 8:29669482-29669504 GGGGATGGGATCCTTTGTGAAGG - Intergenic
1039435658 8:37557590-37557612 GGGCATGGGGTGATCTGTGCAGG - Intergenic
1041838349 8:62242178-62242200 GGGAGTGGGATCCGCTGAGCTGG + Intergenic
1046334651 8:112769402-112769424 GGCCATGAGATCCACTTTGCTGG + Intronic
1048110180 8:131459825-131459847 AGGCATGGGTCCCACAGTGCAGG - Intergenic
1049343393 8:142125827-142125849 GGGCCTGGGTTCCTCTGTGGAGG - Intergenic
1049820016 8:144627834-144627856 GGGCAAGGGGTCCAGGGTGCAGG - Intergenic
1053336261 9:37275155-37275177 GAGCATGGGTTTCACTATGCTGG - Intronic
1053602708 9:39626773-39626795 GCGCATGGGGACCACTGTTCTGG + Intergenic
1054564935 9:66750175-66750197 GCGCATGGGGACCACTGTTCTGG - Intergenic
1055414626 9:76067953-76067975 AGGCATGGGACTCGCTGTGCTGG + Exonic
1057037797 9:91824453-91824475 GGGCAGGGCATCCCCTCTGCAGG + Intronic
1057854952 9:98594698-98594720 GGGGATGGGCTGCCCTGTGCAGG - Intronic
1059356388 9:113702548-113702570 AGGCTTGAGAACCACTGTGCTGG - Intergenic
1060212492 9:121719132-121719154 GGTCATGTGCTCCACTTTGCAGG - Intronic
1062354746 9:136156686-136156708 GGTAATGGGAGCCACTGGGCTGG - Intergenic
1203521847 Un_GL000213v1:52997-53019 GGTCATGGGATCCGCACTGCCGG - Intergenic
1190161511 X:48034849-48034871 GGGTATGGGATAAACTTTGCAGG - Intronic
1192149040 X:68700467-68700489 GGGCAGGGGTTCCTCTGTGGTGG - Intronic
1193164284 X:78263877-78263899 GGGGAGGGGGTGCACTGTGCTGG + Intergenic
1193228439 X:79013371-79013393 GGGGGTGGGATCCACTGAGCTGG + Intergenic
1196602964 X:117623029-117623051 GGGGTTGGGATCCACTGAGCAGG + Intergenic
1199747331 X:150781602-150781624 CAGCATGTGATACACTGTGCAGG - Intronic