ID: 1093724912

View in Genome Browser
Species Human (GRCh38)
Location 12:22493556-22493578
Sequence TTACTTTAACAGATATCTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 354}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093724909_1093724912 28 Left 1093724909 12:22493505-22493527 CCTTTTAAACTCAATTGCTGGAA 0: 1
1: 0
2: 1
3: 14
4: 200
Right 1093724912 12:22493556-22493578 TTACTTTAACAGATATCTATAGG 0: 1
1: 0
2: 4
3: 30
4: 354
1093724910_1093724912 -1 Left 1093724910 12:22493534-22493556 CCACCTATCTGTATTTGCTTTAT 0: 1
1: 0
2: 1
3: 26
4: 372
Right 1093724912 12:22493556-22493578 TTACTTTAACAGATATCTATAGG 0: 1
1: 0
2: 4
3: 30
4: 354
1093724911_1093724912 -4 Left 1093724911 12:22493537-22493559 CCTATCTGTATTTGCTTTATTAC 0: 1
1: 0
2: 1
3: 59
4: 625
Right 1093724912 12:22493556-22493578 TTACTTTAACAGATATCTATAGG 0: 1
1: 0
2: 4
3: 30
4: 354

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093724912 Original CRISPR TTACTTTAACAGATATCTAT AGG Intronic
901351974 1:8605440-8605462 TTACTTTAAGAGGTAACTAAAGG + Intronic
902140158 1:14346824-14346846 TTAAATTAACAAATATTTATTGG + Intergenic
906868382 1:49448207-49448229 TTGCTTTAACAATTATGTATTGG + Intronic
907928516 1:58977348-58977370 TTAATTTAACAAATAATTATTGG - Intergenic
907938980 1:59068778-59068800 TTACTTAAACTGATATCAAGAGG + Intergenic
908046642 1:60177456-60177478 TCACTTAAGGAGATATCTATGGG - Intergenic
909312483 1:74170463-74170485 TTAGTTGAACATATATCCATGGG + Intronic
909356389 1:74714819-74714841 TTCCTTGAACAAATATTTATTGG + Intronic
909391043 1:75122616-75122638 TTACTTAAAAAGAAATTTATAGG + Intergenic
909405936 1:75289607-75289629 TTTCTTTAACACATGCCTATTGG - Intronic
909579718 1:77220776-77220798 TTAATTCAACAGATATCTATTGG + Intergenic
909665515 1:78127867-78127889 TTACTTTAACAAATTTTTTTTGG + Intronic
910033559 1:82762226-82762248 TCATTTTCACAGATATCCATAGG + Intergenic
911526055 1:98987328-98987350 TTTCTTTAAGTGATATTTATGGG + Intronic
911778759 1:101848165-101848187 TTACTTTAAAACACATATATTGG - Intronic
912247671 1:107977839-107977861 TTGCATTAACATATATTTATTGG + Intergenic
912347875 1:108981703-108981725 TTTCTTTAAATGATATATATGGG - Intronic
912901163 1:113651002-113651024 TTATCTTATCAGATATATATTGG + Exonic
913473052 1:119209379-119209401 CTAATTTATCAGATAACTATTGG - Intergenic
916282918 1:163072330-163072352 TTTCTTTAAAAGATACCTAATGG - Intronic
916327543 1:163579952-163579974 TGACTTTAAAATATATTTATGGG - Intergenic
916449387 1:164905643-164905665 TTTCTTTAATAGATATATAGAGG - Intergenic
916626669 1:166565499-166565521 TTAATTTAATAAATATTTATTGG - Intergenic
916673781 1:167048577-167048599 TTAATTTACCAGAGATCAATAGG + Intergenic
917379516 1:174389495-174389517 CTACTTTTAAAGATGTCTATTGG - Intronic
919119059 1:193316185-193316207 TTTATTCAACAAATATCTATTGG - Intergenic
920418740 1:205815637-205815659 ATACTTGAACAGATATCCAAGGG - Intergenic
920938800 1:210461047-210461069 ATACTTTAACAAATATTTCTGGG - Intronic
924790102 1:247238252-247238274 TTTGTTTGACAGATATCTATAGG - Intergenic
924866153 1:247983591-247983613 TTACTTAGACAGATATATAATGG + Intronic
924869955 1:248031184-248031206 TTACTGAAACAGATATATAATGG + Intronic
1064225771 10:13483454-13483476 TTATTCTAACAAATATCTATTGG - Intronic
1066669827 10:37825037-37825059 ATACTTTAACATTTGTCTATGGG - Intronic
1067283045 10:44887441-44887463 TTCCTTTAACAAATATTTTTAGG + Intergenic
1068081294 10:52321237-52321259 TTACTTTAATTGAAATCTAATGG - Intergenic
1068281838 10:54882300-54882322 TTACTTTAAAAGGTAACAATGGG - Intronic
1068808731 10:61230361-61230383 TGAATTTAACAGATATATACTGG + Intergenic
1069245482 10:66199950-66199972 TTAGTTAAAAAGATAACTATTGG - Intronic
1069368832 10:67722425-67722447 GAATTTTAACAGATATCTAAAGG + Intergenic
1069392093 10:67947121-67947143 TGGATTTAACAGATATTTATAGG + Intronic
1072365718 10:94706855-94706877 TTACATTAAAAGTTATGTATTGG + Exonic
1073421645 10:103428642-103428664 TTAATTTAACAGATATATGGGGG + Intronic
1073715090 10:106096283-106096305 TGACTTTAACATATTTCTCTTGG - Intergenic
1074549429 10:114428849-114428871 TTAGTTATACAGATAGCTATTGG + Intergenic
1075380066 10:122011801-122011823 TTAATTGAACAAATATTTATTGG + Intronic
1075482855 10:122797343-122797365 TGAATTTAAAACATATCTATTGG + Intergenic
1079498973 11:21080566-21080588 TTATTTAAACAGATCACTATTGG + Intronic
1079541815 11:21585379-21585401 TCACTTTTACATATATCTGTTGG - Intergenic
1079570823 11:21941814-21941836 TTATTGTAACATATATCCATAGG - Intergenic
1079828619 11:25232132-25232154 TAACTTTTGCAGATATTTATGGG + Intergenic
1080036341 11:27715855-27715877 GTACTTTGACAGCTCTCTATAGG - Intronic
1080074002 11:28126478-28126500 TTATTTCAACAAATATTTATGGG - Intronic
1080173089 11:29329595-29329617 TTATTTTGACTGATATTTATGGG + Intergenic
1080286580 11:30621043-30621065 TTAATTAAACTGAGATCTATAGG - Intergenic
1081335002 11:41854425-41854447 ATACTTTAACATTTATTTATAGG + Intergenic
1081589811 11:44414048-44414070 TTATTTTCACAGATAGTTATAGG + Intergenic
1082234189 11:49802992-49803014 TTGCTTTAATAGATAGCTTTTGG + Intergenic
1082681272 11:56173717-56173739 TTTCTTTAACAAATATTTCTGGG - Intergenic
1085983799 11:81759240-81759262 TTTCTTTTACAGATATCTATAGG - Intergenic
1086111686 11:83206197-83206219 TTACTTTAACATAGTTCTGTTGG + Intronic
1086516056 11:87614647-87614669 TGACTTAAAGAAATATCTATTGG + Intergenic
1086608303 11:88724148-88724170 TTAGTTTAACTCATCTCTATTGG + Intronic
1087216275 11:95498609-95498631 TTATTTTAACAAATATTTATTGG + Intergenic
1087519348 11:99210934-99210956 TTAATTTGACAAATATTTATTGG - Intronic
1087734188 11:101813347-101813369 TAACCATAACAGATATCTTTTGG - Intronic
1088426763 11:109713348-109713370 TTTCCTTAACAGATGTGTATTGG - Intergenic
1090642640 11:128742335-128742357 TTAATTTAGCAAATATTTATTGG - Intronic
1093080182 12:14802126-14802148 TTACCTTAAGAAATATATATTGG - Intronic
1093091845 12:14930321-14930343 TTCCTTTTACAGTTATTTATTGG - Intronic
1093445003 12:19246713-19246735 TTTTTTTATCTGATATCTATAGG - Intronic
1093724912 12:22493556-22493578 TTACTTTAACAGATATCTATAGG + Intronic
1094269342 12:28594848-28594870 TTCCTTTAACATATATTCATGGG + Intergenic
1097312400 12:58134438-58134460 TTCATTTAACAAATAGCTATTGG - Intergenic
1098756716 12:74373009-74373031 CTACTTTTTCAGATATCCATAGG - Intergenic
1099340942 12:81432838-81432860 GTACTTTAACAAATACTTATTGG - Intronic
1099445444 12:82746409-82746431 TTAATTGAACACATATTTATGGG + Intronic
1099648607 12:85394799-85394821 TTCCTATAACAAATATTTATTGG + Intergenic
1099780314 12:87186047-87186069 TTGTGTGAACAGATATCTATAGG + Intergenic
1099819068 12:87686490-87686512 TTCATTTAACAAATATTTATTGG + Intergenic
1100598992 12:96096494-96096516 TTCATTTAAGAGATATTTATTGG - Intergenic
1100668924 12:96788377-96788399 TTCATTTCACAGATATGTATTGG - Intronic
1101018966 12:100532171-100532193 TTACTTTCATAGATCTTTATTGG - Intronic
1103056074 12:117821726-117821748 TTATTTTAACAAATATGAATTGG + Intronic
1103349494 12:120273789-120273811 TTATTTTAAAAGATATCTGTAGG - Intergenic
1106882970 13:34151909-34151931 TCATTTTAACAAATATATATTGG + Intergenic
1107043260 13:35970807-35970829 TTAATTTCACAGATATCTTGTGG + Intronic
1109362825 13:61318922-61318944 TTCCTCTAACAAATATTTATTGG + Intergenic
1109550654 13:63894866-63894888 TCACTTTAGCAGCAATCTATGGG - Intergenic
1109580185 13:64320649-64320671 TTCATTTAGCAGATATTTATTGG - Intergenic
1109602682 13:64653100-64653122 TTCCTTTGATAGATATTTATTGG - Intergenic
1109735187 13:66474454-66474476 TTAATTTGGCAGATATTTATTGG - Intronic
1110065643 13:71101954-71101976 TTATTTTAAGAGACATCTAGTGG - Intergenic
1110248133 13:73351126-73351148 TTTGTTTAACATATATTTATGGG - Intergenic
1110807733 13:79777163-79777185 ATTCTTTAACAGGCATCTATAGG - Intergenic
1111816106 13:93154739-93154761 TTACTTTGACAAATATCTATTGG - Intergenic
1111870039 13:93819819-93819841 TTACTTTAAAAGATATCTTTGGG + Intronic
1112162309 13:96881016-96881038 TTGCTTTTGCAGATATCTAGTGG - Intergenic
1112174970 13:97013112-97013134 TTATTCTAACAGAAATCCATTGG - Intergenic
1112728377 13:102330923-102330945 TTTATTTAACACATATTTATTGG - Intronic
1112998810 13:105607261-105607283 TTACTTAAAAAAATATCTACTGG - Intergenic
1114382650 14:22224305-22224327 ATACTTTTACAGCTATTTATAGG + Intergenic
1114949705 14:27734479-27734501 CAACTTTAACAGATAACTGTAGG - Intergenic
1115044271 14:28971647-28971669 ATACTTTAAAATATATCTTTTGG + Intergenic
1115082526 14:29474065-29474087 TTTCTTTAACAGATGTGTCTTGG + Intergenic
1115772504 14:36680503-36680525 ATACTTTAAAAAATGTCTATAGG - Exonic
1116303746 14:43220983-43221005 ATCCTTTAAAACATATCTATAGG - Intergenic
1116331897 14:43607344-43607366 TTGCTTGAAAAGATATTTATGGG + Intergenic
1116818167 14:49602445-49602467 TTACTTAGACAGATATCCACAGG - Exonic
1116909554 14:50445217-50445239 GTACTTTAACAGTTATCATTAGG + Intronic
1117083673 14:52177800-52177822 TTCATTTAACAGATATTTACTGG - Intergenic
1117391089 14:55263632-55263654 TTAATTCAACAGATATTTATTGG + Intergenic
1118006689 14:61569646-61569668 TGCCTTTTACAGATATTTATAGG - Intronic
1118152991 14:63209812-63209834 ATTCCTAAACAGATATCTATTGG - Intronic
1118390809 14:65293777-65293799 TTAATTCAATAAATATCTATAGG + Intergenic
1118579205 14:67276517-67276539 TGAGTTGAACAGATATTTATTGG + Intronic
1119305026 14:73600829-73600851 GTTCTTAAACAGATATCTAGAGG - Intergenic
1119341359 14:73881575-73881597 TTAATTTAACAAATATTTATGGG + Intronic
1121902336 14:97705137-97705159 TGACTTTCACAGATATATAGAGG - Intergenic
1126543435 15:49846218-49846240 TTACTTTAAGGAATATATATGGG + Intergenic
1128219136 15:65955441-65955463 TTACTTAAACAAATATATTTAGG + Intronic
1129351914 15:74960471-74960493 GAACCTTAACAGATATGTATTGG - Intronic
1133598060 16:7312066-7312088 TTTCTTTATCAAACATCTATAGG - Intronic
1137362296 16:47829730-47829752 TTGCTTTACCACACATCTATGGG - Intergenic
1137859500 16:51831905-51831927 TTCCTTCAACAGATATTTGTGGG - Intergenic
1138001854 16:53289135-53289157 TTACTTTAAAAAATTTCAATAGG - Intronic
1138580578 16:57938293-57938315 TAACTTCAACACATATTTATAGG - Intronic
1138922588 16:61550171-61550193 TTACTTTTTAAGATATATATGGG - Intergenic
1139330470 16:66185081-66185103 TTACTTTCAATGATATCTTTTGG + Intergenic
1140169994 16:72594791-72594813 TCACTTTAAAATATATATATAGG + Intergenic
1142329923 16:89445275-89445297 TTTCTTTAACTAATATATATAGG + Intronic
1146310007 17:31760928-31760950 TTACTTTAACAGACATCAGCTGG + Intergenic
1147469544 17:40647170-40647192 TTTCTTGAACAAATATTTATCGG - Intronic
1150256031 17:63745264-63745286 TCACTTTAATAGATGTCCATAGG + Exonic
1150358687 17:64509773-64509795 ATACTTTAACCCATAACTATGGG - Intronic
1150360572 17:64530081-64530103 TTACTTTAACATATATAATTGGG - Intronic
1151109461 17:71658474-71658496 TGACTTTAAAAAATATCTTTGGG - Intergenic
1153116746 18:1666329-1666351 TTACTGTGAGAGCTATCTATGGG + Intergenic
1153412170 18:4805706-4805728 TTCATTTAACAAATATTTATTGG + Intergenic
1153621667 18:6984691-6984713 TTACTTTAACTTATATTTTTTGG - Intronic
1153923738 18:9814237-9814259 TTAATTTAGCAGATAAATATGGG - Intronic
1154028498 18:10728291-10728313 TTACTTTAATAGATATTTTTCGG - Intronic
1156062455 18:33096968-33096990 TTACCTCAACTGATATCTCTCGG - Intronic
1156737888 18:40284421-40284443 TTATTTTCATAAATATCTATGGG - Intergenic
1156845937 18:41665322-41665344 TTATTTTAACTGACATTTATGGG + Intergenic
1157146746 18:45171028-45171050 TGACTCAAACAGAGATCTATAGG + Intergenic
1157681883 18:49613818-49613840 TTTCTTTAATAGATATTCATTGG - Intergenic
1158302778 18:56070812-56070834 TTACTTAAACAGATCCCTCTGGG - Intergenic
1158376705 18:56878490-56878512 TTAATTTAACAAATATTTATTGG - Intronic
1159146379 18:64458865-64458887 TTACTTTAACAAATACATGTGGG - Intergenic
1159259773 18:65998791-65998813 TTATCTTAACGTATATCTATAGG + Intergenic
1159328155 18:66950523-66950545 TTAATTTAAAAGATATCAGTAGG - Intergenic
1159725023 18:71946485-71946507 TTAGTGTATTAGATATCTATTGG + Intergenic
1159812809 18:73036827-73036849 TTTCTTTACCAGATATGTAGGGG + Intergenic
1163092934 19:15033825-15033847 TTATTATAACAAATATATATGGG - Intergenic
1163208904 19:15825643-15825665 TCACTTTACCATATATATATGGG - Intergenic
1163502487 19:17685145-17685167 GGACCTTAACAGATATGTATGGG + Intronic
1164490435 19:28707422-28707444 TTTCTTTATCAGGTATTTATAGG + Intergenic
1164897207 19:31887316-31887338 GTAATTTAACAGATGTATATAGG + Intergenic
1167391383 19:49197145-49197167 GAAGTTTAACAGATATTTATGGG + Intronic
1168442188 19:56379177-56379199 TTATTTTAACAAATTTCTCTAGG + Intronic
1168709588 19:58491257-58491279 TTACTTTAAAATAAATGTATGGG - Intronic
927124203 2:19998453-19998475 TTACTTTAAAATATATAAATAGG + Intronic
927536501 2:23865169-23865191 AAACTTTAATAGGTATCTATAGG + Intronic
928069513 2:28200732-28200754 CTAGTTTACCAGGTATCTATGGG + Intronic
928322994 2:30298025-30298047 TTAATTTAAGAGCTATTTATGGG - Intronic
929151680 2:38754425-38754447 TAAATTTAACAGATTTCTAGAGG - Intronic
930139589 2:47938433-47938455 TTGATTTAAAAGATCTCTATTGG + Intergenic
931495935 2:62807220-62807242 TTACACAAACTGATATCTATTGG + Intronic
931680477 2:64743361-64743383 TTAATTCAACAGATATTTATTGG - Intronic
932079794 2:68703169-68703191 TTTATTTAATAGATATATATGGG - Intronic
932608856 2:73183693-73183715 TTCATTTAACAAATATCTGTGGG + Intergenic
933596629 2:84289308-84289330 TTACTTCAACAGCTTTCTAATGG - Intergenic
933879054 2:86649745-86649767 TTACTATAACTGCTTTCTATAGG + Intronic
934458415 2:94194895-94194917 TTTCTTTCACAGTTATCTGTTGG - Intergenic
936767369 2:115869328-115869350 TTTATTTAACAAATATATATTGG - Intergenic
940031955 2:149272891-149272913 TTTATTTAACAAATATCTATGGG - Intergenic
940105921 2:150100149-150100171 TTACTTTTAAAGATAGCAATTGG + Intergenic
941374741 2:164713574-164713596 TGACTTTAAGAGAAATCTAGTGG - Intronic
943149331 2:184091674-184091696 TCACTTAACCAGATATCCATTGG + Intergenic
943171863 2:184411906-184411928 TGACTTTAAAATATATCCATTGG - Intergenic
944149305 2:196540337-196540359 TGACATTAACAGATTTCTCTAGG - Intronic
944280118 2:197886100-197886122 TTACTTTAAAGGATATGTGTTGG - Intronic
944906524 2:204267236-204267258 GTACTTTAAGATATATCAATAGG + Intergenic
946350949 2:219152115-219152137 TCAATTCAACAGATATCTACTGG + Intronic
947431703 2:230034372-230034394 ATACTTTAACGGTTATCTATTGG + Intergenic
947847343 2:233255467-233255489 TTACGCTAACAGATCTGTATTGG - Intronic
1169579727 20:7006542-7006564 GTATTTTCACATATATCTATTGG - Intergenic
1170187584 20:13608401-13608423 TTAATTCAACAAATATTTATTGG + Intronic
1171802868 20:29642704-29642726 TTAATTTTACAGAAATATATTGG - Intergenic
1173097743 20:40053102-40053124 TTTGTTTAACTGATATCTCTGGG - Intergenic
1173680077 20:44872719-44872741 TTACTTTTAGCAATATCTATTGG - Intergenic
1175067421 20:56301336-56301358 TGATTATAACAGATATCTCTTGG - Intergenic
1177874453 21:26614067-26614089 AGACTTTGACAGATATCTATAGG + Intergenic
1177928102 21:27244338-27244360 TTACATTTACAGATTTCCATAGG + Intergenic
1180059655 21:45378237-45378259 TTCCTTTAACAAATAAATATTGG - Intergenic
949360507 3:3227384-3227406 TTACTTTAAAAATTATTTATAGG - Intergenic
949714646 3:6915536-6915558 TTACTTTAACAAAAATCGCTTGG + Intronic
949780878 3:7686534-7686556 TTACCTGAAAATATATCTATAGG + Intronic
951182459 3:19674452-19674474 GCATTTTAACAGAAATCTATAGG - Intergenic
951371474 3:21855144-21855166 TTACTTTCAGAGATAGGTATGGG - Intronic
951385337 3:22034948-22034970 ATACTTTAAAACATATCAATAGG + Intronic
951940345 3:28071171-28071193 ATACTTTAAAAGATATTTCTTGG - Intergenic
952308616 3:32167973-32167995 TTACTTTAAAAGATATATAAAGG + Exonic
952778570 3:37070876-37070898 TTTCTTTAACACAGATCTGTAGG - Intronic
955537619 3:59941047-59941069 TTCATTTAACACATACCTATTGG - Intronic
955757474 3:62240036-62240058 TTCCTTTAATAACTATCTATTGG - Intronic
955903529 3:63782970-63782992 TTATTTTAACAGAGATGTGTAGG + Intergenic
955991932 3:64637112-64637134 TGACTTTAACAAATATAAATTGG + Intronic
956353281 3:68362514-68362536 TTGATTTAATACATATCTATTGG + Intronic
956389074 3:68752431-68752453 TCATTTTAACAGACATTTATAGG - Intronic
956813488 3:72887652-72887674 TTTATTCAACAGATATTTATTGG + Intergenic
957602526 3:82356470-82356492 TTAGTTTAGCAAATATTTATTGG + Intergenic
957648920 3:82973708-82973730 TTATTTTAAGAGATATTAATAGG + Intergenic
958846062 3:99265755-99265777 TTATTTTTAAATATATCTATAGG - Intergenic
959693794 3:109227669-109227691 TTCATTTAGCAGATATTTATTGG + Intergenic
960061638 3:113328996-113329018 TTAATTTAGCAAATATTTATTGG - Intronic
960130331 3:114048867-114048889 TTCCTTTAACAAATATTTATTGG - Intronic
960169321 3:114439869-114439891 ATTTTTTAAAAGATATCTATTGG + Intronic
960399761 3:117181873-117181895 TTTATTTAACAAATATTTATTGG - Intergenic
960930875 3:122848207-122848229 TTAGGTTAACAAATATCTATGGG - Intronic
962347815 3:134633086-134633108 TTAATTTAACAAATAGGTATTGG - Intronic
962514553 3:136138230-136138252 TTATTTCAACAGATATTTACTGG + Intronic
963455942 3:145548008-145548030 TTTCTTTGACAAATTTCTATTGG + Intergenic
964055808 3:152455649-152455671 TAAGTTTAACTTATATCTATTGG + Intronic
964640534 3:158905695-158905717 TTACCTAAACAGCTATTTATTGG + Intergenic
965388360 3:168073324-168073346 TTACTTTAACTCATATTTACTGG - Intronic
965977831 3:174646873-174646895 TTATTTTAACATAAATGTATTGG + Intronic
966319589 3:178686365-178686387 TTTCTTTAAAAGTGATCTATTGG + Intronic
966788313 3:183640065-183640087 TAACTATATCATATATCTATAGG + Intronic
968145382 3:196293974-196293996 TTAATTTATCAGCTATCTTTGGG - Intronic
971302778 4:25455763-25455785 TTCATTCAACAGATATATATTGG + Intergenic
971552256 4:27972677-27972699 TTAGTTCAACAGATACCTGTGGG - Intergenic
971832050 4:31707106-31707128 TTAATTCAACAAATATGTATTGG - Intergenic
971871647 4:32248047-32248069 TGACTTAAAAAGATATTTATAGG + Intergenic
971975834 4:33685217-33685239 TTAATTTATCAGATATGTATAGG - Intergenic
973064940 4:45778114-45778136 GTACTTTAACAACTATTTATTGG + Intergenic
973810937 4:54569652-54569674 TTTATTTAACAAATATTTATTGG + Intergenic
974169467 4:58247083-58247105 TTTCTTTCACAGATTGCTATGGG + Intergenic
974661670 4:64898582-64898604 TTAATTTAAATGATATATATTGG - Intergenic
974692981 4:65324680-65324702 TTTATATAACAGATATCTTTAGG + Intronic
974861195 4:67523620-67523642 TTACATTTAAAGATATTTATAGG + Intronic
976126779 4:81841583-81841605 TTATTTTATCAAACATCTATTGG - Intronic
976667882 4:87619446-87619468 TTACTTTAAGAAATATTTAGAGG + Intergenic
976930655 4:90562870-90562892 AAACTTTAAAAGATATCTTTAGG - Intronic
977093065 4:92703843-92703865 TTACTTTTGTATATATCTATTGG + Intronic
977115535 4:93020730-93020752 TTTCTTTAAAAGAAATATATGGG + Intronic
977839570 4:101686162-101686184 TTAATTCAACAAATATGTATTGG + Intronic
978567901 4:110103762-110103784 TTCCATTAACTGATATCTTTTGG - Intronic
979203471 4:118007148-118007170 TTGCTTTATCAGATGTATATGGG - Intergenic
979452032 4:120884135-120884157 TTACTTTAAAAGATTTATATAGG + Intronic
979863796 4:125727731-125727753 TTAATATAACAGATCTCTAAAGG + Intergenic
980078677 4:128320980-128321002 TAAATTTAACAGATATGTACAGG + Intergenic
980783221 4:137518297-137518319 TTACCTTAATAGTTATCTATTGG + Intergenic
981294857 4:143120184-143120206 TAAATTTAACAAATATTTATGGG - Intergenic
981903987 4:149898639-149898661 CTACTTTAAAATATATCTATAGG - Intergenic
983015140 4:162604369-162604391 TTATTTTAACAAATTTCTGTAGG + Intergenic
983032463 4:162820051-162820073 TTACTTTAAAATATTTTTATTGG - Intergenic
983465671 4:168085745-168085767 TTACTTTACCATATATGTATGGG - Intergenic
983771381 4:171553662-171553684 CTATTTTAACAAATATCTAGAGG + Intergenic
984124455 4:175789651-175789673 TTATGTTAACAGTTATCTACCGG + Intronic
984174919 4:176405496-176405518 TTAATTTAAAAGATATATTTTGG - Intergenic
984666622 4:182436129-182436151 TTGCTTTAACAGATGCCTTTAGG + Intronic
985855629 5:2423173-2423195 TTTCTTTATCAAATATCTAAGGG + Intergenic
986223635 5:5792990-5793012 TTAATTCAACAAATATTTATTGG - Intergenic
986897584 5:12388862-12388884 TTTCTTTTACAGAGATTTATTGG + Intergenic
986955057 5:13140367-13140389 ATACGCTAACAGGTATCTATAGG + Intergenic
987084874 5:14459028-14459050 ATTCTTTAACAGATATCAATGGG + Intronic
987968679 5:24911731-24911753 TTAATTTAAAAAATATATATTGG - Intergenic
990724021 5:58733456-58733478 CTAATTTGCCAGATATCTATTGG + Intronic
994422877 5:99544134-99544156 TTACGGTAACAGATATGTACAGG + Intergenic
994933406 5:106218654-106218676 TTTATTTAACACATATTTATGGG - Intergenic
994990756 5:106993950-106993972 TTACTTTAGCCTATATTTATTGG + Intergenic
995004677 5:107177814-107177836 TTGATTTGACAGATATTTATTGG + Intergenic
995664231 5:114523074-114523096 TTAATTGAACAGAAATTTATTGG + Intergenic
996250372 5:121321641-121321663 TTACTGTATCAGATATGTACTGG + Intergenic
996468905 5:123836629-123836651 TTACTTTAACAAATATTTTAAGG + Intergenic
997301681 5:132810800-132810822 TTATTTCAACAAACATCTATTGG - Intergenic
999637805 5:153640805-153640827 TAAATTCAACAGATATTTATTGG - Intronic
999815889 5:155175629-155175651 TTACTTTAACATTTATATGTTGG + Intergenic
1000338909 5:160261918-160261940 TTCATTTAACAAATATTTATTGG - Intronic
1000685972 5:164249790-164249812 TTACTTTAACAGAATTTTTTTGG + Intergenic
1000709902 5:164560111-164560133 TTATTTCCACACATATCTATGGG + Intergenic
1000729915 5:164821268-164821290 TTACTTAGACAAATATTTATGGG + Intergenic
1000807543 5:165814886-165814908 TTTCTTTAATATATATCTACTGG - Intergenic
1001168713 5:169395710-169395732 TTATTTTAAAAAATATTTATCGG + Intergenic
1001675706 5:173513129-173513151 TTTATTTAATAGATATTTATTGG - Intergenic
1003073792 6:2965771-2965793 TTATTTTAACAGTTTCCTATGGG + Intronic
1003331628 6:5134391-5134413 TGTCTTTAAAAGAAATCTATAGG - Intronic
1003674303 6:8188840-8188862 TTACCTTCACAGACATCAATGGG - Intergenic
1003723146 6:8728210-8728232 ATACTTTAAAAAATATCCATAGG + Intergenic
1004062442 6:12210974-12210996 TTACTTTTACATATATATGTGGG + Intergenic
1004758398 6:18638730-18638752 GTACTTTAACAGAAATCCAAAGG + Intergenic
1005164580 6:22905003-22905025 TTAGTTTATAAGCTATCTATGGG + Intergenic
1005179606 6:23089599-23089621 TTCATTTAACAAATATTTATTGG - Intergenic
1005465329 6:26107355-26107377 TTTCTGTGACAGTTATCTATAGG - Intergenic
1007044819 6:38762260-38762282 TAACTTTAAAAAATATCTCTTGG - Intronic
1008181869 6:48341016-48341038 TTATTTTAAAAGGTGTCTATTGG - Intergenic
1008456832 6:51720901-51720923 TTTCTTCAACAGATACTTATTGG - Intronic
1008750439 6:54727583-54727605 TTAATTTAACAGATGTTTACAGG + Intergenic
1008938169 6:57015431-57015453 TTGTTTTATCAGATAACTATTGG + Intronic
1010031651 6:71277448-71277470 TTAATTTAATAAATATATATTGG - Intergenic
1011154908 6:84320135-84320157 TTAATTTACCAGGTATTTATTGG + Intergenic
1011363926 6:86559464-86559486 TTCATTTAACAAATATTTATTGG - Intergenic
1011587599 6:88943486-88943508 TTAGTTTAACAGATATATAGTGG + Intronic
1012282579 6:97346144-97346166 TAAATTTAACATATATTTATTGG + Intergenic
1012573102 6:100755991-100756013 TTATGTTAACAGATATCATTAGG + Intronic
1013135801 6:107281856-107281878 TTCATTTAACAGATATTTATAGG - Intronic
1013248777 6:108313838-108313860 TTGAGTTAAGAGATATCTATGGG - Intronic
1014294898 6:119606096-119606118 TAATTTTACCAGATATCTAGAGG + Intergenic
1014438802 6:121450076-121450098 TTATTTAAACACATTTCTATTGG + Intergenic
1015452712 6:133389506-133389528 TTCATTTAACAGATATGTACTGG - Intronic
1015741530 6:136460108-136460130 TTACTTTAATGGATGTCTTTAGG - Intronic
1016695507 6:146989912-146989934 ATCCTTTAACAGATAGCTATAGG - Intergenic
1017543546 6:155427399-155427421 TTAGTTTGACAAATATTTATTGG - Intronic
1017588726 6:155955107-155955129 TTACTTTAACAGACACAAATTGG + Intergenic
1017668373 6:156744150-156744172 TTTATTAAACAAATATCTATTGG - Intergenic
1018274484 6:162116016-162116038 ATACTTTAAAAGATATAGATAGG + Intronic
1018519476 6:164631313-164631335 TTACTTTTTCAAATATATATTGG + Intergenic
1019793412 7:3032366-3032388 TTGCTTTAAAAGTCATCTATAGG - Intronic
1021496860 7:21284525-21284547 TTTATTCAACAGATATTTATTGG + Intergenic
1021925962 7:25533832-25533854 TGATTGTAACAAATATCTATTGG - Intergenic
1023264400 7:38391298-38391320 TTAATTTACCAAATATTTATGGG + Intronic
1023575713 7:41624093-41624115 TTAATTCAACATATATTTATTGG - Intergenic
1027476267 7:78635505-78635527 TTTCTTTAGCAAATATGTATTGG - Intronic
1028487757 7:91378588-91378610 TTAATTTGACAAATATTTATTGG + Intergenic
1028863781 7:95684050-95684072 TTACTTTAAAATAAATTTATTGG - Intergenic
1030212214 7:107007614-107007636 TTACTTTCAGAGACAACTATGGG + Intergenic
1030542824 7:110853578-110853600 TTTCTTTAAAAGATCTCTAAAGG - Intronic
1031523967 7:122801352-122801374 TTAATGTAACAGATTTCTTTAGG - Intronic
1031637980 7:124124736-124124758 TTATTTTAACACACATTTATTGG + Intergenic
1031893374 7:127321042-127321064 TTATTTTAACAAATATCTCAAGG + Intergenic
1031961223 7:127991711-127991733 TTTCTTTTACAGTCATCTATAGG + Intronic
1033063811 7:138133388-138133410 TTACTTGATCATATATGTATTGG + Intergenic
1034409044 7:150928468-150928490 ATACCTTAACAGTTATCTATGGG + Intergenic
1036292912 8:7510820-7510842 TGGCTTTAAGAGATTTCTATAGG - Intergenic
1036329649 8:7810188-7810210 TGGCTTTAAGAGATTTCTATAGG + Intergenic
1036567846 8:9952801-9952823 GTACTCTACCAGATATCTGTGGG + Intergenic
1038763993 8:30410534-30410556 TGACTTTAAAATATATATATAGG + Intronic
1039628570 8:39082213-39082235 TTACTATGACAGATATCAAAAGG - Intronic
1040653560 8:49478139-49478161 TGACTTTCACAGTTATCTATGGG + Intergenic
1041202117 8:55460453-55460475 TTTCTTTGATAAATATCTATTGG - Intronic
1041267940 8:56083144-56083166 TTATTTTCACAGACATGTATAGG - Intergenic
1042455363 8:68995708-68995730 TTACTTTAGCAGTTTTCTTTGGG - Intergenic
1042524685 8:69751845-69751867 TTCCTTAAACAGAAAACTATTGG - Intronic
1042892901 8:73633099-73633121 TTCATTTAACAGATATGTAGTGG - Intronic
1043178886 8:77058396-77058418 TAACTTTAATATATATTTATGGG + Intergenic
1044153218 8:88808866-88808888 TTATTTCAACAAATATTTATCGG - Intergenic
1044261717 8:90132440-90132462 TTCATTCAACAGATATTTATTGG + Intergenic
1044517925 8:93161214-93161236 TTACTGAATCAGATATCTCTGGG + Intronic
1044647140 8:94455961-94455983 GGACTTTAACATATATCTTTAGG + Intronic
1046054225 8:109060146-109060168 TTAATTCAACAAATATTTATTGG - Intergenic
1046832924 8:118766443-118766465 TTACTTTTACAGCTATAAATGGG - Intergenic
1046866289 8:119154329-119154351 TTAATTTAACAGATAGGAATTGG + Intergenic
1050728846 9:8684127-8684149 TTACTATCACAGATTTCTATAGG - Intronic
1052086193 9:24268788-24268810 TTGCTTTTACAGATTTCTCTGGG + Intergenic
1052651601 9:31310551-31310573 ATACTTAAGCAGATATCTAACGG + Intergenic
1052783146 9:32801753-32801775 TTACTTTAGCAGATATGGTTGGG - Intergenic
1053688923 9:40570716-40570738 TTTCTTTCACAGTTATCTGTTGG - Intergenic
1054300163 9:63371643-63371665 TTTCTTTCACAGTTATCTGTTGG - Intergenic
1055590464 9:77807663-77807685 GTACTCTAAAAGATATCTCTGGG + Intronic
1056046191 9:82719651-82719673 TTAATTCAACAAATATTTATTGG + Intergenic
1057570374 9:96199790-96199812 TTACCTTAACAGATTCCTTTGGG - Intergenic
1058000290 9:99857986-99858008 TCAATTTAACAGATATTTATTGG + Intronic
1059254580 9:112917937-112917959 TTACTTTGACACATATTTCTTGG + Intergenic
1185768195 X:2743429-2743451 TTCCTTTAGCAAATACCTATAGG - Intergenic
1186898698 X:14030826-14030848 TAACTTTAACAAATATTTACTGG + Intergenic
1187498661 X:19819080-19819102 TTTCTTTAACAGTTAGTTATAGG + Intronic
1188063433 X:25628870-25628892 TTACTTTTACAGAAAACTACCGG - Intergenic
1188104237 X:26129744-26129766 TTAATTTGACAGCTATTTATTGG - Intergenic
1188348215 X:29094455-29094477 TTACTTAAAGAAACATCTATTGG + Intronic
1188937026 X:36189054-36189076 TTACTTTATGAAATAACTATAGG + Intergenic
1188951444 X:36379996-36380018 TGACTTTAACAGATAATTACTGG - Intronic
1189288991 X:39872048-39872070 TCACTTTAACAAATAGATATTGG - Intergenic
1190421414 X:50288300-50288322 ATAATTTAACAAATATCTAAGGG - Intronic
1191957635 X:66662489-66662511 TTACTTTAACAAATGTTTGTGGG - Intergenic
1192794369 X:74413803-74413825 TTTATTTAACAAATATGTATTGG - Intergenic
1193411850 X:81173962-81173984 TTAATTTAACACATATCTCCAGG - Intronic
1193935891 X:87620945-87620967 TTACTGTAGCAGATGTCTCTGGG - Intronic
1194254253 X:91617239-91617261 TTACCTTAACACTTATTTATTGG + Intergenic
1195155066 X:102114906-102114928 TTATTTCAACAGATATTTATTGG + Intergenic
1195965491 X:110426613-110426635 TCATTTTAACAAATATGTATAGG - Intronic
1196057225 X:111368746-111368768 TTAATTTAAGAGATAACTAGGGG - Intronic
1196881429 X:120201282-120201304 TTTGTTTTACAGATATCCATAGG - Intergenic
1197979752 X:132203123-132203145 TTACTTTTACAAATCTTTATAGG + Exonic
1198516950 X:137418370-137418392 TTCCTTCTACAGATATTTATTGG - Intergenic
1199036877 X:143061869-143061891 TTACCTTAACATATATATGTGGG + Intergenic
1199191179 X:144972957-144972979 TTAATTCAACAAATATTTATTGG - Intergenic
1199313265 X:146346396-146346418 TTATTTTAACTGATATCTTTTGG + Intergenic
1200573044 Y:4856818-4856840 TTACCTTAACACTTATTTATTGG + Intergenic