ID: 1093722796

View in Genome Browser
Species Human (GRCh38)
Location 12:22463922-22463944
Sequence GTTTTATTATGATCAAAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 310}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093722794_1093722796 -5 Left 1093722794 12:22463904-22463926 CCTATTTAAACATTCTCAGTTTT 0: 1
1: 0
2: 5
3: 60
4: 509
Right 1093722796 12:22463922-22463944 GTTTTATTATGATCAAAACTGGG 0: 1
1: 0
2: 1
3: 28
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093722796 Original CRISPR GTTTTATTATGATCAAAACT GGG Intronic
902845741 1:19109312-19109334 GTTATTTTAGGATAAAAACTTGG + Intronic
904187513 1:28716996-28717018 TTTTTATTAAAAACAAAACTTGG + Intronic
907970372 1:59375085-59375107 TTTTTTTTTTGATGAAAACTAGG - Intronic
908375266 1:63530933-63530955 GTTGTATAATGATCAAATCAAGG + Intronic
908650858 1:66331635-66331657 TTTTTATTTTGATTAAAGCTGGG - Intronic
909156175 1:72079642-72079664 ATTTTTAAATGATCAAAACTTGG + Intronic
909368618 1:74858707-74858729 GATTTTTTATGATCATAACGAGG + Intergenic
909516430 1:76512516-76512538 GTTGTATAATGATCAAATCAAGG + Intronic
911866091 1:103024083-103024105 GTTTTATTATGATCATGATGAGG + Intronic
916344651 1:163774480-163774502 GTTATTTTAGGAACAAAACTAGG - Intergenic
916382570 1:164228757-164228779 TTTTTATTATGACCTACACTCGG - Intergenic
916595545 1:166239100-166239122 TATTTATAATGAACAAAACTTGG - Intergenic
917343106 1:174000920-174000942 GTATTTTTACAATCAAAACTGGG - Intronic
918416383 1:184312261-184312283 GTTGTATAATGATCAAATCAGGG + Intergenic
918897068 1:190361706-190361728 ATATTATTATTATAAAAACTGGG - Intronic
919402562 1:197137957-197137979 TTTTTATTATGATAAAAGATTGG - Intronic
920291338 1:204925285-204925307 GTTTTCTTATGTTTAAAAGTGGG - Intronic
920752197 1:208689504-208689526 GTGTTATGATGAGAAAAACTAGG - Intergenic
921489390 1:215755970-215755992 GTTTTATTATTTTGAAAATTGGG + Intronic
921597687 1:217072678-217072700 GTTTTACTATTTTCTAAACTGGG + Intronic
921913597 1:220579651-220579673 GTTTCAATATGATTAACACTGGG + Intronic
923617754 1:235551786-235551808 GTATTAATATGATATAAACTTGG + Exonic
924012738 1:239684106-239684128 GTTTTATTCTGGTAAAAAATTGG - Intronic
924606700 1:245541663-245541685 TTTTTATTTTTATCAAAAGTAGG + Intronic
1063356442 10:5403309-5403331 GCTGTAATCTGATCAAAACTTGG + Intronic
1064466568 10:15588419-15588441 ATTTTATTAAGATCACATCTGGG + Intronic
1064893258 10:20204340-20204362 GTTTTATTATGACATAAAATAGG - Intronic
1065974903 10:30833686-30833708 TTTTTATTAGGCTCCAAACTTGG - Intronic
1066251669 10:33638825-33638847 GTTTTATTTTCAGCAACACTGGG + Intergenic
1066989717 10:42501351-42501373 CTCTTAATAAGATCAAAACTTGG + Intergenic
1068227001 10:54118347-54118369 TTTTTTATATGATGAAAACTAGG - Intronic
1069127259 10:64651744-64651766 GTTTTTATAAGATCAAAATTGGG - Intergenic
1069234645 10:66055621-66055643 GTTTTTTTAAGATAAAAAATCGG + Intronic
1070507879 10:77131498-77131520 GTTATATGAAGTTCAAAACTGGG + Intronic
1071460577 10:85890350-85890372 GTTGTATAATGATCAAATCAGGG - Intronic
1071755926 10:88539166-88539188 GTTTTATTATCTGCATAACTAGG + Intronic
1071892261 10:90023300-90023322 TTTTTTTTATTATCAAACCTGGG - Intergenic
1071949407 10:90685607-90685629 CTTTAATTATGAATAAAACTGGG + Intergenic
1074216104 10:111385482-111385504 GTTTTAATATTAGCAAAACATGG + Intergenic
1074284978 10:112089526-112089548 GCTTTATTCTGATGGAAACTGGG - Intergenic
1074807776 10:117070948-117070970 GTTTTATAAGGATCCAAAATAGG + Intronic
1076416808 10:130296929-130296951 CTCTTAATAGGATCAAAACTTGG + Intergenic
1077823864 11:5782666-5782688 TTTTTATGATGATGATAACTTGG + Intronic
1079374652 11:19881189-19881211 GTTTTAACATCATCACAACTGGG - Intronic
1079876038 11:25858524-25858546 TTGTTCTTATGATCAAAACAAGG - Intergenic
1080035948 11:27711343-27711365 ATTTTATGATTATGAAAACTGGG + Intronic
1082716040 11:56615167-56615189 TTTTTAGTATGATGAAAACAAGG + Intergenic
1083036917 11:59646895-59646917 TTTTTATCATGATCTAGACTAGG - Intronic
1083950830 11:65955045-65955067 GTTTTTTTACCATCAAAACGAGG + Intronic
1084135974 11:67182354-67182376 ATTTTATTATATTCAAAATTTGG + Intronic
1085657248 11:78327709-78327731 GTATTATTATTTTCAAAATTTGG - Intronic
1086183055 11:83978933-83978955 GTTTAATAATGGACAAAACTGGG - Intronic
1086599558 11:88616185-88616207 ATATTATTATTAACAAAACTTGG - Intronic
1087360222 11:97149082-97149104 TTTTTATTATGATAAAAAACAGG - Intergenic
1087500531 11:98946391-98946413 GCTTTATTATGATGAATATTTGG + Intergenic
1088158187 11:106834985-106835007 ATTTTATTCTGAGGAAAACTAGG - Intronic
1088263517 11:107968012-107968034 GTTTTATTATCATCATCTCTTGG + Intergenic
1088526650 11:110763066-110763088 TTCTTATTGTGATCAAAACCTGG - Intergenic
1088839779 11:113615482-113615504 CTTTTGTTATGAGAAAAACTTGG - Intergenic
1090870520 11:130742268-130742290 TTTGTATGATGTTCAAAACTAGG - Intergenic
1091338032 11:134787397-134787419 GATTTATAATGATCACAATTTGG - Intergenic
1091966503 12:4746738-4746760 GTTATATAATGATAAAAACCTGG - Intronic
1092279221 12:7087062-7087084 GTTTTACTAAGACCAAAATTCGG + Intronic
1093722796 12:22463922-22463944 GTTTTATTATGATCAAAACTGGG + Intronic
1094723999 12:33093591-33093613 GTTGTATAATGATCAAATCAGGG + Intergenic
1095361327 12:41343792-41343814 GTTGTATAATGATCAAATCAGGG - Intronic
1096307702 12:50492696-50492718 GCTTTAATAAGATCAAAATTTGG - Intergenic
1097314564 12:58158322-58158344 GGTTAATTATGGGCAAAACTGGG - Intergenic
1097557023 12:61150964-61150986 GTTTTGTTGTGATGATAACTGGG - Intergenic
1097925246 12:65120556-65120578 GTTTTATTATTTTAAAAACCAGG - Exonic
1099210061 12:79773534-79773556 GTTTTTTTATGATAATAAGTGGG - Intergenic
1099537952 12:83868228-83868250 TTTTTATTCTGATTAAAACCTGG + Intergenic
1100038634 12:90283260-90283282 ATTTTATTATGACAAAAACTAGG + Intergenic
1100509289 12:95253637-95253659 GTTTTGTTTTGATACAAACTTGG + Intronic
1101170551 12:102088558-102088580 TTTTTATGATGTTCAAAAATAGG - Intronic
1101703107 12:107193823-107193845 GGTTTGTTCTTATCAAAACTAGG + Intergenic
1105681634 13:22734204-22734226 GTTGTATAATGATTAAATCTGGG - Intergenic
1106927358 13:34627253-34627275 TTTATATAATGATCAAAACCAGG - Intergenic
1108393614 13:49972023-49972045 CATTTATTATTATTAAAACTTGG + Intergenic
1109497560 13:63193313-63193335 GTTTTCTTTTTATGAAAACTAGG - Intergenic
1109575469 13:64250683-64250705 TTTTGATAATGATCAAATCTGGG + Intergenic
1111647106 13:91045320-91045342 GCTTTATTAAGATGAAAACAAGG + Intergenic
1111920545 13:94405838-94405860 GTAGTATGATGATAAAAACTAGG - Exonic
1114250693 14:20957832-20957854 AGTTTATTATTATCAAAAATTGG - Intergenic
1114475613 14:22992521-22992543 GTGCTATTATGGGCAAAACTGGG - Intronic
1116565176 14:46436454-46436476 GTTTAATAAAAATCAAAACTTGG + Intergenic
1117127779 14:52649547-52649569 GTTTTAATTTGATCAAAACTCGG - Intronic
1117894467 14:60467140-60467162 GTTTTATTATCTGCAAAACGAGG - Intronic
1117967036 14:61216839-61216861 GTTTCTTTATGAGAAAAACTTGG + Intronic
1118131784 14:62973705-62973727 GATTTAATAAGATTAAAACTAGG + Intronic
1118956408 14:70486615-70486637 GTTGTATAATGATCCAATCTGGG - Intergenic
1119358279 14:74025530-74025552 ATTTTATTATGAACAAAATTAGG + Intronic
1120030450 14:79635130-79635152 ATTGTATAATGATCAAATCTGGG - Intronic
1120237575 14:81910234-81910256 TTTTTGTTATGCTCCAAACTTGG + Intergenic
1120260078 14:82172776-82172798 GTTATATTATGATCAAATCAAGG + Intergenic
1120712074 14:87803430-87803452 TTTTTATTATGAACAAAAGATGG - Intergenic
1121697582 14:95926361-95926383 GTTGTATTGTGATCAATACAGGG - Intergenic
1121832817 14:97066521-97066543 GTTTTCTTAAAATTAAAACTGGG - Intergenic
1122887185 14:104715292-104715314 GTTTTATTATCATCAGAATCAGG - Exonic
1124467778 15:29954204-29954226 TATTTATTATGATAAAAACATGG + Intronic
1125098066 15:35877442-35877464 GATTTATTATGTTTATAACTTGG - Intergenic
1126201876 15:45995660-45995682 GTTGTATTATGAACTGAACTTGG + Intergenic
1127513565 15:59669136-59669158 ATTGTATAATGATCAAACCTGGG - Intronic
1128598024 15:68971025-68971047 GTTGTATTATTTTTAAAACTAGG - Intronic
1129817097 15:78565054-78565076 GTTTCTTTCTGATCACAACTCGG + Intergenic
1130723374 15:86412096-86412118 GTTTCATCATCATCAAAGCTTGG + Intronic
1131703342 15:94964870-94964892 GTTTCGTAATGATCAAAACAAGG - Intergenic
1133075124 16:3274199-3274221 CCTTTATTATGCTCACAACTTGG + Intronic
1137883173 16:52074042-52074064 GTTTTATTAAGTTCAAACATAGG - Intronic
1138987766 16:62351442-62351464 GTTTGTTTATGACTAAAACTAGG - Intergenic
1141005560 16:80348430-80348452 GTTTTTTCATCACCAAAACTGGG + Intergenic
1147468120 17:40628116-40628138 TTTTTGTTATGATTAATACTGGG - Exonic
1149286431 17:55170178-55170200 TTTTTATTTTGGTCTAAACTTGG - Intergenic
1149338600 17:55663397-55663419 GTATTATTATTATCAATACCCGG - Intergenic
1150985188 17:70188188-70188210 GTTGTATAATGATCGAAACAGGG + Intergenic
1151434737 17:74088033-74088055 GGTTTATTATTATCATAACTTGG - Intergenic
1154072803 18:11168479-11168501 GTTGTATGATGACCAAATCTGGG + Intergenic
1157507358 18:48238018-48238040 TTTTTATTAGGTTCAAAACTAGG + Intronic
1157853729 18:51084262-51084284 GTGATATTATGCTCAAAACAAGG + Exonic
1159138498 18:64364872-64364894 GTTGTATAATGATCAAATCAGGG - Intergenic
1159304842 18:66627262-66627284 TTTGTATTATGCTCAATACTAGG + Intergenic
1159733369 18:72061037-72061059 GTTTTCTTAGGATCAAAATTTGG - Intergenic
1159973674 18:74684056-74684078 ATATTAGTATGTTCAAAACTTGG + Intronic
1160626899 18:80216199-80216221 TTTTTATAATGAATAAAACTAGG + Intronic
1160746156 19:711680-711702 ATTATATTGTGATCAACACTGGG - Intronic
1162794993 19:13082372-13082394 TTTTTTTTATTATCAAGACTGGG - Intronic
928586676 2:32766234-32766256 GTTGTATTATGATCAAATCAGGG + Intronic
928719807 2:34106901-34106923 GATTTATAATTGTCAAAACTTGG - Intergenic
928972673 2:37047583-37047605 TTTTTATTTTTATCCAAACTGGG + Intronic
929049339 2:37822125-37822147 TTTTTATAATGATAAGAACTTGG - Intergenic
929618497 2:43331089-43331111 GTTTCAATATGGTCTAAACTGGG - Intronic
930610490 2:53537676-53537698 GTTTTATTAAGGCCAAAACGTGG - Intronic
931075975 2:58712172-58712194 GTTTCATTGAGATAAAAACTAGG - Intergenic
931182570 2:59917398-59917420 GTTATATTATAATCAATAATTGG - Intergenic
931630331 2:64292748-64292770 GTAGTCTCATGATCAAAACTGGG + Intergenic
931895541 2:66725345-66725367 GTTTTATTATGTTGATTACTAGG - Intergenic
933147853 2:78877439-78877461 GTTTTATTATTATCAAGGCTGGG + Intergenic
933483097 2:82882028-82882050 TTATTATTATGATAAAAAATTGG + Intergenic
935378863 2:102429276-102429298 GTTTCTTTATGATCCAATCTTGG + Intronic
935712186 2:105909151-105909173 GATTTACCATGATTAAAACTTGG - Intergenic
935787504 2:106562075-106562097 ACTTTATTATTATCATAACTTGG + Intergenic
936402735 2:112177512-112177534 GTTTTATCATCATAAAAAATAGG - Intronic
936542894 2:113366359-113366381 GTTTGATCCTGATCTAAACTGGG - Intergenic
937959030 2:127440495-127440517 GTTTAATTAACAACAAAACTGGG + Intronic
938713077 2:133992220-133992242 GTTTCATTATGAGCCAGACTTGG - Intergenic
939010692 2:136842648-136842670 GTTTTATTATTTTCAAAAAAAGG - Intronic
939389302 2:141545718-141545740 GTCTCTTTATGATCACAACTGGG - Intronic
939623077 2:144444798-144444820 TCTTTATTATGATGAAATCTGGG - Intronic
940115079 2:150199252-150199274 TGATTACTATGATCAAAACTTGG + Intergenic
940421219 2:153480987-153481009 GTGTTAAAATGATCAAACCTTGG + Intergenic
940492330 2:154378743-154378765 GTTGTATAATGATCAAATCAGGG - Intronic
940754142 2:157662262-157662284 GTTTTAATTTGATCATGACTGGG - Intergenic
940754255 2:157663634-157663656 GTTTTAATATGATCATGACTGGG + Intergenic
940930143 2:159418714-159418736 GTTTTAGTATCACCAAGACTGGG + Intronic
940970382 2:159890515-159890537 ATTTTATTGTGATCAAAATATGG - Intronic
941058669 2:160819159-160819181 GATTTATAATGACCAAAACCTGG - Intergenic
941334400 2:164223977-164223999 TGTTTATTATGAGCAAAATTGGG + Intergenic
941789906 2:169540571-169540593 GTATTATTATCATCAACACTGGG - Intronic
941840638 2:170079416-170079438 GTTTGAGAATGATCAAAACTTGG + Intronic
942019647 2:171853859-171853881 ATTTTATAATAATCGAAACTGGG + Intronic
942664237 2:178300130-178300152 GGTTTGTCATAATCAAAACTTGG - Intronic
942709463 2:178816754-178816776 ATTTTATTATGGTAAAAAATGGG - Intronic
942848550 2:180455249-180455271 GTTTTAATATTATCATAACTAGG + Intergenic
943662343 2:190572390-190572412 GTTTTTTTCTGGGCAAAACTGGG + Intergenic
943677088 2:190726353-190726375 GTTATGCTATGAGCAAAACTAGG + Intergenic
943820860 2:192319073-192319095 GTTGTATTTTGGTCAAAACAAGG + Intergenic
944590332 2:201211020-201211042 GTTGTATAATGATCAAATCAGGG + Intronic
945103207 2:206282770-206282792 GTTTTATTATGTTCACAAAGTGG + Intronic
945415912 2:209572613-209572635 GTTTTGTTATGATTAAAAAATGG - Intronic
946033994 2:216727314-216727336 TTTTTATTATGATCAGATATTGG + Intergenic
946206852 2:218115732-218115754 GATTTATTATGGTAAATACTGGG - Intergenic
946450624 2:219775926-219775948 ATATGATGATGATCAAAACTAGG - Intergenic
947040050 2:225907898-225907920 GATATATAATGATCAAATCTGGG + Intergenic
948249648 2:236515709-236515731 GTTTATTGATGCTCAAAACTAGG + Intergenic
1169161790 20:3385773-3385795 GTTTTATTAGGTTTATAACTAGG - Intronic
1169397271 20:5243225-5243247 GTTTCATTATGAACCAGACTTGG - Intergenic
1169768907 20:9180186-9180208 TTTTTATTATGATGAATATTGGG - Intronic
1172072912 20:32271879-32271901 GTTTTATTATGATCTCATCCAGG - Intergenic
1172531375 20:35633321-35633343 GTTATGTTAGGATCAGAACTTGG - Intronic
1172984825 20:38976529-38976551 GTTGTATAATGATCAAATCTGGG + Intronic
1173094606 20:40013086-40013108 ATTTTCTTATTATCACAACTGGG + Intergenic
1173182789 20:40817218-40817240 CATTTTTTATTATCAAAACTGGG + Intergenic
1174991241 20:55512739-55512761 CTTTTATTCTGAGCAAAAATAGG + Intergenic
1175338961 20:58215490-58215512 TTTTTTTGGTGATCAAAACTTGG + Intergenic
1177437540 21:21075689-21075711 GTTTTATTTTTATCATAAATGGG + Intronic
1178600345 21:33988982-33989004 GTTTTCTTGTCAGCAAAACTGGG + Intergenic
1180222703 21:46369502-46369524 GTTTGCCTATGATCAAAACTGGG - Intronic
1180572237 22:16737254-16737276 TTCTTATTATGATTAAAAATGGG - Intergenic
1180744896 22:18080711-18080733 GTTGTATAATGATCAAATCAGGG + Intronic
949310536 3:2692509-2692531 TTTTTAGTATGATAAAAATTAGG + Intronic
952991852 3:38837264-38837286 GTTTTATTAATATCAAAATCGGG + Intergenic
955182470 3:56684629-56684651 GCTTTATTATGATGATAATTTGG - Intergenic
955864327 3:63366791-63366813 GTGTTTTTATTTTCAAAACTAGG - Intronic
956829782 3:73034832-73034854 TTTTTTTTAAGAACAAAACTAGG - Intronic
959475357 3:106804655-106804677 TTTATTTTATGATCAAAAGTTGG - Intergenic
959643628 3:108671316-108671338 GTTTTATTATCAGAAACACTTGG - Intronic
960081988 3:113551864-113551886 GTTTTATTTTCATCAATGCTGGG + Intronic
960158889 3:114327658-114327680 GTTTGATTAAGATAAAAGCTGGG + Intergenic
961323568 3:126096006-126096028 CTTTTAATAAGATCAAAATTTGG + Intronic
961586275 3:127928811-127928833 GTTTTATCATGAAGAAAACTTGG - Intronic
961697802 3:128718049-128718071 GTTTATTTATCATCGAAACTGGG - Intergenic
963536350 3:146533830-146533852 GTTTTATTATCAACAAAACATGG - Intronic
965383913 3:168023178-168023200 GTTTTATTATGTCCAATACTAGG - Intronic
965558570 3:170040640-170040662 GTTTTTTGATGAACACAACTTGG - Intronic
965774285 3:172212130-172212152 GCTTTATTATGACTAAAGCTGGG + Intronic
966198530 3:177337743-177337765 GTTTTATTATTATGTAAACATGG - Intergenic
967992421 3:195141391-195141413 GTTTTTCTATGATAAGAACTTGG + Intronic
968051332 3:195657161-195657183 GTGTTATTAAGAGCAAAAATGGG + Intergenic
968104494 3:195991178-195991200 GTGTTATTAAGAGCAAAAATAGG - Intergenic
968302784 3:197628762-197628784 GTGTTATTAAGAGCAAAAATGGG - Intergenic
969549139 4:7852763-7852785 GTTATATTCTTATCAAAACAAGG - Intronic
970434156 4:16017039-16017061 ATTATATAATGATCAAAATTAGG - Intronic
970885433 4:20983347-20983369 GGTTTATTATGATATAAAATGGG - Intronic
970971152 4:21985717-21985739 ATATTTTTATGATCCAAACTAGG + Intergenic
972001155 4:34035465-34035487 GTGTTATAATAATCAATACTAGG + Intergenic
972045434 4:34659765-34659787 ATCTTAATATGATAAAAACTAGG - Intergenic
972194848 4:36641209-36641231 GTTTTTTTATAATCTAATCTTGG - Intergenic
972236360 4:37138285-37138307 GTCCTTTTATCATCAAAACTGGG - Intergenic
972273992 4:37539872-37539894 GTTGTAAAATGATCAAAACAGGG + Intronic
972659656 4:41103603-41103625 TTTTTCTTATAAACAAAACTGGG - Intronic
974276904 4:59732939-59732961 ATTGTATAATGATCAAAACGAGG + Intergenic
975184798 4:71388858-71388880 TTTTTATTGTGATCTAAAATAGG - Intronic
975353253 4:73369407-73369429 GTCTTAATAAGATCAAAATTTGG + Intergenic
975809153 4:78147664-78147686 GTTTTCTTATGTTTAAAACTAGG + Intronic
976749492 4:88439718-88439740 GTTGTATTGTGACCAAAACCTGG - Intronic
977419221 4:96776169-96776191 CTTTTATTATGAGAAAAGCTTGG + Intergenic
979319322 4:119303899-119303921 GTTGTACTATCATCATAACTAGG + Intronic
979409703 4:120361754-120361776 GTTTAATTATGATGACAACTAGG - Intergenic
979578561 4:122326560-122326582 CTTTTTTTATGAAGAAAACTTGG + Intronic
979709137 4:123757044-123757066 GTTTCTTTATGAATAAAACTTGG + Intergenic
979905757 4:126289290-126289312 TTTTTATATTGATCCAAACTAGG + Intergenic
980737528 4:136910795-136910817 ATTGTATAATGATCAAATCTGGG + Intergenic
980981949 4:139662100-139662122 GTTTTTATGTGATCAAATCTTGG + Intergenic
981875880 4:149545159-149545181 ATTTTTTTATGATAGAAACTGGG - Intergenic
986251192 5:6059915-6059937 GCTTGTTTATGATCAAAACACGG - Intergenic
986934313 5:12864330-12864352 ATTTTAGTAATATCAAAACTAGG - Intergenic
987437612 5:17915515-17915537 GTTCCATTGTGTTCAAAACTAGG - Intergenic
987447558 5:18039304-18039326 GTTTTATTAAAATCAAATCCTGG + Intergenic
988015284 5:25549078-25549100 TTTTCATTATGATTAACACTTGG + Intergenic
988230218 5:28466952-28466974 GTTGTATAATGATCAAATCAGGG - Intergenic
988373036 5:30396801-30396823 TATTTATAATGACCAAAACTTGG - Intergenic
989618762 5:43364408-43364430 GTTGTATAATGATCAAATCAGGG - Intergenic
989700869 5:44263116-44263138 GTTTTGTAATGATAAAAAGTGGG + Intergenic
991106389 5:62847821-62847843 TTTTCTTTATGATAAAAACTCGG - Intergenic
992959863 5:81947553-81947575 GTTTCATTATGACCTAGACTTGG + Intergenic
993975010 5:94468698-94468720 CATTTATTATGATAATAACTCGG + Intronic
994429270 5:99635528-99635550 TTTTTATTATTACCAAAACTGGG - Intergenic
995292546 5:110474193-110474215 GTTATATAATGATCAAATCAGGG - Intronic
995302977 5:110606807-110606829 TTTTTAATATTATAAAAACTGGG + Intronic
995962511 5:117859933-117859955 GTCATATTATAAGCAAAACTCGG - Intergenic
997145348 5:131427413-131427435 GTATTATTATAATAAAATCTGGG - Intronic
998720369 5:144939628-144939650 GTTTTATTATGATGAGAGATAGG - Intergenic
1000283524 5:159804447-159804469 ATTTTAAAATAATCAAAACTGGG - Intergenic
1001971932 5:175963377-175963399 TTTTTTTAATGAGCAAAACTAGG + Intronic
1002245510 5:177880400-177880422 TTTTTTTAATGAGCAAAACTAGG - Intergenic
1002408800 5:179057567-179057589 GTTTTATTATTATTAAACCATGG + Intergenic
1003529077 6:6922665-6922687 GTTTTATCATGATCACAAACAGG + Intergenic
1003751280 6:9059922-9059944 GTGTTATGATGATAGAAACTAGG + Intergenic
1004102175 6:12624902-12624924 GTTGTATAATGATCAAATCAGGG - Intergenic
1004337825 6:14780716-14780738 CTTTGATTATGAGCAAAACCAGG - Intergenic
1005371915 6:25142307-25142329 GCTTAATTATGATCTAAACTAGG + Intergenic
1006067528 6:31472799-31472821 GTTTTCAGATGATCAAAACTGGG + Intergenic
1008245484 6:49166413-49166435 GTTTTATAATGATCAAATCAAGG + Intergenic
1008245489 6:49166539-49166561 GTTTTATAATGATCAAATCAAGG + Intergenic
1009055767 6:58333028-58333050 GTTTAATTATTATAAAAAATAGG - Intergenic
1009235404 6:61117572-61117594 GTTTAATTATTATAAAAAATAGG + Intergenic
1009395839 6:63199612-63199634 GATTTATTATGAAAAAAACTGGG - Intergenic
1009693897 6:67071035-67071057 TTTTTATTATTATCAAATGTGGG + Intergenic
1010008334 6:71021404-71021426 GTTTTATAATGATCCAACCAGGG - Intergenic
1010073239 6:71769072-71769094 TGTTTATAAGGATCAAAACTAGG - Intergenic
1010509205 6:76697110-76697132 ATTTAATTTTTATCAAAACTTGG - Intergenic
1011402931 6:86983723-86983745 GATGTATAATGATCAAATCTGGG - Intronic
1012664398 6:101949280-101949302 TTTCTATTATAATCAAATCTAGG - Intronic
1013434494 6:110088674-110088696 TTTTTATAAGCATCAAAACTGGG + Intergenic
1014617350 6:123619515-123619537 GTATTTTTATGATCTAACCTTGG + Intronic
1014683906 6:124470499-124470521 GTTTTATTATGATTATAATTAGG + Intronic
1015952521 6:138567617-138567639 ATTTTATTAGGAGAAAAACTGGG + Intronic
1016652093 6:146473884-146473906 GTTTTGTTTTAAGCAAAACTAGG + Intergenic
1019802996 7:3102313-3102335 GTTTTATTATGATTTTAATTTGG + Intergenic
1020287178 7:6692970-6692992 TTTATATTTTGTTCAAAACTGGG + Intronic
1020887907 7:13842407-13842429 GTTTTATCATGATAAGAAATAGG - Intergenic
1022306931 7:29155222-29155244 GTATTATTATTATCTAAACTTGG + Intronic
1024108533 7:46119614-46119636 GTTTTATCATGAACAGGACTTGG + Intergenic
1025615940 7:63116688-63116710 TTTTTATTATGATAAAAGGTTGG - Intergenic
1026404437 7:70050560-70050582 GTTTTATTAGGATAAAGTCTTGG + Intronic
1027664563 7:81028841-81028863 GTTTTCTGATGAATAAAACTTGG + Intergenic
1030171960 7:106611964-106611986 GCTATATAATGAGCAAAACTTGG - Intergenic
1030595063 7:111528000-111528022 GTTTTATTATTATGAAATATAGG - Intronic
1031426382 7:121610487-121610509 TTTCTATTCTGATCAAACCTGGG - Intergenic
1034281018 7:149854476-149854498 GAGTTATAATGATCAAAACCAGG - Intronic
1036987050 8:13545203-13545225 TTTTTAATATGAACAAAACATGG + Intergenic
1038061140 8:23914454-23914476 GTATTAATATGAACAAAACATGG + Intergenic
1038184273 8:25258807-25258829 TTTTTTTAATGATCAAAACAGGG - Intronic
1038185752 8:25273287-25273309 TTTTTTTAATGATCAAAACAGGG - Intronic
1039285426 8:36034727-36034749 GTTTTATAATCTTTAAAACTAGG - Intergenic
1039733625 8:40306384-40306406 GTTTGTTTCTGATCAGAACTGGG + Intergenic
1040740388 8:50567782-50567804 ATTGTATAATGATCAAATCTAGG + Intronic
1041709511 8:60880598-60880620 GTTTTCTTATTATCAAATTTTGG + Intergenic
1042496461 8:69459584-69459606 TTTTTATTATGGTAAAAATTTGG + Intergenic
1043096627 8:75983588-75983610 GTTTTCTTATGATTTAATCTTGG - Intergenic
1043498503 8:80829406-80829428 AATTTATAATCATCAAAACTAGG - Intronic
1043587852 8:81790378-81790400 GTTATATAATAATCAAAACAGGG + Intergenic
1045537078 8:103040539-103040561 GTTTTATAATGAAAAAAAGTAGG + Intronic
1046406360 8:113777950-113777972 TTTTCATTATGTTAAAAACTTGG + Intergenic
1046591190 8:116209222-116209244 GTTTTATTATTATTGAAACCTGG - Intergenic
1046607838 8:116390570-116390592 TTTTTATTATTATAGAAACTAGG - Intergenic
1047987184 8:130247255-130247277 ATTTTATCATCATCAATACTGGG - Intronic
1048621346 8:136136115-136136137 GATATATTCTGATAAAAACTTGG - Intergenic
1050715281 9:8517545-8517567 GTTTTTCTATTCTCAAAACTGGG + Intronic
1051311300 9:15776168-15776190 GTATTATTATTATAAAAACATGG + Intronic
1051670908 9:19509592-19509614 GTTTTATTCTGATAAGAATTGGG + Exonic
1051908979 9:22131130-22131152 TTTTTATTATGATGAAAGCAAGG - Intergenic
1052811238 9:33062433-33062455 CTTTTGTTATAAACAAAACTTGG + Intronic
1054926556 9:70595096-70595118 GTTTCATTCTAGTCAAAACTGGG + Intronic
1055729726 9:79267965-79267987 GTTTTCTTAAGATGAAAACCTGG - Intergenic
1056285708 9:85085666-85085688 GTTTTACTATGATTAAAAGATGG - Intergenic
1058094722 9:100846693-100846715 TTTTAGTTATGATGAAAACTGGG - Intergenic
1058559905 9:106216118-106216140 CTTTTTTTGTGATGAAAACTAGG + Intergenic
1058845235 9:108950965-108950987 TTTTCATTTTGTTCAAAACTTGG + Intronic
1059970275 9:119660263-119660285 GTTGTATCATGATCAAATCAGGG - Intergenic
1061890679 9:133617558-133617580 GTTTTGTTTTGATGAAAAGTTGG + Intergenic
1186693687 X:12006501-12006523 GTTTAATTAAGAGCAAAAATTGG - Intergenic
1186899362 X:14037270-14037292 TTATTAGTATGAACAAAACTAGG - Intergenic
1187799712 X:23047771-23047793 GTTTTATTTTGATGGAAAATTGG - Intergenic
1188255179 X:27953727-27953749 GATATATTATGAGCAAAATTTGG - Intergenic
1188331015 X:28871867-28871889 ACTTCATTGTGATCAAAACTTGG + Intronic
1188891633 X:35618489-35618511 GTTGTATAATGATCAAAATCAGG - Intergenic
1189066407 X:37814092-37814114 GTTTTCTTATCAACAAAATTAGG - Intronic
1189117700 X:38359814-38359836 CTTTTCTTATCATCAGAACTTGG + Intronic
1194488339 X:94514726-94514748 GTTTTATTTTGTTGAAAATTGGG + Intergenic
1196042717 X:111222899-111222921 GATATATTATTATCAAATCTTGG - Intronic
1196306913 X:114113783-114113805 GTTTTATAATGATCAATTCAGGG + Intergenic
1197826989 X:130600585-130600607 GTTTTATGATGATCAAATCAGGG + Intergenic
1198880869 X:141279775-141279797 GTTTCCTTATGAGTAAAACTGGG - Intergenic
1199474856 X:148233656-148233678 GTTTTCTTATCAACAAAACAAGG + Intergenic
1199813638 X:151376390-151376412 ATAATATAATGATCAAAACTGGG - Intergenic
1200622363 Y:5467255-5467277 GCTTGGTCATGATCAAAACTGGG - Intronic
1200947528 Y:8860940-8860962 GTTTCATATTGTTCAAAACTAGG + Intergenic
1201695470 Y:16819262-16819284 GTTTAAATATGAGGAAAACTAGG + Intergenic
1201700705 Y:16878469-16878491 CTCTTAATAAGATCAAAACTTGG + Intergenic